Cellular and subcellular localization of EFA6C ... - Wiley Online Library

Journal of Neurochemistry, 2005, 93, 674–685

doi:10.1111/j.1471-4159.2005.03072.x

Cellular and subcellular localization of EFA6C, a third member of the EFA6 family, in adult mouse Purkinje cells Shigetsune Matsuya,*, Hiroyuki Sakagami,*,§ Akira Tohgo,à Yuji Owada,* Hye-Won Shin,¶ Hiroshi Takeshima,à Kazuhisa Nakayama,¶ Shoichi Kokubun and Hisatake Kondo* Division of Histology, Departments of *Cell Biology, Orthopaedic Surgery and àBiochemistry, Tohoku University Graduate School of Medicine, Sendai, Japan §Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Corporation, Kawaguchi, Japan ¶Graduate School of Pharmaceutical Sciences, Kyoto University, Yoshida-shimoadachi, Sakyo-ku, Kyoto, Japan

Abstract EFA6C is a third member of the EFA6 family of guanine nucleotide exchange factors (GEFs) for ADP-ribosylation factor 6 (ARF6). In this study, we first demonstrated that EFA6C indeed activated ARF6 more selectively than ARF1 by ARF pull-down assay. In situ hybridization histochemistry revealed that EFA6C mRNA was expressed predominantly in mature Purkinje cells and the epithelial cells of the choroid plexus in contrast to the ubiquitous expression of ARF6 mRNA throughout the brain. EFA6C mRNA was already detectable in the Purkinje cells at embryonic day 13, increased progressively during post-natal development and peaked during post-natal

second week. In Purkinje cells, the immunoreactivity for EFA6C was localized particularly in the post-synaptic density as well as the plasma membranes of the cell somata, dendritic shafts and spines, while the immunoreactivity in their axon terminals in the deep cerebellar nuclei was very faint. These findings suggest that EFA6C may be involved in the regulation of the membrane dynamics of the somatodendritic compartments of Purkinje cells through the activation of ARF6. Keywords: adenosine diphosphate ribosylation factor 6, dendrite, guanine nucleotide exchange protein, mouse, Purkinje cell, spine. J. Neurochem. (2005) 93, 674–685.

ADP ribosylation factors (ARFs) belong to a family of Ras-related small GTPases. The six isoforms so far identified in mammals can be classified into three classes based on their structural similarities: Class I (ARF1-3), Class II (ARF4-5), and Class III (ARF) (Boman and Kahn 1995; Donaldson and Jackson 2000). In contrast to wellestablished involvement of ARF1 in the vesicle formation and transport between the endoplasmic reticulum and Golgi complex, ARF6 appears to regulate the rearrangement of cortical actin cytoskeleton as well as the membrane trafficking at the plasma membrane based on the findings obtained from non-neural cells (D’Souza-Schorey et al. 1995; Peters et al. 1995; Radhakrishna and Donaldson 1997). As for its neuronal functions, ARF6 has recently been shown to regulate a variety of neuronal processes including exocytosis and endocytosis of pre-synaptic vesicles, receptor internalization, proliferation, migration, and neurite formation (Galas et al. 1997; Claing et al. 2001; Hernandez-Deviez et al. 2002, 2004; Vitale et al. 2002; Krauss et al. 2003; Sheen et al. 2004).

Like other small GTPases, ARFs function as a molecular switch by cycling between two distinct conformational states, GTP-bound active and GDP-bound inactive states. The activation of ARFs is mediated by guanine nucleotide

674

Received August 9, 2004; revised manuscript received December 15, 2004; accepted December 17, 2004. Address correspondence and reprint requests to Hiroyuki Sakagami, Division of Histology, Department of Cell Biology, Tohoku University Graduate School of Medicine, Sendai, Japan. E-mail: [email protected] Abbreviations used: ARF, ADP-ribosylation factor; ARNO, ARF nucleotide-binding-site opener; DAPI, 4¢6-diamidino-2-phenylindole; DMEM, Dulbecco’s modified Eagle’s medium; EFA6, exchange factor for ARF6; GAP, GTPase activating protein; GAT, GGA and TOM1 homologous; GEF, guanine nucleotide exchange factor; GGA, Golgilocalized gamma-ear-containing ARF-binding protein; GRP1, general receptor for phosphoinositides 1; GST, glutathione S-transferase; PB, sodium phosphate-buffer; PBS, sodium phosphate-buffered saline; PVDF, polyvinyl difluoride; SDS–PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; SSC, sodium chloride and sodium citrate solution.

2005 International Society for Neurochemistry, J. Neurochem. (2005) 93, 674–685

Somatodendritic localization of EFA6C in Purkinje cells 675

exchange factors (GEFs) that facilitate the exchange of the bound GDP for GTP, whereas the inactivation of ARFs is mediated by GTPase activating proteins (GAPs) that enhance the intrinsic hydrolysis of the bound GTP to GDP. ARF GEFs have thus far identified share the Sec7 domain that is critical for GEF activity and can be classified into several groups based on structural similarities and functional differences: the Gea/ Gnom/GBF family, Sec7/BIG family, ARNO/cytohesin/GRP family, EFA6 family, ARF-GEP100 (Someya et al. 2001), synArfGEF(Po) (Inaba et al. 2004; reviewed by Donaldson and Jackson 2000; Jackson and Casanova 2000; Jackson et al. 2000). Of these, EFA6, cytohesin-1, ARNO, GRP1, and ARFGEP100 have been shown to be able to activate ARF6 (Frank et al. 1998; Franco et al. 1999; Langille et al. 1999; Knorr et al. 2000; Someya et al. 2001; Derrien et al. 2002). The EFA6 family was originally identified as a new member of ARF GEFs that preferentially activate ARF6 and it has recently been shown to consist of at least four isoforms, EFA6A, -B, -C, and -D, although only EFA6A and -B have been biochemically characterized in detail (Franco et al. 1999; Derrien et al. 2002). Because the activation of ARF6 is strictly dependent on ARF GEFs, the information on the cellular and subcellular localization of each ARF GEF is crucial to understand what roles ARF6 plays in the brain. In this context, we have previously shown that each ARF GEF exhibits a distinct spatial and temporal expression pattern in the brain (Suzuki et al. 2001). Particularly, EFA6A mRNA is expressed predominantly in the forebrain structures including the olfactory bulb, cerebral cortex, striatum, and hippocampal formation and localized in the dendrites as well as cell somata of the hippocampal neurons. Furthermore, the overexpression of a dominant negative mutant of EFA6A prominently induces the dendritic formation in primary hippocampal neurons (Sakagami et al. 2004). Taken together with the recent finding that ARF6 regulates the dendritic formation (HernandezDeviez et al. 2002), it is suggested that the EFA6-ARF6 pathway plays critical roles in hippocampal dendritogenesis. Previous northern blot analysis with human tissues has demonstrated that the expression of EFA6A and -C is restricted to the brain, whereas EFA6B is expressed widely in various tissues outside the brain (Derrien et al. 2002). However, no information is available on the cellular and subcellular localization of EFA6C in the brain. To gain the clue to understand the functional significance of EFA6C in the brain, the present study characterized its biochemical properties and expression in the mouse brain at mRNA and protein levels. Materials and methods Animals C57BL/6 mice used in this study were handled in accordance with the guidelines regarding the Care and Use of Laboratory Animals of Tohoku University Graduate School of Medicine.

