Cellular expression of humancentromere protein C demonstrates

Proc. Natl. Acad. Sci. USA Vol. 93, pp. 10234-10239, September 1996 Cell Biology

Cellular expression of human centromere protein C demonstrates a cyclic behavior with highest abundance in the G1 phase (check point control/cell synchronization/immune detection/quantitative PCR)

M. KNEHR*t, M. POPPE*, D. SCHROETER*, W. EICKELBAUM*, E.-M. FINZE*, U.-L. KIESEWETTER*, M. ENULESCU*, M. ARANDt, AND N. PAWELETZ* *Research Program IV, Department of Growth and Division of the Cell (430), German Cancer Research Center, D-69120 Heidelberg, Germany; and Toxicology, University of Mainz, D-55131 Mainz, Germany

tlnstitute of

Communicated by Nicholas R. Cozzarelli,§ University of California, Berkeley, CA, June 26, 1996 (received for review June 25, 1995)

nents of this region (7, 8, 11, 15-19). However, their partial structural and functional characterization already allows us a much better understanding of the molecular interactions of the CKC with spindle microtubules in mitosis (20-26). One of the most interesting centromere proteins (CENPs) is CENP-C. It represents the only known CENP that has been shown to be localized within the kinetochore (27). It is probably very important for the structural integrity of the kinetochore, since microinjection of antibodies directed against CENP-C resulted in shortened and disrupted kinetochores paralleled by a delay in the transition from metaphase to anaphase and chromosomal segregation (28). These findings also indicate a role of CENP-C in cell cycle control, i.e., some checkpoint at the metaphase-anaphase transition examines the correct attachment of all kinetochores with spindle microtubules and their proper arrangement within the metaphase plate before allowing the onset of the anaphase (8, 24, 29). Possibly, phosphoepitopes, which can be found only at kinetochores that are neither attached to spindle microtubules nor have achieved their stable bipolar orientation, may represent some inhibiting signals for the anaphase onset (30). Additionally, recently published results point to mitotic checkpoint control by measuring the tension between kinetochores and the spindle microtubules (29, 31). Investigating the integrity of the CKC by immunoelectron microscopy (IEM) following its chemical detachment from the chromosomes (32), we were able to reveal expression of CENP-B and CENP-C in all cell cycle phases. Because these findings were not self-evident, we focused on the expression pattern of CENP-C during the cell cycle. By a combination of immunological and molecular biological methods, we evaluated protein and transcript levels of CENP-C in synchronized HeLa cells, demonstrating that its expression proves to be cyclic with lowest amounts in the S phase and highest abundance in the G1 phase.

ABSTRACT Centromere proteins are localized within the centromere-kinetochore complex, which can be proven by means of immunofluorescence microscopy and immunoelectron microscopy. In consequence, their putative functions seem to be related exclusively to mitosis, namely to the interaction of the chromosomal kinetochores with spindle microtubules. However, electron microscopy using immune sera enriched with specific antibodies against human centromere protein C (CENP-C) showed that it occurs not only in mitosis but during the whole cell cycle. Therefore, we investigated the cell cycle-specific expression of CENP-C systematically on protein and mRNA levels applying HeLa cells synchronized in all cell cycle phases. Immunoblotting confirmed protein expression during the whole cell cycle and revealed an increase of CENP-C from the S phase through the G2 phase and mitosis to highest abundance in the G1 phase. Since this was rather surprising, we verified it by quantifying phasespecific mRNA levels of CENP-C, paralleled by the amplification of suitable internal standards, using the polymerase chain reaction. The results were in excellent agreement with abundant protein amounts and confirmed the cyclic behavior of CENP-C during the cell cycle. In consequence, we postulate that in addition to its role in mitosis, CENP-C has a further role in the G1 phase that may be related to cell cycle control.

Cell division or mitosis is represented by a complex pattern of cellular events and changes that have to be closely coordinated to finally achieve the correct segregation of sister chromatids and their equal distribution to the developing daughter cells. Modifications of the timely sequence of essential events or structural changes of crucial components localized within the centromere-kinetochore complex (CKC) will most probably result in an aberrant cell division leading either to polyploid progenitor cells, or following cytokinesis, to aneuploid daughter cells (1, 2). The latter's fate will most often be cell death. However, in some cases they may lead to tumorigenesis as a consequence of malsegregated chromosomes and, therefore, to changed patterns of expression (3). The importance of the CKC for mitosis is reflected by its chromosomal localization and its specific functions. In addition to the capture of spindle microtubules by the kinetochores (4), which occurs in the early prophase (5), the CKC also regulates the arrangement of the sister chromatids into the metaphase plate (6) and their cohesion and timely release at the transition from metaphase to anaphase (7, 8). This segregation of the sister chromatids and their subsequent poleward movement (9) is supported by force-generating motor proteins localized in this region (1012). So far, essentially by application of autoimmune sera from scleroderma patients with high antigenic specificity to the CKC (13, 14), a few proteins have been identified as compo-

