Cerulenin upregulates heat shock protein-70 gene expression in chicken muscle Sami Dridi,*1 Eddy Decuypere,† and Johan Buyse† *Department of Poultry Science, Center of Excellence for Poultry Science, University of Arkansas, Fayetteville 72701; and †Division of Livestock-Nutrition-Quality, Department of Biosystems, KU Leuven, Kasteelpark Arenberg 30, 3001 Leuven, Belgium ABSTRACT Lines of evidence suggested that systems involved in the regulation of the stress responses and energy homeostasis are highly integrated. Because cerulenin, the natural antibiotic product of the fungus Cephalosporium ceruleans and a broad-spectrum fatty acid synthesis (FAS) inhibitor, has been shown to affect food intake and energy balance, and because the biomarker of stress Hsp-70 gene was found to interact directly with fatty acids, we hypothesized that cerulenin may regulate Hsp-70 gene expression. Therefore, the present study was undertaken to examine this issue. Cerulenin administration significantly (P < 0.05) decreased food intake and induced Hsp-70 mRNA levels in muscle, but not in liver or hypothalamus of 2-wk-old broiler chickens. These changes were accompanied by an unpregulation of muscle uncoupling protein and carnitine palmitoyltransferase 1 mRNA levels. This result
indicated that the regulation of Hsp-70 gene expression in normal chickens, as estimated by oxidative stress indices [TBA reacting substances, ferric reducing/antioxidant power, and ceruloplasmin oxidase activity] levels, is tissue-specific. In attempt to discriminate between the effect of cerulenin and cerulenin-reduced food intake on Hsp-70 gene expression, we also evaluated the effect of food deprivation on the same cellular responses. Food deprivation for 16 h did not affect Hsp-70 gene expression in all tissues examined, indicating that the effect of cerulenin is independent of the inhibition of food intake. To ascertain whether the effect of cerulenin is direct or indirect, we carried out in vitro studies. Cerulenin treatment did not affect Hsp-70 gene expression in Leghorn male hepatoma and quail myoblast cell lines, suggesting that the observed effect in vivo may be mediated through the central nervous system.
Key words: cerulenin, food deprivation, oxidative stress, cell, heat shock protein 2013 Poultry Science 92:2745–2753 http://dx.doi.org/10.3382/ps.2013-03242
INTRODUCTION Stressful events markedly affect eating behavior in rodents (Valles et al., 2000) and humans (Fryer et al., 1997), suggesting that the regulation of energy homeostasis and the stress response are coupled physiological processes. Stress rapidly induces an increased synthesis of a group of stress proteins belonging to the heat shock protein (Hsp) families. Heat shock proteins are classified into about 6 families (Hsp10 to 100) on the basis of their monomeric molecular weight (for review, see Van Eden et al., 2005). Heat shock proteins carry out crucial housekeeping functions and are molecular chaperones that are important for the survival of cells. Among these families, Hsp-70 is necessary for cell
©2013 Poultry Science Association Inc. Received April 12, 2013. Accepted June 20, 2013. 1 Corresponding author:
[email protected]
translocation and protein folding (Gething and Sambrook, 1992). The Hsp-70 is expressed in normal cells and is highly stress-inducible, and it has been widely studied as a biomarker of stress (Ryan and Hightower, 1996). Stress responses are initiated by activating corticotropin-releasing factor, which recruits endocrine, immune, and neural systems. The type and degree of stress determines the outcome, but consistent responses are stimulation of the hypothalamic pituitary adrenal axis and the sympathetic nervous system. Cerulenin, the naturally occurring fatty acid synthesis inhibitor (Omura, 1976; Funabashi et al., 1989), profoundly reduced leptin, food intake, and BW, and increased metabolic rate when injected into mice (Loftus et al., 2000; Makimura et al., 2001; Shu et al., 2003). The metabolic effects of cerulenin were hypothesized to involve, as leptin, the hypothalamic feeding-related neuropeptides (Loftus et al., 2000; Dridi et al., 2006). Recent studies have shown that cerulenin (Jin et al., 2004) and leptin (Haynes et al., 1997) modulate sympathetic nervous system activity, implying that they have the
2745
2746
Dridi et al.
potential to modify the stress response. Although leptin has been shown to modulate key processes involved in oxidative stress in mammals (Bouloumie et al., 1999; Oates et al., 2000), the role of cerulenin is currently unknown. In addition, we have previously shown that leptin downregulates Hsp-70 gene expression in chicken liver and hypothalamus (Figueiredo et al., 2007) and we hypothesize that cerulenin may affect also Hsp-70 gene expression. Therefore the present study aimed to investigate the effect of cerulenin on Hsp-70 gene expression in different metabolically important tissues in chickens and on plasma levels of oxidative stress indices (TBARS, FRAP, and ceruloplasmin oxidase activity).