Mammalian expression vectors To construct the mammalian expression vector for EFA6C (pCAGGS-FLAG-EFA6C), the entire coding region of EFA6C was amplified by PCR with specific primers that create restriction enzyme EcoRI sites at both ends (sense: TGAATTCATGGATGAAGAGAAGCTCCCATGTGAGC; antisense: GGAATTCCTAAGTATCAGATGCAGAGGTATCCTTTG). After the PCR fragment was digested with EcoRI, the fragment was ligated into EcoRI site of pCAGGS downstream of the FLAG epitope sequence in frame (Niwa et al. 1991; Sakagami et al. 2004). A mutant of EFA6C, in which glutamate at 374 amino acid residue in its putative Sec7 domain of EFA6C was substituted by lysine, was created by using GeneEditor in vitro site-directed mutagenesis system (Promega, Madison, WI, USA) with a mutagenic oligonucleotide: 5¢-GCTGATGGGGAAGACACAGGAAC-3¢ in accordance with the manufacturer’s protocol. The mammalian expression vector for rat EFA6A (pCAGGS-FLAG-EFA6A) has been described previously (Sakagami et al. 2004). Double immunostaining of FLAG-EFA6C and ARF1-HA or ARF6-HA in HeLa cells HeLa cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum. They were transfected with an expression vector for wild-type ARF1-HA or ARF6-HA (Hosaka et al. 1996) together with pCAGGS-FLAGEFA6C (0.5 lg each) by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) and fixed with 4% paraformaldehyde for 10 min 24 h after transfection. The cells were immunostained with anti-FLAG (M2; Sigma-Aldrich, Inc., St Louis, MO, USA) and antiHA (Clontech Laboratories, Inc., Palo Alto, CA, USA) antibodies at a final concentration of 1 lg/mL overnight at 4C and subsequently incubated with Alexa594-conjugated anti-mouse IgG and Alexa488conjugated anti-rabbit IgG (Molecular Probes, Inc., Eugene, OR, USA). The immunoreaction was observed by confocal laser scanning microscopy (LSM5 PASCAL, Carl Zeiss, Jend, Germany). Actin cytoskeleton staining HeLa cells were transfected with pCAGGS carrying FLAG-EFA6C or GEF-defective mutant of FLAG-EFA6C (1 lg/35-mm plate). Twenty-four hours after transfection, the cells were fixed with 4% paraformaldehyde and immunostained with anti-FLAG antibody (M2, Sigma-Aldrich) overnight at 4C. The cells were subsequently incubated with Alexa488-conjugated anti-mouse IgG (Molecular Probes) and Alexa568-conjugated phalloidin for 1 h. To visualize cell nuclei, cells were stained with 4¢6-diamidino-2-phenylindole (DAPI). The immunoreaction was observed by confocal laser scanning microscopy. ARF pull-down assay The GEF activity of EFA6C was determined by a recently developed ARF pull-down assay with GGA1 (Golgi-localized, c-ear-containing ARF-binding protein 1) as described (Shinotsuka et al. 2002). COS-7 cells were transfected with an expression vector for wild-type ARF1-HA or ARF6-HA (Hosaka et al. 1996) together with empty pCAGGS or pCAGGS-FLAG-EFA6C (total 12 lg/10-cm dish, ratio 1 : 3) by using Lipofectamine 2000 (Invitrogen). Twenty-four hours after transfection the cells were harvested in the lysis buffer consisting of the 50 mM Tris–HCl


676 S. Matsuya et al.

(pH 7.5), 100 mM NaCl, 2 mM MgCl2, 0.1% sodium dodecyl sulfate (SDS), 0.5% sodium deoxycholate, 1% Triton X-100, 10% glycerol, and a cocktail of proteinase inhibitors (Complete MiniTM, Roche, Mannheim, Germany). The supernatants were incubated with 40 lL of the GGA1-GAT-glutathione S-transferase (GST) fusion protein (Takatsu et al. 2002) coupled with glutathione-Sepharose 4B (Amersham Biosciences Corp., Piscataway, NJ, USA) for 1 h at 4C while gently rotating. The pellets were washed three times with the lysis buffer and boiled in SDS–PAGE (polyacrylamide gel electrophoresis) sampling buffer. The samples were electrophoresed on a 15% SDS–polyacrylamide gel and transferred onto polyvinyl difluoride (PVDF) membranes (PVDF-PLUS, Osmonics, Inc., Westborough, MA, USA). The membranes were immunoblotted with anti-HA antibody. The immunoreactive bands were visualized with a chemiluminescent reagent (ECL Plus western blotting detection kit, Amersham) and intensities were measured with an imaging analyzer (ChemiDoc XRS; Bio-Rad Laboratories, Hercules, CA, USA). Northern blot analysis Total RNAs were prepared from various tissues of adult C57BL/6 mice by using Trizol Reagent (Life Technologies, Inc., Carlsbad, CA, USA), separated on agarose gels and transferred to nylon filters as described previously (Sakagami et al. 2004). Hybridization was performed overnight at 42C in a solution containing 50% formamide, 1 · Denhardt’s solution, 200 lg/mL heat-denatured salmon sperm DNA, 0.1% SDS, 5 · SSC [1 · SSC: 0.15 M NaCl plus 0.015 M sodium citrate (pH 7.4)], and [32P]-labeled cDNA fragment (nucleotides 1–837). After washing with 0.1 · SSC/0.1% SDS at 50C, the membrane was autoradiographed for 1 week at ) 80C.

In situ hybridization histochemistry In situ hybridization histochemistry was performed as described previously (Sakagami et al. 2004). The oligonucleotide probes corresponding to the nucleotides 667–712 and 2454–2498 for mouse EFA6C and 476–520 for mouse ARF6 (Hosaka et al. 1996) were synthesized and radiolabeled with [35S]-dATP by using terminal deoxynucleotidyltransferase (Takara, Tokyo, Japan). The sections of C57BL/6 mouse brains at embryonic day 13 (E13), E15, E18, post-natal day 0 (P0), P5, P10, P15, P21, and post-natal 7th week (P7W) were hybridized in a solution consisting of 50% deionized formamide, 4 · SSC, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin, 0.02% Ficoll, 1% sodium N-lauroyl sarcosinate (Sarkosyl), 0.1 M sodium phosphate buffer (PB), 100 lg/mL tRNA, 10% dextran sulfate, 100 mM dithiothreitol, and [35S]-labeled oligonucleotide probes (2 · 107 cpm/mL). After washing in 0.1 · SSC/0.1% Sarkosyl, sections were autoradiographed using NTB2 nuclear track emulsion (Eastman Kodak, Rochester, NY, USA) for 1 month at 4C. Production of polyclonal antibody against EFA6C The amino-terminal region (amino acid 1–136) of EFA6C, which has no significant homology among EFA6 family, was amplified by PCR using mouse EFA6C cDNA as template and primers, 5¢-TGAATTCATGGATGAAGAGAAGCTCCCATGTG3¢ and 5¢-CGAATTCGGCACTGAAGCCATCACGTACATCTGG3¢. After purification, the PCR fragment was digested with EcoRI and ligated into the EcoRI site of the pGEX4T-1 expression vector