MATERIALS AND METHODS Cell Culture and Synchronization. HeLa S3 cells (American Type Culture Collection) were grown as suspension culture in Joklik's minimal essential medium enriched with 1% nonessential amino acids and supplemented with 5% (vol/vol) NCS (Biochrom, Berlin) at 37°C under continuous stirring. HeLa cells maximally synchronized in the G1 (Go) phase (78%) were obtained by incubation with 5 mM 2'-deoxythymidine (Serva) for 24 h, change of medium, and further incubation in the presence of 2 mM hydroxyurea (Sigma) for an additional 12 h. Cells in the S phase (97%) were synchronized by thymidine Abbreviations: CENP, centromere protein; CKC, centromerekinetochore complex; IEM, immunoelectron microscopy; IFM, immunofluorescence microscopy; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hsp6o, heat shock protein 60. *To whom reprint requests should be addressed. §Communication of this paper was initiated by Daniel Mazia and, after his death (June 9, 1996), completed by Nicholas R. Cozzarelli.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 10234

Cell

Biology: Knehr et al.

double block beginning with an incubation with 2 mM thymidine for 24 h, followed by a recovery period of 12 h and another incubation in 2 mM thymidine for 14 h. Finally, cells were again incubated in normal medium for a further 4 h. Likewise, a maximum of synchronization for cells representing the G2 phase (78%) was achieved by extending the final recovery period to 8 h. Mitotic cells (76%) were harvested following incubation in the presence of colcemid (10-6 M; Serva) for 20 h. The percentage of enrichment was measured by applying flow cytometric determination of the DNA/protein ratio of the cells. For detailed information see Knehr et al. (33). Antibody Production and Serum Generation. Three peptide sequences derived from the published primary sequence of human CENP-C (27) were chosen due to their calculated high antigenicity predicted by the algorithm of Jameson and Wolf (34). Peptide 1 (EASLGFVVEPSEA, positions 94-106) was selected since the underlined amino acid residues differed from the corresponding CENP-C sequence of mouse origin (52). Peptides 2 (EEKGKQHVGQDIL, positions 878-890) and 3 (FGDLLCTLHETPY, positions 896-908) contained sequences that were homologous overall between man and mouse. Following synthesis and HPLC purification, 6 mg of each peptide were used for immunizing two rabbits at a time (Dianova, Hamburg, Germany). Preimmune, immune, and boostered sera were collected and tested for their specific immune reaction against human CENP-C. Unless otherwise stated, all experiments were performed with serum mks2, derived from immunization with peptide 1. Immunofluorescence. HeLa cells cultivated in monolayer cultures on glass coverslips were fixed at -20°C in methanol and acetone, 5 min each. Crossreactivity was reduced by incubation for 10 min in TBS (10 mM Tris HCl, pH 7.6/150 mM NaCl) containing 0.5% BSA and 0.1% gelatine followed by several washes in TBS. The coverslips were then incubated in a humid chamber for 20 min at room temperature with 1:1000 dilutions of the immune sera derived from peptides 1-3. Any excess antibody was removed by further washing in TBS, followed by incubation for 20 min with sheep anti-rabbit Fab fragment conjugated to rhodamine diluted 1:20 (Dianova). The cells were washed again in TBS and distilled water before embedding them in Mowiol 4.88 (Hoechst Pharmaceuticals). The immune reaction was observed under a Zeiss IM 35 microscope equipped with a suitable filter system (540-590 nm). Immunoelectron Microscopy. HeLa cells cultured on coverslips were fixed with 4% paraformaldehyde followed by immunoreaction, postfixation with 2% glutaraldehyde, silver enhancement, and stepwise dehydration as described (5), before embedding them according to Spurr (35) and polymerizing them for 5 days at 48°C. Finally, 90 nm sections were generated with an Ultracut E microtome (Reichert) and stained with 3% uranyl acetate and lead citrate as described (36). Immune reactions were investigated by transmission electron microscopy applying an EM 400 microscope at 80 keV (Philips Medical Systems, Kassel, Germany). Immunoblotting. Lysates of synchronized HeLa cells (6 x 105 cells per lane) were subjected to SDS/PAGE on 7.5% gels (37), and transferred to nitrocellulose (Schleicher & Schuell) according to Towbin et al. (38). Blots were stained with Ponceau Red S (Sigma), destained with TBS, blocked for 2 h with 5% BSA in TBST (TBS supplemented with 0.1% Tween 20), and incubated with serum mks2 overnight at 4°C (diluted 1:1000 in TBST). Following three wash steps, alkaline phosphatase-conjugated goat anti-rabbit IgG[H+L] (Dianova) was added at a dilution of 1:5000 for an additional 2 h. Finally, the membrane was incubated for 5-10 min in a solution of nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt (400 mM each, Roth, Karlsruhe, Germany). In addition to serum mks2, this experiment was reproduced with two additional anti-CENP-C sera and an anti-hsp60 (heat