MATERIALS AND METHODS Cerulenin Treatment In Vivo (Experiment 1) One-day-old broiler chickens (Ross strain, Avibel, Halle-Zoersel, Belgium) were reared on floor pen until one week of age, at which time the birds were transferred to individual cages and provided with individual feeders and drinking nipples. Food (12 MJ/kg, 22% protein) and water were available for ad libitum consumption, and a standard lighting schedule was provided. After 1 wk of adaptation, birds were divided into 2 homogenous weight (267 g, n = 4) and food intake matched groups and fasted for 2 h to increase their appetite. Each bird received an intravenous injection (at 0, 4, and 24 h) of 15 mg/kg of cerulenin (Sigma, Diegem, Belgium) or equal volume of vehicle (10% dimethyl sulfoxide in RPMI 1640 medium). Cumulative food intake was recorded and tissues (hypothalamus, liver, and leg muscle) were removed, frozen in liquid nitrogen, and stored at –80°C until use. The experiment was conducted in accordance with the directives of the European community (86/609/EEC) on the care and use of laboratory animals, and the experimental protocols were approved by the K. U. Leuven Ethical Committee for Animal Experiments. The dose and the duration of cerulenin treatment were chosen based on previous experiments (Loftus et al., 2000) and after pilot studies.
Nutritional State, Fasting Versus Ad Libitum Feeding (Experiment 2) To discriminate between the effect of cerulenin and cerulenin-reduced food intake on Hsp-70 gene expression, 3-wk-old male broiler chickens (Ross strain) were used. Chickens were divided into 2 homogenous weightmatched groups (600 g, n = 4). One group was fed ad libitum (12 MJ/kg, 22% protein); however, the second group was denied access to food during 16 h. Birds were cervically dislocated, and tissues (hypothalamus, liver, and leg muscle) were quickly removed and snap frozen at −80°C until use.
Cerulenin Treatment In Vitro Cell Cultures. Leghorn male hepatoma (LMH; Kawaguchi et al., 1987) and quail myoblasts (QM7; Antin and Ordahl, 1991) cell lines were cultured in McCoy 5A medium supplemented with heat-inactivated fetal bovine serum (10%), chicken serum (1%), penicillin-streptomycin (100 μg/mL), and amphotericin B (100 μg/mL) at 37°C in a humidified atmosphere of 5% CO2 and 95% air. The reagents were purchased from Invitrogen (Belgium). At 80% confluence, the complete medium was removed and replaced by a medium without FBS overnight. Cells were then treated with cerulenin at concentrations of 2.5 to 10 μg/mL for 24 h. The doses and duration of treatment were chosen based on previous experiments (Li et al., 2001). Cerulenin was solubilized in dimethyl sulfoxide (10%) as a stock solution, and the final concentration of dimethyl sulfoxide in the cultures was at or below 0.2%. Control cells were treated with the same stock medium without cerulenin. Cell Viability. Cell viability after treatment with cerulenin was assessed by trypan blue exclusion assay (Sceiza et al., 2001) and was consistently found to be >90%. 3[H]-Thymidine Incorporation. Cells were plated in 96-well plates and grown overnight. On the second day, medium was changed and the specified concentrations of cerulenin were added and cells were pulse labeled with 1 μCi/mL 3[H]-thymidine for 24 h. Cells were then washed twice with ice-cold PBS and fixed with trichloroacetic acid. Precipitates were then dissolved in 0.1 M NaOH, and the incorporated radioactivity was determined by liquid scintillation counting.
Reverse-Transcription PCR Total RNA was isolated from tissues and cells using the Trizol reagent (Invitrogen, Belgium). Complementary DNA was synthesized from RNA samples by mixing 1 μg of total RNA, 10 units of avian myeloblastosis virus reverse transcriptase, 40 units of recombinant RNasin ribonuclease inhibitor, 1 mM deoxyribonucleotide triphosphate mixture, and 0.5 μg of random hexamer primers. The reagents were purchased from Promega (Belgium). The reverse-transcription (RT) reaction was assessed at 42°C for 45 min followed by incubation at 80°C for 3 min. A 2-μL aliquot of the RT product was then used for subsequent PCR amplification with 4 pairs of primers specific for chicken Hsp-70, uncoupling protein (UCP), carnitine palmitoyltransferase-1 (CPT-1), and 18S as a housekeeping gene (Table 1). The PCR was performed in 50-μL reactions containing 1 unit of Taq DNA polymerase (Roche Diagnostic, Belgium), 0.1 mM dNTP mixture, and 10 pmol of each forward and reverse primer. Previous experiments were carried out with various number of PCR cycles to determine nonsaturating conditions of PCR amplification for the studied genes. Thermal cycling parameters con-
2747
REGULATION OF Hsp-70 GENE EXPRESSION IN CHICKENS Table 1. Oligonucleotide PCR primers Gene1
GenBank accession number
Primer sequence (5′→3′; forward, reverse)
Size (bp)
Hsp-70
AY-143693
359
CPT-1
AY-675193
UCP
AB-088685
18S
AF-173612
AACCGCACCACACCCAGCTATG CTGGGAGTCGTTGAAGTAAGCG AAGGGTACAGCAAAGAAGATCCA CCACAGGTGTCCAACAATAGGAG ACTCCATCATTAACTGCGGC TTGATGTACCGCGTCTTCAC CTGCCCTATCAACTTTCG AATAGAACCGGAGTCCTA
1CPT,
181 171 515
carnitine palmitoyltransferase; Hsp, heat shock protein; UCP, uncoupling protein.