(Pharmacia LKB Biotechnology, Piscataway, NJ, USA). The GSTEFA6C fusion protein was induced by adding isopropyl b D-thiogalactopyranoside at a final concentration of 0.1 mM and purified with glutathione-Sepharose 4B (Pharmacia LKB Biotechnology). Two New Zealand White rabbits were intradermally injected with 200 lg of the GST-EFA6C fusion protein in Freund’s adjuvant (Difco Laboratories, Detroit, MI, USA) six times at 3-week intervals. The antibody was purified with Protein A-Sepharose (Ampure PA kit, Amersham), followed by affinity-purification with NHS-activated Sepharose (Pharmacia LKB Biotechnology) coupled with the GST-EFA6C fusion protein. Subcellular fractionation Subcellular fractionation from adult mouse cerebella was performed as described previously (Carlin et al. 1980). Briefly, 5 g of mouse cerebella was homogenized in 20 mL of solution A (0.32 M Sucrose, 1 mM NaHCO3, 1 mM MgCl2, 0.5 mM CaCl2) at 1000 rpm for 12 strokes with a motor-operated Teflon-glass homogenizer. The homogenates were diluted to 10% (wt/vol) in solution A and centrifuged at 1400 g for 15 min at 4C, and the supernatant was saved. The pellet was homogenized in the same 10% volume of solution A, and centrifuged at 710 g for 10 min. The supernatant was combined with the saved supernatant and centrifuged at 710 g for 10 min again. The post-nuclear supernatant was further centrifuged at 13 800 g for 10 min. The resultant supernatant was centrifuged at 100 000 g for 1 h, the supernatant and pellet were saved and designated as cytosolic fraction and Golgi/ endoplasmic reticulum (ER) fraction, respectively. The resulting pellet after 13 800 g centrifugation was resuspended with six strokes of the homogenizer in 12 mL of solution B (0.32 M sucrose in 1 mM NaHCO3) and loaded onto a sucrose gradient laying from the bottom of the tube: 0.85, 1.0, and 1.2 M sucrose in 1.0 mM NaHCO3. After centrifugation at 82 500 g for 2 h, the synaptosome (interface 1.0/1.2 M sucrose) was removed and treated for 15 min with 60 mL of 0.5% Triton X-100 in 0.16 M sucrose and 6 mM Tris–HCl (pH 8.1). The suspension was centrifuged at 32 800 g for 20 min. The resultant supernatant was designated as S3 fraction containing small synaptic vesicles and cytosol from the lysed synaptosomal fraction. The pellet was resuspended in 1.25 mL of solution B and loaded onto a sucrose gradient (1.0, 1.5, 2.0 M sucrose in 1 mM NaHCO3). The gradients were spun at 201 800 · g for 2 h. The fraction banded between 1.5 and 2.0 M sucrose was removed and designated as post-synaptic density fraction. The quality of PSD fraction was verified by immunoblot analysis with antibodies against PSD95 (clone K28/86.2, Upstate Biotechnoloy, Inc., Lake Placid, NY, USA), calbindin (Nakagawa et al. 1998), glucose-regulated protein/BiP (GRP78; Affinity BioReagents, Golden, CO, USA), and synaptophysin (clone SVP-38; Sigma). Immunoblot analysis Immunoblot analysis was performed as described previously (Sakagami et al. 1999). Briefly, adult mouse cerebella were immediately homogenized in a buffer containing 10 mM HEPES (pH 7.4), 0.32 M sucrose, 2 mM EDTA and a cocktail of proteinase inhibitor (Complete MiniTM, Roche), then centrifuged at 1000 g to remove the nuclear fraction. The supernatant was subsequently



centrifuged at 200 000 g for 15 min at 4C to yield cytosolic fraction (S2) and membrane fraction (P2). To prepare the lysates of COS-7 cells expressing EFA6C and EFA6A, the cells were transfected with pCAGGS-FLAG-EFA6A or pCAGGS-FLAG-EFA6C by using Lipofectamine 2000 (Invitrogen). Forty-eight hours after transfection, the cells were harvested and lysed with RIPA buffer (50 mM Tris–HCl pH 7.5, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 150 mM NaCl). After centrifugation at 10 000 g for 30 min, the supernatant was used to characterize the specificity of the antibody by immunoblot analysis. The protein concentration of the samples was determined by a commercially available kit (BCA Protein assay reagent kit, Pierce, Rockford, IL, USA). The cerebellar cytosolic and membrane fractions (50 lg), various fractions of adult mouse cerebella (5 lg) and total lysates of COS-7 cells (10 lg) were separated by 10% SDS–polyacrylamide gels and then transferred onto PDVF membranes. The membranes were incubated with polyclonal antibody against EFA6C at the final concentration of 0.1–0.5 lg/mL in phosphate-buffered saline (PBS) containing 0.1% Tween-20 and 5% bovine serum albumin overnight at 4C. After incubation with the peroxidase-conjugated secondary antibody (Amersham, 1 : 5000) at 20C for 1 h, immunoreactive bands were visualized by using a chemiluminescent reagent (ECL-PLUS Western blotting detection kit, Amersham). Immunohistochemistry Five adult male C57BL/6 mice were deeply anesthetized with diethyl ether and perfused transcardially with physiological saline, followed by 50 mL of ice-cold 4% paraformaldehyde in 0.1 M PB. Brains were cryoprotected with 30% sucrose in 0.1 M PB. Sections (50 lm) were made on a cryostat and permeabilized with PBS containing 0.3% Triton X-100 for 30 min. After blocking in PBS containing 5% normal goat serum for 30 min, the sections were incubated in the primary antibodies diluted at the final concentration of 1–2 lg/mL overnight at 4C. After several washes in PBS, the sections were subsequently incubated in biotinylated anti-rabbit IgG (1: 200, Vector Laboratories, Burlingame, CA, USA) in PBS for 1 h, followed by incubation in avidin/biotinylated horseradish peroxidase complex (Vectastain ABC kit, Vector Laboratories). Immunoreaction was developed in 3,3¢-diaminobenzidine tetrahydrochloride (0.01% in 50 mM Tris– HCl, pH 7.5) plus 0.002% H2O2 for 10–15 min. For immunoelectron microscopy, the procedure was the same as described above except for omission of permeabilization with 0.3% Triton X-100. After color development with diaminobenzidine, the sections were post-fixed with 1% osmium tetroxide, followed by block-staining with 2% uranyl acetate. The section were then dehydrated in ethanol and embedded in Epoxy resin. Ultrathin sections were observed with a JEM-1010 electron microscope (JEOL Ltd, Tokyo, Japan). For immunofluorescent staining, immunoreaction was visualized with Alexa 488-conjugated anti-rabbit IgG (1 : 2000, Molecular Probes) as a secondary antibody and observed by confocal laser scanning microscopy (LSM5 PASCAL, Carl Zeiss). For the control experiment, the primary antibody was used after preabsorption overnight at 4C with the EFA6C polypeptide cleaved from GST fusion partner.