Proc. Natl. Acad. Sci. USA 93 (1996)

10235

shock protein) serum, all of them derived from autoimmune patients. cDNA Synthesis and Validation of PCR Conditions. From defined amounts of HeLa S3 cells synchronized in the G1, S, G2, and M phase (4 x 107 cells each), mRNA was purified in parallel approaches, by applying the Dynabeads mRNA direct kit (Deutsche Dynal, Hamburg, Germany). Following OD quantification, equal amounts of mRNA were then transcribed in parallel into complementary first-strand cDNA using a commercially available kit (Pharmacia LKB). To establish validated conditions for PCR, we used standard reaction mixes of 50 ,ul containing 50 mM KCl, 10 mM Tris HCl (pH 9.0), 1.5 mM MgCl2, 1 mM dNTPs, 150 ng of each CENP-C sense primer (TTCTGGCAACTGATGTTACTTC) and antisense primer (GGTAATATGTGATGTATGTATGTT), 100 ng of first-strand cDNA derived from an unsynchronous culture, and 1.5 units of Taq DNA polymerase (AGS, Heidelberg). As specific template, i.e., internal standard, we added a shortened linearized cDNA fragment of CENP-C in varying amounts from 1 fg up to 10 pg, which was generated as shown in Fig. 2. PCR was carried out in a Crocodile II thermocycler (Appligene, Strasbourg, France) applying an initial denaturation step of 2 min at 94°C, followed by 24-32 cycles of denaturation for 50 sec at 94°C, primer annealing for 1 min and 20 sec at 56°C, and elongation for 2 min and 30 sec at 72°C. Finally, following chloroform/isoamyl alcohol extraction (24:1), PCR products were analyzed on 1% agarose (GIBCO/BRL) stained with ethidium bromide (0.5 ,ug/ml, Sigma). PCR was optimized by evaluating the cycle numbers representing the exponential amplification range to avoid product saturation by varying the amounts of added specific template to achieve equimolar amplification products in comparison to abundant CENP-C cDNA, and by testing different positions within the thermocycler, which may cause product variations. Reproducibility of PCR under optimal conditions (28 cycles applying 5 fg of the internal standard) was ensured by quantifying resulting DNA amounts from 10 parallel approaches. Quantitative PCR. Standardized PCR mixtures, each containing 100 ng of first-strand cDNA deriving either from unsynchronized cells or cells representing transcription patterns of G1, S, G2, and M phase, were finally supplemented with 7, 1.5, 2, and 5 fg of the internal standard, thus guaranteeing equimolarity to cell cycle-specific CENP-C transcript abundance at PCR start. PCR was stopped at the end of cycle 28, and the resulting amplification ratios of standard DNA versus cell cycle-specific CENP-C cDNA were visualized by UV transmission. The resulting fluorescence signals were digitized by means of an Eagle Eye II Still Video System (Stratagene), and signal intensities were subsequently quantified using the Gel Plotting Macros of the National Institutes of Health Image public domain software package (v1.49) created by Wayne Rasband. All experiments were performed in triplicate and in parallel. Alternatively, by applying additional duplex PCR experiments, we evaluated cell cycle-specific product amounts following co-amplification of cDNAs specific for CENP-C and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). For this purpose, standard PCR mixtures were supplemented with GAPDH sense primer (CGGAGTCAACGGATTTGGTCGTAT) and antisense primer (AGCCTTCTCCATGGTGGTGAAGAC) followed by careful determination of the appropriate cycle numbers optimal for co-amplification, as described (39). In preliminary titration experiments, comparable product amounts were achieved by applying 29 cycles of PCR and adding the GAPDH primers at the beginning of cycle 7. Based on these values, the same amounts of cell cycle-specific cDNA templates were coamplified in parallel and quantified as before. This final evaluation was done in triplicate.

10236

Cell

Biology: Knehr et al.