Results

Comparison of the amino acid structure of mouse EFA6C with EFA6A and -B BLAST search of the database identified the sequence of the mouse counterpart of human EFA6C (accession number BC062930). We also cloned the cDNA from a mouse brain library and confirmed its sequence to be valid. The cDNA for mouse EFA6C encodes an open reading frame of 770 amino acids with the predicted molecular weight of 84 kDa. Figure 1 showed the comparison of domain structures among the EFA6 family members deposited in the database. Mouse EFA6C protein shares domain structures conserved in the EFA6 family consisting of Sec7 domain, PH domain and coiled-coil motif in an amino-terminal order. The overall amino acid identities of mouse EFA6C with human EFA6C, rat EFA6A and human EFA6B were 88%, 55%, and 49%, respectively. ARF pull-down assay In order to characterize whether EFA6C can catalyze the guanine nucleotide exchange on ARFs in vivo, we performed a recently developed ARF pull-down assay by taking advantage of the ability of GGA1 to bind specifically

Fig. 1 Schematic representation of the domain structure of mouse EFA6C in comparison with the EFA6 family. The domain structure is depicted based on SMART system (http://smart.embl-heidelberg.de; Schultz et al. 2000). A bar shows the region that was used as an antigen for the antibody against EFA6C. An arrowhead indicates the position of the amino acid mutated for GEF-defective mutant of EFA6C used in this study. c.c., coiled-coil motif.



with GTP-bound ARFs (Santy and Casanova 2001; Shinotsuka et al. 2002; Takatsu et al. 2002). We transfected the expression vector for either carboxyl terminal hemagglutinin (HA)-tagged wild ARF1 or ARF6 in the presence or absence of pCAGGS-FLAG-EFA6C into COS-7 cells, subjected the lysates to GST-GGA1 pull-down assay and measured the ratio of the amount of precipitated GTPbound ARF to that of total ARF in the lysates (Fig. 2). When compared with the empty vector, the transfection of FLAG-EFA6C resulted in 41 ± 7-fold increase in the ratio of GTP-bound ARF6 to total ARF6, while it induced only 5 ± 3-fold increase in the ratio of GTP-bound ARF1. The appearance of the two immunoreactive bands for GTPbound ARF6 was speculated to be due to its protein degradation or incomplete myristoylation in the overexpression system as suggested previously (Shinotsuka

(a)

et al. 2002). These findings indicate that EFA6C can activate ARF6 much more selectively than ARF1. In addition, the substitution of the glutamate at the 374th amino acid residue by lysine in the Sec7 domain of EFA6C lost the GEF activity toward ARF6 (Fig. 2). This confirmed that the glutamate residue in Sec7 domain, which is conserved among ARF GEFs, is critical in the GEF activity as shown previously (Beraud-Dufour et al. 1998; Franco et al. 1999). Subcellular localization of EFA6C in comparision with that of ARF1 or ARF6 To compare the subcellular localization of FLAG-EFA6C and ARFs-HA, HeLa cells were co-transfected with the expression vectors for FLAG-EFA6C and ARF1-HA or ARF6-HA. At a low expression level, FLAG-EFA6C was localized mainly in the plasma membrane which outlined the cell shape and in an undefined punctate cytoplasmic structure (Fig. 3). FLAG-EFA6C and ARF6-HA were co-localized well in the plasma membrane (Fig. 3, lower panel). In contrast, ARF1-HA was distributed in the perinuclear granules, which did not overlap with FLAG-EFA6C (Fig. 3, upper panel) and this subcellular localization was in accordance with the previous finding that ARF1 is localized in the Golgi apparatus (Peters et al. 1995; Hosaka et al. 1996). It should be noted that the co-expression of FLAG-EFA6C and ARF6-HA did not induce any obvious changes in the subcellular localization of ARF6-HA when compared with that of ARF6-HA in the absence of FLAGEFA6C (data not shown).

(b)

Fig. 2 GST-GGA1 pull-down assay. (a) The total lysates of COS-7 cells transfected with the indicated plasmid combinations were subjected to pull-down assay with GST-GGA1 fusion protein. The precipitates (top lane) and total lysates (middle lane) were immunoblotted with an anti-HA antibody. The total lysates were also immunoblotted with an anti-FLAG antibody (bottom lane). Data are representative of three independent experiments. (b) Quantification demonstration of GST-GGA1 pull-down assay. The immunoreactivities of GTP-bound ARFs in the precipitates were normalized by those of total ARFs in the total lysates and shown as the percent of the control without FLAGEFA6C. Data are shown as the mean ± SD of three independent experiments.

Fig. 3 Comparison of localization of FLAG-EFA6C and ARF1-HA or ARF6-HA in HeLa cells. HeLa cells were transfected with the expression vectors encoding FLAG-EFA6C and ARF1-HA or ARF6HA and immunostained with anti-FLAG (red) and anti-HA antibody (green). Nuclei were visualized with DAPI (blue). Note that FLAGEFA6C was colocalized with ARF6-HA but not with ARF1-HA at the plasma membranes. Scale bars ¼ 10 lm.



Effects of wild EFAC and mutant EFA6C on actin cytoskeleton rearrangement As ARF6 is involved in the regulation of actin cytoskeleton organization, we examined whether the overexpression of wild EFA6C and mutant EFA6C could induce actin cytoskeleton rearrangement. We transfected HeLa cells with wild FLAG-EFA6C or its GEF-defective mutant [FLAGEFA6C(E374K)] and examined any changes in the actin cytoskeleton by staining with phalloidin. The overexpression of wild FLAG-EFA6C at a high level induced the formation of membrane protrusions, where a marked accumulation of both EFA6C and F-actin was observed (Fig. 4, upper panel). Although the cells expressing GEF-defective EFA6C mutant did not exhibit such membrane protrusions, they exhibited a distinct phenotype in which numerous membrane spikes were extended from the cell bodies (Fig. 4 lower panel). Tissue distribution of EFA6C in mouse We examined the overall tissue distribution of EFA6C mRNA in adult mouse by northern blot analysis with a radioactive cDNA probe specific for EFA6C (Fig. 5). EFA6C mRNA occurred as a single band of 4.2 kb exclusively in the brain. No significant hybridization signal for EFA6C mRNA was detectable in other tissues including heart, lung, thymus, spleen, liver, small intestine, kidney, testis, or skeletal muscle.

Fig. 4 The effect of overexpression of FLAG-tagged wild and GEFdefective EFA6C on actin cytoskeleton and cell morphology of HeLa cells. HeLa cells were transfected with he expression vectors encoding FLAG-EFA6C or GEF-defective mutant of FLAG-EFA6C and stained with anti-FLAG (green), Alexa568-phalloidin (red) for F-actin, and DAPI (blue) for nuclei. Note that the overexpression of wild FLAGEFA6C but not GEF-defective mutant (E374K) induced membrane protrusions where F-actin was accumulated (arrowheads). Also note that the overexpression of GEF-defective mutant (E374K) induced numerous spikes (arrows). Scale bars ¼ 10 lm.

Fig. 5 Tissue distribution by northern blot analysis. Total RNAs (30 lg) from mouse tissues were subjected to hybridization with [32P]labeled cDNA probe corresponding to the nucleotides 1–837 of the cDNA for mouse EFA6C. Lane 1, brain; lane 2, heart; lane 3, lung; lane 4, thymus; lane 5, spleen; lane 6, liver; lane 7, small intestine; lane 8, kidney; lane 9, testis; lane 10, skeletal muscle. The size markers are indicated in kilobases (RNA molecular size marker; Gibco-BRL, Gaithersburg, MD, USA).

Localization of EFA6C mRNA in the adult mouse brain In situ hybridization histochemistry was performed to examine the cellular distribution of EFA6C mRNA in the adult mouse brain at post-natal 7th week. The expression of EFA6C mRNA was highly restricted to the cerebellar Purkinje cell layer and choroid plexus (Fig. 6a). The bright-field microscopic observation of the cerebellar cortex at a high magnification revealed that the hybridization signals were deposited in Purkinje cells (Fig. 6c). In addition, EFA6C mRNA was expressed in the epithelial cells of the choroid plexus, but not those of the ventriculi such as lateral, third, and fourth ventriculi. In contrast, ARF6 mRNA was ubiquitously expressed throughout the brain in accord with our previous findings in rat brain (Fig. 6b) (Suzuki et al. 2001; Sakagami et al. 2004). In the control experiment, the presence of a 50-fold excess of unlabeled individual oligonucleotide probes diminished hybridization signals and two independent oligonucleotide probes from different regions of EFA6C gave a similar expression pattern as described above (data not shown), suggesting the high specificity of the present in situ hybridization. Developmental localization of EFA6C and ARF6 mRNAs in mouse cerebellum During the cerebellar development, EFA6C and ARF6 mRNAs were already detected in the cerebellar anlage on E13 (Fig. 7). The expression of EFA6C mRNA was higher in the choroid plexus at the fourth ventricle than that in the cerebellar anlage. After birth, the expression EFA6C mRNA in the Purkinje cell layer gradually increased in intensity and peaked during post-natal second week. Throughout the cerebellar development, the expression of EFA6C mRNA was confined to the Purkinje cell layer and undetectable in any other cerebellar layers including the external and internal granular layers or molecular layer. In contrast, ARF6 mRNA



(a)

(b)

(c)

Mo

PCL

GL

Fig. 6 Localization of EFA6C mRNA in the adult mouse brain in comparison of that of ARF6. (a, b) Dark-field photographs of the sagittal sections of adult mouse brain hybridized with oligonucleotide probes for EFA6C (a) and ARF6 (b). Note the restricted expression of EFA6C mRNA in cerebellar Purkinje cells and choroid plexus in contrast to wide expression of ARF6 mRNA. AON, anterior olfactory nuclei; Cb, cerebellar cortex; CP, caudate putamen; Cx, cerebral cortex; Hip, hippocampus; IC, inferior colliculus; MO, medulla oblongata; OB, olfactory bulb; Pn, pontine nuclei; SC, superior colliculus; Th, thalamus; Tu, olfactory tubercle. (c) A bright-field photograph of the cerebellar cortex, showing the expression of EFA6C mRNA in Purkinje cells (arrows). Arrowheads in A indicate the expression of EFA6C mRNA in the choroid plexus. Scale bars ¼ 1 mm in (a) and (b); 10 lm in (c).

was widely distributed in the cerebellar cortex and detected in the external and internal granular layers and Purkinje cell layer. Immunohistochemical localization of EFA6C in the adult mouse brain We raised a specific antibody against a bacterially expressed amino-terminal region of EFA6C that is divergent without any homology among the EFA6 family (Fig. 1) and immunohistochemically examined the subcellular localization of EFA6C in the adult mouse brain.

First, the specificity of the antibody was assessed by the immunoblot analysis. The antibody recognized two immunoreactive bands of the molecular weights of 112 kDa and 102 kDa in both cytosolic and membrane fractions of the mouse cerebellum, while it detected one immunoreactive band in the lysate of the COS-7 cells transfected with FLAGEFA6C (Fig. 8a). The antibody did not detect any immunoreactive bands in the lysates of naive or transfected COS-7 cells with FLAG-EFA6A. This indicates that the present antibody can specifically recognize EFA6C without crossreactivity with EFA6A. The sizes of EFA6C calculated on SDS–PAGE were larger than the predicted size (84 kDa) from the cDNA. This discrepancy and the appearance of two immunoreactive bands may be due to the post-translational modification. Next, we examined the subcellular localization of EFA6C by immunoblot analysis of the fractionation of adult mouse cerebellar cortex (Fig. 8b). EFA6C immunoreactivity was detected in the fraction of post-synaptic density, with weaker immunoreactive intensity in the fractions of S3 and Golgi/ endoplasmic reticulum. No apparent immunoreactive bands were detectable in the cytosolic fraction at this loading amount (5 lg). The quality of the subcellular fractions was verified by several marker proteins including PSD95, calbindin, BiP and synaptophysin. The immunostaining of the adult mouse brain gave an immunoreactive pattern restricted to the cerebellar cortex, which agrees well with the gene expression pattern described above. In the cerebellar cortex (Fig. 9a), the immunoreactivity was intense in the cell bodies of Purkinje cells without any immunoreactivity in their nuclear matrix or in any cells in the granule cell layer. In the molecular layer, a dense punctate staining was observed in addition to the immunoreactivity in the dendritic shafts (Fig. 9b). In contrast, the immunoreactivity in the axon terminal of Purkinje cells in the deep cerebellar nuclei was very faint, if any (data not shown). In the control experiment in which antibody was preabsorbed with the EFA6C polypeptide cleaved from GST fusion partner, the immunoreactivity described above completely disappeared (Fig. 9c). In immunoelectron microscopy of the Purkinje cells, strong immunoreactivity for EFA6C occurred along the membranes of their cell bodies, dendritic shaft and spines with the post-synaptic density (Fig. 9d) Discussion

In this study, we first demonstrated that EFA6C can activate ARF6 selectively over ARF1 by ARF pull-down assay. This GEF activity of EFA6C was completely lost by substitution of glutamate by lysine at 374th amino acid residue in its Sec7 domain. It has previously been shown that the glutamate of Sec7 domain of ARNO at its 156th amino acid residue, which is equivalent to 374th amino acid residue of EFA6C,



Fig. 7 Expression of EFA6C and ARF6 mRNA in developing mouse cerebellum. Dark-field photographs of the sagittal sections of cerebellar cortex at various developmental stages. Note that EFA6C mRNA was already detected weakly in the cerebellar cortex at E13 and peaked around P15. Also note that ARF6 mRNA was expressed in all neuronal layers of cerebellar cortex including the external (EGL) and internal (IGL) granular layers and Purkinje cell layer (PCL) throughout the development. Asterisks indicate the expression of EFA6C and ARF6 mRNAs in the choroids plexus. Scale bars ¼ 0.5 mm.