RESULTS Rabbit sera derived from immunization with peptides 1-3 were primarily tested for their specificity for CENP-C by means of immunoblotting and immunofluorescence. Following blotting of cell lysates, we were able to detect the characteristic staining of the 140-kDa protein representing CENP-C, either with extracts of isolated mitotic chromosomes or nuclei derived from interphase cells. Moreover, the typical double dot staining of the CKC in cells representing G2 phase and early mitotic phases was shown with IFM (Fig. 1 C, F, and G). However, some of these sera additionally stained spindle microtubules, centrioles, or undefined background of the cells. The strongest affinity for components of the centromere resulted from sera mksl and mks2, which originated from immunization with peptide 1. Because serum mks2 demonstrated the better ratio between specificity and background, it was chosen for all immunological methods of this study. The described localization of CENP-C in the inner kinetochore plate (27) cannot be shown by IFM. Therefore, we applied IEM to show kinetochore specificity of serum mks2. Routinely, we investigated typical phases of the cell cycle (Fig. 1 A, B, D, and E), which confirmed the kinetochore localization of CENP-C in cells representing prometaphase (Fig. ID) and metaphase (Fig. 1E). Additionally, we also observed specific staining in interphase nuclei, probably associated with heterochromatin, as shown in cells representing the G1 phase (Fig. 1A) and the G2 phase (Fig. 1B). Primarily, these findings reveal that CENP-C is present during the whole cell cycle. However, a quantifica-

Proc. Natl. Acad. Sci. USA 93 (1996)

tion of the cell cycle-specific abundance of CENP-C is not possible by means of IEM. Instead, a rather satisfying evaluation can be achieved by immunoblotting, applying equal amounts of cells maximally synchronized in specific cell cycle phases (33). Therefore, proteins were separated in SDS/PAGE followed by immunoblotting either with serum mks2 or serum SL (Fig. 2). Since the latter possessed high antigenicity to mitochondrial hsp60, which is expressed in comparable amounts during the cell cycle (51), we applied it as a control for changes in cell cyclespecific protein abundance. In summary, we were able to detect only low amounts of CENP-C in the S and G2 phase, whereas in mitosis one can find the expected higher protein level, which seems to be at least five times higher as compared with the S phase. Surprisingly, the specific immune reaction of CENP-C with mks2 is strongest in the G1 phase, which indicates that it is most abundant in this cell cycle phase (Fig. 2A). Conversely, by immunoblotting with serum SL, no prominent changes in hsp60 amounts occurred, confirming the rather stable expression of this protein during the cell cycle (Fig. 2B). To further corroborate these findings we carried out another approach based on the quantification of cell cycle-specific transcript amounts applying PCR. This method requires the addition of an internal standard with identical priming sites, which will be simultaneously amplified (40-42). The internal standard applied corresponded to a shortened amino-terminal sequence of the cDNA encoding CENP-C and was generated according to the cloning procedure as shown in Fig. 3. For the validation of PCR conditions we started by defining the exponential amplification range, which could be assured up to cycle 29. As expected, DNA

J.f

qR,

"J,

Ak:

FIG. 1. IEM reveals the occurrence of human CENP-C (arrows) during the whole cell cycle. As compared with the G1 phase (A), CENP-C is still associated with heterochromatin in the G2 phase (B) before being localized in mitosis to the kinetochores of the CKC as shown in sister chromatids in prometaphase (D) and metaphase (E). By means of IFM, the typical staining of the kinetochores in late G2 phase (C), metaphase (F), and anaphase (G) can be observed. (A, x6,900, B, D, and E, x11,500. Bars represent 1 ,um.)

Biology: Knehr et al.

Cell

A

s

MwM

Proc. Natl. Acad. Sci. USA 93 (1996)

G2

M

GI

116 f;

97

B 66 45

FIG. 2. Immunoblots of equal amounts of HeLa cell lysates synchronized in different cell cycle phases. Applying serum mks2 (A), as compared with the S phase, one can find only low CENP-C levels (140 kDa) in the G2 phase. However, mitosis (M phase) reveals significantly larger protein amounts with highest abundance in the G1 phase. Conversely, applying serum SL with high antigenicity to hsp60 (60 kDa) as a control (B) results in no differences in protein amounts occuring during the cell cycle. MWM, molecular weight marker applied. amounts doubled with each additional cycle, and visual detection became possible beginning with cycle 24. Since DNA accumulation reached saturation with cycle 30, we carried out further test PCRs by selecting 28 cycles. Quantification of product amounts derived from identical reactions amplified in parallel revealed independence of different positions of vials within the thermo77=