mediates the destabilization of Mg2+ and GDP from ARF (Beraud-Dufour et al. 1998). This indicates that the conserved glutamate residue in Sec7 domain of EFA6C is critical for its GEF for ARF6. We also demonstrated that FLAGEFA6C co-localized well with ARF6 rather than ARF1. Furthermore, we showed that the overexpression of EFA6C induced the membrane protrusions enriched in F-actin, which is reminiscent of the ARF6-mediated actin reorganization of HeLa cells stimulated by aluminum fluoride (Radhakrishna et al. 1996). Taken together, it is highly likely that EFA6 acts as a GEF specific for ARF6 in vivo. However, it should be noted that the overexpression of GEF-defective mutant of EFA6C had a distinct effect on the cell shape such as the induction of numerous membrane extension from the cell bodies. In this regard, previous studies have demonstrated that the carboxyl terminal regions of EFA6A and EFA6B containing PH domain and coiled coil motif exhibit the ability to induce a similar change in cell shape possibly through the activation of Rac1 pathway without GEF activity of Sec7 domain (Derrien et al. 2002). Therefore, it is further necessary to examine whether the carboxyl terminal region of EFA6C exhibits such an ability to regulate cell shape and actin cytoskeleton like EFA6A and EFA6B. Concerning the cellular localization of EFA6C in the adult mouse brain, we demonstrated the expression of EFA6C mRNA was confined to the cerebellar Purkinje cells and epithelial cells of the choroid plexus. This restricted expression pattern is in sharp contrast to those of ARF6 and EFA6A mRNAs: ARF6 mRNA is ubiquitously expressed throughout the brain, while EFA6A is preferentially expressed in the forebrain structures including olfactory bulb, cerebral cortex, striatum, and hippocampus (Suzuki et al. 2001, 2002). This

suggests that ARF6 may be differentially regulated by multiple EFA6 isoforms in a cell-specific manner. In Purkinje cells, EFA6C was localized in the plasma membrane of the cell bodies, dendrites and dendritic spines, but not in their axon terminals in the deep cerebellar nuclei. Such an asymmetrical localization in the plasma membranes has also been observed for EFA6B: It is localized at the apical membrane but not at the basolateral membrane in MDCK cells (Luton et al. 2004). These findings indicate that individual EFA6 isoforms may regulate the activation of ARF6 at their specific subcellular compartments. One of the possible mechanisms for the asymmetrical localization of EFA6 isoforms to various membrane compartments could be the interaction of their PH domains with some specific phosphoinositides of target membranes. Cytohesin-1, ARNO, and GRP-1 have been shown to translocate to the plasma membrane in response to agonist stimulation of phosphoinositide 3-kinase through the ability of their PH domains to bind phosphatidylinositol 3,4,5-trisphosphate (Cullen and Venkateswarlu 1999; Jackson et al. 2000). However, as our preliminary examination by using the protein-lipid overlay assay indicated that the PH domain of EFA6C was able to bind to phosphatidylinositol monophosphate, phosphatidylinositol bisphosphate, and phosphatidylinositol trisphosphate without any selectivity (data not shown), the PH domain of EFA6C is unlikely to be primarily responsible for the asymmetrical membrane targeting. Another possible mechanism is the targeting of EFA6C by anchoring proteins. Indeed, cytohesins have recently been shown to be localized to the post-synaptic density and to form a signaling complex with group 1 metabotrophic glutamate receptors by interacting tamalin [also called



(a)

(b)

Fig. 8 Immunoblot analysis of EFA6C. (a) Characterization of the antibody against EFA6C. The cytosolic (lane 1) and crude membrane (lane 2) fractions of adult mouse cerebellum (50 lg/lane) and total lysates (10 lg/lane) of COS-7 cells transfected with FLAG-rat EFA6A (lanes 3, 6) and FLAG-EFA6C (lanes 4, 7) and of naı¨ve COS-7 cells (lanes 5, 8) were immunoblotted with anti-EFA6C (lanes 1–5) and antiFLAG (lanes 6–8) antibodies. Positions of molecular weight markers are shown on the left in kDa. (b) Subcellular distribution of EFA6C in the mouse cerebellum. Proteins (5 lg) of various fractions from adult mouse cerebellum were immunoblotted with the antibodies against EFA6C, PSD95, calbindin, BiP, synaptophysin. Note the immunoreactivity of EFA6C in the fractions of PSD, S3, and Golgi/endoplasmic reticulum (Golgi/ER).

GRP1-associated scaffold protein (GRASP)], which contains a PDZ domain (the post-synaptic density protein PSD95/the Drosophila discs-large tumor suppressor protein DlgA/the tight junction protein ZO-1; Kitano et al. 2002). Further studies are necessary to define the mechanisms to target EFA6C to the somatodendritic compartments in Purkinje cells. The occurrence of the immunoreactivity for EFA6C in the dendritic spines and post-synaptic density is noteworthy.

Fig. 9 Immunohistochemical localization of EFA6C in the adult mouse cerebellum. (a) Immunofluorescent staining of the adult mouse cerebellar cortex with anti-EFA6C antibody, showing the immunoreactivity for EFA6C can be traced from the cell bodies of cerebellar Purkinje cells to their dendritic arborization in the molecular layer (Mo). GL, granular layer; PCL, Purkinje cell layer. Scale bar ¼ 50 lm. (b) A high magnification of the molecular layer, showing the immunoreactivity for EFA6C in the dendritic shafts and spines. Bar ¼ 5 lm. (c) Negative control in which the antibody was preabsorbed with the EFA6C polypeptide (1 lM) cleaved from GST fusion partner. Note the complete disappearance of the immunoreactivity. (d) An immunoelectron microscopic photograph of the molecular layer of the cerebellar cortex, showing strong immunoreactivity in the dendritic spines (sp) having the post-synaptic density (arrows). pre: pre-synaptic terminal. Scale bar ¼ 200 nm.

This finding was confirmed by immunoblot analysis with purified post-synaptic density. The dendritic spines are the highly dynamic protrusions that receive the excitatory inputs and that various receptors and signaling complex are concentrated in the post-synaptic density of the spine (Hering and Sheng 2001). Among the signaling molecules that regulate the spine dynamics, Rho family of small GTPase, particularly Rac1, has been shown to regulate the spine formation in Purkinje cells (Luo et al. 1996). Interestingly, the cross-talk mechanisms have been reported to exist between Rac1 and ARF6 in various cell lines: ARF6 enhances Rac1-dependent membrane ruffling through



Arfaptin 2/Partner of Rac1, a common downstream effector with Rac1 (D’Souza-Schorey et al. 1997; Radhakrishna et al. 1999). Furthermore, EFA6A-induced actin cytoskeleton rearrangement requires the activation of Rac1 as a downstream of ARF6 (Franco et al. 1999). Together with the recent findings that ARF6 regulates the dendritic formation of the hippocampal neurons through EFA6A and ARNO (Hernandez-Deviez et al. 2002; Sakagami et al. 2004), it can be hypothesized that the EFA6C-ARF6 pathway may regulate the formation of the dendrites and spines of Purkinje cells in a coordinated manner with Rac1. In support of this hypothesis, the present study demonstrated that EFA6C mRNA was progressively increased in the Purkinje cells after birth and peaked during post-natal second week, when the Purkinje cells actively form and arborize their dendrites (Altman 1972). In addition to the regulation of the actin cytoskeleton, ARF6 has been shown to regulate the internalization of G protein-coupled receptors and adhesion molecules such as the adrenergic receptor and E-cadherin (Palacios et al. 2002; Paterson et al. 2003). Thus, it is also possible that EFA6C may regulate the surface expression of various receptors at the post-synaptic density through activation of ARF6. On the other hands, although ARF6 has been shown to regulate pre-synaptic functions such as exocytosis of the synaptic vesicles (Galas et al. 1997), the absence of the apparent immunoreactivity for EFA6C in pre-synaptic axon terminals of Purkinje cells in deep cerebellar nuclei suggests that other ARF GEFs for ARF6 are involved in the presynaptic activation of ARF6. We have previously demonstrated that Purkinje cells express the mRNAs for EFA6A, cytohesin-1 and GRP as well as EFA6C, all of which can activate ARF6 (Suzuki et al. 2002). Thus, other ARF GEFs for ARF6, particularly ARNO, are likely to regulate the activation of ARF6 in the pre-synaptic axon terminals of Purkinje cells. Further studies are necessary to determine the subcellular localization of individual ARF GEFs with their specific antibodies. Besides Purkinje cells, EFA6C mRNA is abundantly expressed in the epithelial cells of the choroid plexus, but not in the ependymal cells lining the ventricle. The choroid epithelial cells are known to form a barrier between blood and cerebrospinal fluid by tight junctions, to secrete the ventricular cerebrospinal fluid, and to transport various substances by the receptor-mediated endocytosis. Among membrane receptors that are expressed in the choroid epithelial cells, transferrin receptor mediates the internalization of iron-saturated transferrin (Moos and Morgan 2000). The endocytosis of transferrin receptor has been shown to be regulated by EFA6A-ARF6 pathway in HeLa cells (D’Souza-Schorey et al. 1995; Franco et al. 1999). Thus, it is likely that EFA6C may be involved in the transport of various substances in the choroid epithelial cells by regulating the receptor-mediated endocytosis.

In summary, the present study demonstrated that EFA6C, the third member of EFA6 family, exhibited the selective activation of ARF6 and distinct cellular and subcellular localization in the adult mouse brain, providing an anatomical clue to understand its neuronal functions in future studies. Acknowledgements The authors would like to thank Dr J. Miyazaki (Osaka University Medical School) for kindly providing pCAGGS vector, Dr Tatsuo Suzuki (Shinshu Universtiy Graduate School of Medicine) for his useful advice on purification of post-synaptic density, Dr H. Yawo (Tohoku University Graduate School of Life Sciences) for his continuous encouragement, and Dr Thorsten Hanhoff (Tohoku University Graduate School of Medicine) for critical reading the manuscript. This work is supported by a Grants-in-Aid for Young Scientists (#15700269) and for Scientific Research on Priority Areas (#16015215) to H.S. from the Ministry of Education, Science, Sports, Culture and Technology of Japan.

References Altman J. (1972) Postnatal development of the cerebellar cortex in the rat. II. Phases in the maturation of Purkinje cells and of the molecular layer. J. Comp. Neurol. 145, 399–463. Beraud-Dufour S., Robineau S., Chardin P., Paris S., Chabre M., Cherfils J. and Antonny B. (1998) A glutamic finger in the guanine nucleotide exchange factor ARNO displaces Mg2+ and the b-phosphate to destabilize GDP on ARF1. EMBO J. 17, 3651–3659. Boman A. L. and Kahn R. A. (1995) Arf proteins: the membrane traffic police? Trends Biochem. Sci. 20, 147–150. Carlin R. K., Grab D. J., Cohen R. S. and Siekevitz P. (1980) Isolation and characterization of post-synaptic densities from various brain regions: enrichment of different types of postsynaptic densities. J. Cell Biol. 86, 831–845. Claing A., Chen W., Miller W. E., Vitale N., Moss J., Premont R. T. and Lefkowitz R. J. (2001) b-Arrestin-mediated ADP-ribosylation factor 6 activation and b2-adrenergic receptor endocytosis. J. Biol. Chem 276, 42 509–42 513. Cullen P. J. and Venkateswarlu K. (1999) Potential regulation of ADPribosylation factor 6 signalling by phosphatidylinositol 3,4,5-trisphosphate. Biochem. Soc. Trans. 27, 683–689. D’Souza-Schorey C., Li G., Colombo M. I. and Stahl P. D. (1995) A regulatory role for ARF6 in receptor-mediated endocytosis. Science 267, 1175–1178. D’Souza-Schorey C., Boshans R. L., McDonough M., Stahl P. D. and Van Aelst L. (1997) A role for POR1, a Rac1-interacting protein, in ARF6-mediated cytoskeletal rearrangements. EMBO J. 16, 5445– 5454. Derrien V., Couillault C., Franco M., Martineau S., Montcourrier P., Houlgatte R. and Chavrier P. (2002) A conserved C-terminal domain of EFA6-family ARF6-guanine nucleotide exchange factors induces lengthening of microvilli-like membrane protrusions. J. Cell Sci. 115, 2867–2879. Donaldson J. G. and Jackson C. L. (2000) Regulators and effectors of the ARF GTPases. Curr. Opin. Cell Biol. 12, 475–482. Franco M., Peters P. J., Boretto J., van Donselaar E., Neri A., D’SouzaSchorey C. and Chavrier P. (1999) EFA6, a sec7 domain-containing exchange factor for ARF6, coordinates membrane recycling and actin cytoskeleton organization. EMBO J. 18, 1480–1491.