1

PCR-amplification of cDNA CENP-C

r

777=

cycler. Finally, we determined the required amounts of the internal standard to achieve approximate equimolarity with abundant CENP-C transcripts for each cell cycle phase. The resulting DNA patterns of the essential PCRs reflect the relative amounts of initially abundant CENP-C transcripts (Fig. 4). A significant difference in amplified cDNA amounts from cells synchronized in the M and G1 phase could be observed, as compared with cells enriched in the S and G2 phase (Fig. 4A). The computer-supported analysis of data elucidated more exactly the differences in cell cycle-specific transcript levels (Fig. 4B). Because values of amplified DNA from mitotic cells were set to 100%, cells in the S phase revealed CENP-C-specific transcript levels of only 40% followed by a slight increase up to 50% in cells in the G2 phase. However, the absolute maximum of amplified DNA resulted from cells synchronized in the G1 phase (125%), reflecting highest abundance of CENP-C transcripts in this cell cycle phase. Co-amplification of CENP-C and GAPDH transcripts in a duplex PCR (Fig. 4C) represented an alternative approach with several advantages. First, being a "housekeeping" gene, mRNA levels of GAPDH are known to remain constant during the cell cycle (39, 43). Second, its use as an endogenous internal control being present in the original samples implies that it is processed under conditions that are identical to CENP-C, providing a convenient way to control for differences in reaction efficiencies and variations in starting template abundance. Hence, the only variable that it is necessary to address is the selection of the appropriate target-specific PCR cycle number to achieve comparable product amounts. Again, data analysis confirmed the cycling pattern of CENP-C transcript amounts (Fig. 4C, shaded columns) with highest abundance in the M and G1 phase, setting the latter to 100%. Abundance of CENP-C transcripts in the S, G2, and M phase was revealed to be 26%, 32%, and 56% in relation to the G1 phase. Quantification of cell cycle-specific mRNA amounts of GAPDH following simultaneous amplification (open columns) demonstrated a very stable transcription pattern of about 65-75%. AAAAA

TTTTT TTTTT TTTTT

=WOW= AAAAA VOR0tW~P AAAAA

First strand cDNA synthesis

specific for

L

10237

IpolyA+ RNA from HeLa cells

First strand cDNA

Bgl II Bgl II 1

A

Ligation

in

_

A

1.36 KB fragment coding for the aminoterminus

pGEM-T

Bgl 11

Bgl

II

Bgl

Nco

II

Nco I / Not I digest Gelextraction

lac Z

pGEI

t ori \\

hCEI

4.36

1.12 KB fragment pr

(Bgl Il-deleted)

Internal standard for (semi)quantitative PCR

FIG. 3. The applied internal standard for quantitative PCR was created primarily by specific amplification of 1.36 kb of the cDNA coding for human CENP-C. The amplicon was ligated in pGEM-T (Promega), and recombinant plasmids were selected for ampicillin resistance after their transformation in competent Escherichia coli C600. Following plasmid preparation, the CENP-C insert was shortened by digestion with BglII and the remaining plasmid was purified by gel extraction and religated before undertaking a second round of transformation and cloning. Finally, the remaining 1.12 kb of specific CENP-C cDNA (equal to the internal standard) was isolated by double digestion with NcoI and NotI, and purified by gel extraction.

Cell

10238

Proc. Natl. Acad. Sci. USA 93 (1996)

Biology: Knehr et al. MWM C

A

U G, S

we obtained a cyclic pattern for the abundance of CENP-Cspecific transcripts during the cell cycle which is paralleled by appropriate protein amounts (Fig. 2).

G2 M

DISCUSSION 1.0kb

_ 0.76kb _

B

i

cm c

z 0

U

C:

E

GI

S

M

G2

synchronized cell cycle phases

c

- CENP-C

Relatve

~-

r/ol

GAPDH

120

100 80 60 40 20 0

U

01

S

G2

M

FIG. 4. Quantitative PCR with equal amounts of cDNA templates derived from unsynchronous cells and cells synchronized in different cell cycle phases, and data evaluation of the amplified DNA products. The applied internal standard contained the identical priming sites as compared with specific CENP-C templates as a presupposition for quantifying cell cycle-specific CENP-C mRNA abundance. Equimolarity of both templates before starting PCR was achieved by applying various amounts of the internal standard in preliminary PCR experiments and determining the appropriate amounts for each cell cycle phase. The resulting DNA pattern (A) reveals bands of 1.0 kb derived from the amplification of abundant reverse-transcribed CENP cDNA, and 0.75 kb following amplification of the added internal standard. MWM, applied DNA molecular weight marker; C, a control mixture without template; U, amplified cDNA from unsynchronized cells (which represents primarily cells in the G1 phase). Evaluation of DNA product amounts is shown graphically (B) and reflects the relative abundance of CENP-C transcripts during the cell cycle. Additionally, co-amplification of CENP-C and GAPDH was investigated as a further control (C). Again, amplification products of CENP-C demonstrate a cyclic pattern (1.0 kb, shaded columns), whereas resulting GAPDH amounts (0.3 kb, open columns) represent a rather stable expression pattern during the cell cycle. Overall, the abundance of CENP-C mRNA is revealed to be cyclic with a maximum in the G1 phase.