Frank S., Upender S., Hansen S. H. and Casanova J. E. (1998) ARNO is a guanine nucleotide exchange factor for ADP-ribosylation factor 6. J. Biol. Chem. 273, 23–27. Galas M. C., Helms J. B., Vitale N., Thierse D., Aunis D. and Bader M. F. (1997) Regulated exocytosis in chromaffin cells. A potential role for a secretory granule-associated ARF6 protein. J. Biol. Chem. 272, 2788–2793. Hering H. and Sheng M. (2001) Dendritic spines: structure, dynamics and regulation. Nat. Rev. Neurosci. 2, 880–888. Hernandez-Deviez D. J., Casanova J. E. and Wilson J. M. (2002) Regulation of dendritic development by the ARF exchange factor ARNO. Nat. Neurosci. 5, 623–624. Hernandez-Deviez D. J., Roth M. G., Casanova J. E. and Wilson J. M. (2004) ARNO and ARF6 regulate axonal elongation and branching through downstream activation of phosphatidylinositol 4-phosphate 5-kinase a. Mol. Biol. Cell 15, 111–120. Hosaka M., Toda K., Takatsu H., Torii S., Murakami K. and Nakayama K. (1996) Structure and intracellular localization of mouse ADPribosylation factors type 1 to type 6 (ARF1-ARF6). J. Biochem. 120, 813–819. Inaba Y., Tian Q. B., Okano A., Zhang J. P., Sakagami H., Miyazawa S., Li W., Komiyama A., Inokuchi K., Kondo H. and Suzuki T. (2004) Brain-specific potential guanine nucleotide exchange factor for Arf, synArfGEF (Po), is localized to post-synaptic density. J. Neurochem. 89, 1347–1357. Jackson C. L. and Casanova J. E. (2000) Turning on ARF: the Sec7 family of guanine-nucleotide-exchange factors. Trends Cell Biol. 10, 60–67. Jackson T. R., Kearns B. G. and Theibert A. B. (2000) Cytohesins and centaurins: mediators of PI 3-kinase-regulated Arf signaling. Trends Biochem. Sci. 25, 489–495. Kitano J., Kimura K., Yamazaki Y., Soda T., Shigemoto R., Nakajima Y. and Nakanishi S. (2002) Tamalin, a PDZ domain-containing protein, links a protein complex formation of group 1 metabotropic glutamate receptors and the guanine nucleotide exchange factor cytohesins. J. Neurosci. 22, 1280–1289. Knorr T., Nagel W. and Kolanus W. (2000) Phosphoinositides determine specificity of the guanine-nucleotide exchange activity of cytohesin-1 for ADP-ribosylation factors derived from a mammalian expression system. Eur. J. Biochem. 267, 3784–3791. Krauss M., Kinuta M., Wenk M. R., De Camilli P., Takei K. and Haucke V. (2003) ARF6 stimulates clathrin/AP-2 recruitment to synaptic membranes by activating phosphatidylinositol phosphate kinase type Igamma. J. Cell Biol. 162, 113–124. Langille S. E., Patki V., Klarlund J. K., Buxton J. M., Holik J. J., Chawla A., Corvera S. and Czech M. P. (1999) ADP-ribosylation factor 6 as a target of guanine nucleotide exchange factor GRP1. J. Biol. Chem 274, 27 099–27 104. Luo L., Hensch T. K., Ackerman L., Barbel S., Jan L. Y. and Jan Y. N. (1996) Differential effects of the Rac GTPase on Purkinje cell axons and dendritic trunks and spines. Nature 379, 837–840. Luton F., Klein S., Chauvin J. P., Le Bivic A., Bourgoin S., Franco M. and Chardin P. (2004) EFA6, exchange factor for ARF6, regulates the actin cytoskeleton and associated tight junction in response to E-cadherin engagement. Mol. Biol. Cell 15, 1134–1145. Moos T. and Morgan E. H. (2000) Transferrin and transferrin receptor function in brain barrier systems. Cell. Mol. Neurobiol. 20, 77–95. Nakagawa S., Watanabe M., Isobe T., Kondo H. and Inoue Y. (1998) Cytological compartmentalization in the staggerer cerebellum, as revealed by calbindin immunohistochemistry for Purkinje cells. J. Comp. Neurol. 395, 112–120. Niwa H., Yamamura K. and Miyazaki J. (1991) Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108, 193–199.

Palacios F., Schweitzer J. K., Boshans R. L. and D’Souza-Schorey C. (2002) ARF6-GTP recruits Nm23–H1 to facilitate dynaminmediated endocytosis during adherens junctions disassembly. Nat. Cell Biol. 4, 929–936. Paterson A. D., Parton R. G., Ferguson C., Stow J. L. and Yap A. S. (2003) Characterization of E-cadherin endocytosis in isolated MCF-7 and chinese hamster ovary cells: the initial fate of unbound E-cadherin. J. Biol. Chem. 278, 21 050–21 057. Peters P. J., Hsu V. W., Ooi C. E., Finazzi D., Teal S. B., Oorschot V., Donaldson J. G. and Klausner R. D. (1995) Overexpression of wild-type and mutant ARF1 and ARF6: distinct perturbations of nonoverlapping membrane compartments. J. Cell Biol. 128, 1003– 1017. Radhakrishna H. and Donaldson J. G. (1997) ADP-ribosylation factor 6 regulates a novel plasma membrane recycling pathway. J. Cell Biol. 139, 49–61. Radhakrishna H., Klausner R. D. and Donaldson J. G. (1996) Aluminum fluoride stimulates surface protrusions in cells overexpressing the ARF6 GTPase. J. Cell Biol. 134, 935–947. Radhakrishna H., Al-Awar O., Khachikian Z. and Donaldson J. G. (1999) ARF6 requirement for Rac ruffling suggests a role for membrane trafficking in cortical actin rearrangements. J. Cell Sci. 112, 855–866. Sakagami H., Umemiya M., Kobayashi T., Saito S. and Kondo H. (1999) Immunological evidence that the b isoform of Ca2+/calmodulindependent protein kinase IV is a cerebellar granule cell-specific product of the CaM kinase IV gene. Eur. J. Neurosci. 11, 2531– 2536. Sakagami H., Matsuya S., Nishimura H., Suzuki R. and Kondo H. (2004) Somatodendritic localization of the mRNA for EFA6A, a guanine nucleotide exchange protein for ARF6, in rat hippocampus and its involvement in dendritic formation. Eur. J. Neurosci. 19, 863–870. Santy L. C. and Casanova J. E. (2001) Activation of ARF6 by ARNO stimulates epithelial cell migration through downstream activation of both Rac1 and phospholipase D. J. Cell Biol. 154, 599–610. Schultz J., Copley R. R., Doerks T., Ponting C. P. and Bork P. (2000) SMART: a web-based tool for the study of genetically mobile domains. Nucleic Acids Res. 28, 231–234. Sheen V. L., Ganesh V. S., Topcu M. et al. (2004) Mutations in ARFGEF2 implicate vesicle trafficking in neural progenitor proliferation and migration in the human cerebral cortex. Nat. Genet. 36, 69–76. Shinotsuka C., Yoshida Y., Kawamoto K., Takatsu H. and Nakayama K. (2002) Overexpression of an ADP-ribosylation factor-guanine nucleotide exchange factor, BIG2, uncouples brefeldin A-induced adaptor protein-1 coat dissociation and membrane tubulation. J. Biol. Chem. 277, 9468–9473. Someya A., Sata M., Takeda K., Pacheco-Rodriguez G., Ferrans V. J., Moss J. and Vaughan M. (2001) ARF-GEP (100), a guanine nucleotide-exchange protein for ADP-ribosylation factor 6. Proc. Natl Acad. Sci. USA 98, 2413–2418. Suzuki I., Owada Y., Suzuki R., Yoshimoto T. and Kondo H. (2001) Localization of mRNAs for six ARFs (ADP-ribosylation factors) in the brain of developing and adult rats and changes in the expression in the hypoglossal nucleus after its axotomy. Brain Res. Mol. Brain Res. 88, 124–134. Suzuki I., Owada Y., Suzuki R., Yoshimoto T. and Kondo H. (2002) Localization of mRNAs for subfamily of guanine nucleotideexchange proteins (GEP) for ARFs (ADP-ribosylation factors) in the brain of developing and mature rats under normal and postaxotomy conditions. Brain Res. Mol. Brain Res. 98, 41–50. Takatsu H., Yoshino K., Toda K. and Nakayama K. (2002) GGA proteins associate with Golgi membranes through interaction between their



GGAH domains and ADP-ribosylation factors. Biochem. J. 365, 369–378. Vitale N., Chasserot-Golaz S., Bailly Y., Morinaga N., Frohman M. A. and Bader M. F. (2002) Calcium-regulated exocytosis of dense-

core vesicles requires the activation of ADP-ribosylation factor (ARF) 6 by ARF nucleotide binding site opener at the plasma membrane. J. Cell Biol. 159, 79–89.