Therefore, in addition to the results derived from immunoblotting, the highest transcript levels were found in cells representing mitosis and the G1 phase. Overall, in HeLa cells,

Primarily, it may not be surprising that CENP-C is detectable during the whole cell cycle. Similar results, which we obtained in investigating CENP-B, support these findings (unpublished work). Most likely, this may be characteristic of most CENPs despite the current view that their functional relevance for the cell is limited exclusively to mitosis. We now believe that this idea must be revised in respect to CENP-C. In this context, it becomes quite interesting to investigate and quantify the cell cycle-specific expression patterns of CENPs. To our knowledge this has been undertaken only twice with components of the CKC investigating CENP-E and CENP-F (10, 44, 45). Concerning CENP-E, which is mainly localized in the cytoplasm, this protein can first be detected by means of pulsechase and immunoprecipitation in very low amounts in the G1 phase. It is slowly enriched in the succeeding S phase, and then undergoes strong accumulation beginning with the G2 phase up to late mitosis before being completely degraded at the end of the telophase. Because CENP-C proves to be localized predominantly within the nucleus, we chose an alternative attempt based on immunoblotting to evaluate the abundance of CENP-C during the cell cycle. Likewise, this allowed the quantitative estimate of CENP-C amounts in different cell cycle phases. Whereas the larger amounts of CENP-C could be expected in mitosis, as compared with the S and G2 phase, the even higher CENP-C level in the G1 phase was surprising and did not correspond to our expectations. Representing a component of the kinetochore (27) essential for a functional CKC (28), one would expect a correlation of CENP-C expression with kinetochore development (46) with highest protein amounts at the onset of mitosis. Therefore, we tried to confirm these results by quantitative PCR, supposing that in vivo protein synthesis may reflect abundant transcript levels. However, one has to keep in mind that reactivity in immunoblotting might be partially modified by several parameters including possible proteolytic effects, sterically-hindered epitope masking, or post-translational modifications. As described in Results, a rather good correlation between the cell cycle-specific amounts of CENP-C and the appropriate mRNA levels could be demonstrated. Focusing first on mitosis, the comparable high amounts of CENP-C as compared with the S and G2 phase reflect the relevance of this protein for cell division and cell regulation. Apparently, an accumulation of CENP-C must occur before mitosis to ensure the development of a functional CKC. We did not find significantly higher transcript and protein amounts for CENP-C in the G2 phase as compared with the S phase. However, because the applied synchronization protocol enriches cells in mid G2 phase, we assumed that the necessary de novo synthesis mainly occurs at the end of the G2 phase, similar to CENP-E expression (44). Remarkably, the highest CENP-C amounts are detected in cells in the G1 phase, probably as a consequence of the greater abundance of specific mRNA. Apparently, disintegration of the CKC at the end of mitosis is not paralleled by a decay or degradation of CENP-C. Instead, one gets the impression that in the G1 phase CENP-C expression even increases to some extent. Both findings, the absence of CENP-C degradation at the end of mitosis and its increased expression in the G1 phase, indicate an additional relevance of CENP-C for this cell cycle phase, and raise the question as to what this function might be. Recently published results (28) may help to provide an answer. Microinjection of antibodies against CENP-C in the S and G2 phase does not significantly influence the process of mitosis. Injection in the G1 phase, however, arrests cells in the metaphase paralleled by shortened and disrupted kinetochores and the disintegration of the metaphase plate. Moreover, sister

Cell

Biology: Knehr et al.

chromatids start moving apart but cannot be separated any longer, probably as a result of remaining chromatin bridges within the cleavage furrow. The authors concluded that CENP-C must be involved in cell cycle regulation since the transition from metaphase to anaphase reflects a checkpoint control within the cell cycle (24, 31). Our findings suggest that despite the disintegration of the CKC in the early G1 phase CENP-C expression again increases at a high level up to the end of the G1 phase before being partially degraded, maybe as a presupposition for the transition from the G1 to the S phase. Therefore, we can imagine that in addition to mitosis, CENP-C might also be involved in cell cycle regulation during the G1 phase. Supposing that CENP-C remains bound to the centromere until the end of the G1 phase, its degradation may be a necessary prerequisite for the subsequent replication of the centromere region. Later on, in the G2 phase, newly synthesized CENP-C will be integrated into the developing CKC to build up functional kinetochore structures. Therefore, disturbing or inhibiting the degradation of CENP-C in the G1 phase should prevent its dissociation from the centromere, and as a consequence, prevent the replication of the latter. This should impede the integration of de novo synthesized CENP-C molecules, finally resulting in a structurally and functionally imperfect CKC. In addition to our findings, further indications of some degradation mechanism are provided by numerous putative PEST sequences (47) within the primary sequence of CENP-C, i.e., signal sequences for proteins whose expression has to be timely synchronized and which are involved in cell cycle control (48), i.e., CENP-E (44) or cyclin E (49). Notably the latter is degraded at the end of the GI phase, and in addition has been shown to be involved in checkpoint control at the restriction point (50). Currently, we can neither prove nor rule out some possible connection between CENP-C and this important cellular checkpoint. However, the putative binding property to the centromere in the G1 phase may be part of a further participation of CENP-C in cell cycle regulation or checkpoint control. Supplementary experiments, including the inhibition of CENP-C degradation and promotor characterization, should help to elucidate the cellular relevance of CENP-C within the complex molecular pattern describing cell division and regulation. This paper is dedicated to the memory of Prof. Dr. Daniel Mazia. We are very grateful to W. C. Earnshaw and J. Whyte for generously

providing us with autoimmune sera against CENP-C, as well as to R. L. Humbel for his kind support with the serum recognizing hsp60. We also want to thank R. Pipkorn and W. Fleischer for synthesizing the applied peptides and oligonucleotides, C. Wojcik for helpful comments, and R. Grosskopf for typing the manuscript. M. Arand is supported by the German Research Council (SFB 302). 1. Vig, B. K. & Paweletz, N. (1988) Mutat. Res. 201, 259-269. 2. Vig, B. K., Richards, B. & Paweletz, N. (1993) in Advances in Mutagenesis Research, ed. Obe, G. (Springer, Berlin), pp. 169203. 3. Vig, B. K., Paweletz, N. & Schroeter, D. (1993) Cancer J. 6, 243-252. 4. Mitchison, T. J. & Kirschner, M. W. (1985) J. Cell Bio. 101, 766-777. 5. Paweletz, N., Schroeter, D. & Finze, E.-M. (1994) Chromosome Res. 2, 115-122. 6. Rieder, C. L. (1982) Int. Rev. Cytol. 79, 1-58. 7. Yen, T. J., Li, G., Schaar, B. T., Szilak, T. & Cleveland, D. W.

(1991) EMBO J. 10, 1245-1254. 8. Earnshaw, W. C. & Mackay, A. M. (1994) FASEB J. 8, 947-956. 9. Nicklas, R. B. (1989) J. Cell Biol. 109, 2245-2255. 10. Yen, T. J., Li, G., Schaar, B. T., Szilak, I. & Cleveland, D. W. (1992) Nature (London) 359, 536-539. 11. Wordeman, L. & Mitchison, T. J. (1995)J. Cell Biol. 128, 95-105. 12. Desai, A. & Mitchison, T. J. (1995) J. Cell Biol. 128, 1-4.

Proc. Natl. Acad. Sci. USA 93 (1996)

10239

13. Moroi, Y., Peebles, C., Fritzler, M. J., Steigerwald, J. & Tan, E. M. (1980) Proc. Natl. Acad. Sci. USA 77, 1627-1631. 14. Brenner, S., Pepper, D., Berns, M. W., Tan, E. & Brinkley, B. R. (1981) J. Cell Biol. 91, 95-102. 15. Earnshaw, W. C. & Rothfield, N. (1985) Chromosoma 91, 313321. 16. Earnshaw, W. C., Sullivan, K. F., Machlin, P. S., Cooke, C. A., Kaiser, D. A., Pollard, T. D., Rothfield, N. F. & Cleveland, D. W. (1987) J. Cell Bio. 104, 817-829. 17. Bischoff, F. R., Maier, G., Tilz, G. & Ponstingl, H. (1990) Proc. Natl. Acad. Sci. USA 87, 8617-8621. 18. Palmer, D. K, O'Day, K., Trong, H. L., Charbonneau, H. & Margolis, R. L. (1991) Proc. Natl. Acad. Sci. USA 88, 3734-3738. 19. Rattner, J. B., Rao, A., Fritzler, M. J., Valencia, D. W. & Yen, T. J. (1993) Cell Motil. Cytoskeleton 26, 214-226. 20. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N. & Okazaki, T. (1989) J. Cell Biol. 109, 1963-1973. 21. Sugimoto, K., Hagishita, Y. & Himeno, M. (1994) J. Biol. Chem. 269, 24271-24276. 22. Sullivan, K. F., Hechenberger, M. & Masri, K. (1994) J. Cell Biol. 127, 581-592. 23. Liao, H., Li, G. & Yen, T. J. (1994) Science 265, 394-398. 24. Gorbsky, G. J. (1995) Trends Cell Biol. 5, 143-148. 25. Lombillo, V. A., Nislow, C., Yen, T. J., Gelfand, V. I. & McIntosh, J. R. (1995) J. Cell Biol. 128, 107-115. 26. Kitagawa, K., Masumoto, H., Ikeda, M. & Okazaki, T. (1995) Mol. Cell. Bio. 15, 1602-1612. 27. Saitoh, H., Tomkiel, J., Cooke, C. A., Ratrie, H., Maurer, M., Rothfield, N. F. & Earnshaw, W. C. (1992) Cell 70, 115-125. 28. Tomkiel, J., Cooke, C. A., Saitoh, H., Bernat, R. L. & Earnshaw, W. C. (1994) J. Cell Biol. 125, 531-545. 29. Rieder, C. L., Schultz, A., Cole, R. & Sluder, G. (1994) J. Cell Biol. 127, 1301-1310. 30. Gorbsky, G. J. & Ricketts, W. A. (1993) J. Cell Biol. 122, 13111321. 31. Li, X. & Nicklas, B. (1995) Nature (London) 373, 630-632. 32. Paweletz, N., Finze, E.-M., Schroeter, D. & Knehr, M. (1995) Chromosome Res. 3, 235-238. 33. Knehr, M., Poppe, M., Enulescu, M., Eickelbaum, W., Stohr, M., Schroeter, D. & Paweletz, N. (1995) Exp. Cell Res. 217, 546-553. 34. Jameson, B. A. & Wolf, H. (1988) Comput. Appl. Biosci. 181-186. 35. Spurr, A. R. (1969) J. Ultrastruct. Res. 26, 31-43. 36. Reynolds, E. S. (1963) J. Cell Biol. 17, 208-212. 37. Laemmli, U. K. (1970) Nature (London) 227, 680-685. 38. Towbin, H., Staehelin, T. & Gordon, J. (1979) Proc. Natl. Acad. Sci. USA 76, 4350-4354. 39. Wong, H., Anderson, W. D., Cheng, T. & Riabowol, K. T. (1994) Anal. Biochem. 223, 251-258. 40. Wang, M., Doyle, M. V. & Mark, D. F. (1989) Proc. Natl. Acad. Sci. USA 86, 9717-9721. 41. Murphy, L. D., Herzog, C. E., Rudick, J. B., Fojo, A. T. & Bates, S. E. (1990) Biochemistry 29, 10351-10356. 42. Gause, W. C. (1994) PCR Methods Appl. 3, 123-135. 43. Apostolakos, M. J., Schuermann, W. H. T., Frampton, M. W., Utell, M. J. & Willey, J. C. (1993) Anal. Biochem. 213, 277-284. 44. Brown, K. D., Coulson, R. M. R., Yen, T. J. & Cleveland, D. W. (1994) J. Cell Biol. 125, 1303-1312. 45. Liao, H., Winkfein, R. J., Mack, G., Rattner, J. B. & Yen, T. J. (1995) J. Cell Biol. 130, 507-518. 46. Schroeter, D., Paweletz, N., Finze, E.-M. & Kiesewetter, U.-L. (1993) in Chromosome Segregation and Aneuploidy, NATO ASI Series H72, ed. Vig, B. K. (Springer, Berlin), pp. 241-255. 47. Rogers, S., Wells, R. & Rechsteiner, M. (1986) Science 234, 354-368. 48. Rechsteiner, M. (1990) Semin. Cell Biol. 1, 433-440. 49. Tamura, K., Kanaoka, Y., Jinno, S., Nagata, A., Ogiso, Y., Shimizu, K., Hayakawa, T., Nojima, H. & Okayama, H. (1993) Oncogene 8, 2113-2118. 50. Dou, Q.-P., Levin, A. H., Zhao, S. & Pardee, A. B. (1993) Cancer Res. 53, 1493-1497. 51. Demel, M., Finze, E.-M., Kiesewetter, U.-L., Schroeter, D., Knehr, M. & Paweletz, N. (1996) in Chromosome Segregation and Aneuploidy-III, eds. Abbondandolo, A., Vig, B. K. & Roi, R. (E C Joint Research Center, Ispra, Italy), in press. 52. McKay, S. J., Thomson, E. T. & Cooke, H. J. (1994) Genomics 22, 36-40.