sisted of initial denaturation (95°C, 2–6 min), followed by 25 to 30 cycles of denaturation (95°C, 1 min), primer annealing (Table 1) for 1 min, and primer extension (72°C, 1 min to 1 min 30 s) with a final extension at 72°C for 10 min. The number of cycles used for each gene was in the linear amplification range.
Probe Labeling and Southern Blot Analysis The amplified fragments were separated on a low melting point agarose gel (1%) and the appropriate bands were cut out, purified by using Qiaquick gel extraction kit protocol (Qiagen, Belgium), and stored at −20°C. The cDNA fragments were cloned in the pPCR Script Amp SK (+) cloning vector using the pPCR Script Amp cloning kit (Stratagene, La Jolla, CA) and automatically sequenced using an ABI automated sequencer. The cloned fragments (25–30 ng) were labeled by random priming with (α-32P) dCTP (Feinberg and Vogelstein, 1983). The amplified PCR products were transferred to nylon membrane by using a vacuum blotting apparatus (Amersham Biosciences, the Netherlands) and cross-linked by UV irradiation and baked at 80°C for 20 to 30 min. Membranes were hybridized with heat-denatured 32P-labeled DNA probes, prepared as described above, at 42°C overnight. During the following day, the membranes were rinsed twice with 1× SSC, 0.1% SDS at 55°C. Each wash was for 20 min and then membranes were subjected to storage phosphor autoradiography cassette. Hybridization signals were quantified using phosphorimagery (Bio-Imaging Analyzer BAS 1000 Mac BAS, Fujix, TINA software, version 2.09, Belgium).
Plasma Parameter Measurement Circulating leptin concentrations were determined by RIA (Linco Research Co). Plasma corticosterone levels were measured by RIA (IDS Inc., UK). Plasma lipid peroxidation was estimated by spectrophotometric determination of TBA reacting substances (TBARS; Lin et al., 2004). Total plasma antioxidant activity was determined by ferric reducing/antioxidant power (FRAP) assays as described previously (Benzie and Strain, 1996). Plasma ceruloplasmin oxidase activity was measured with the p-Phenylenediamine end-point method (Sugiyama et al., 2000).
Statistical Analysis All data were analyzed by using the Student’s unpaired t-test. Significance was set at P < 0.05. Data from Southern blot analysis were expressed in arbitrary densitometry units normalized to the 18S rRNA levels, and values are expressed as means ± SEM. Analyses were performed using GraphPad Prism version 6.00 for Windows (GraphPad Software, La Jolla, CA).
RESULTS Effect of Cerulenin on Food Intake and Hsp70 Gene Expression in Broiler Chickens Cerulenin significantly reduced food intake (P < 0.05, Table 2) and increased Hsp-70 gene expression in muscle of 2-wk-old broiler chickens compared with the vehicle-treated group (Figure 1A). In contrast, hepatic
Table 2. Effect of cerulenin on food intake and plasma leptin, corticosterone, and oxidative stress indices levels [thiobarbituric acid reacting substances (TBARS), ferric reducing/antioxidant power (FRAP), and ceruloplasmin oxidase activity] Parameter Food intake (g/28 h) Leptin (ng/mL) Corticosterone (ng/mL) TBARS (µmol/L) FRAP (µmol/L) Ceruloplasmin oxidase activity (U/L) *Different from the control, P < 0.05.
Control 85.93 1.29 16.18 3.62 953.2 68.31
± ± ± ± ± ±
2.48 0.26 0.95 0.08 34.4 23.43
Cerulenin 67.07 1.00 35.17 3.60 1,240.6 65.34
± ± ± ± ± ±
1.95* 0.05 14.78 0.28 193.5 36.3
2748
Dridi et al.
Figure 1. Effect of cerulenin on heat shock protein (Hsp)-70 gene expression in broiler chickens. Two homogenous weight-matched groups of 2-wk-old broiler chickens (n = 4) were treated with cerulenin or RPMI medium as a control. Birds were cervically dislocated, and total RNA (1 μg) was isolated from muscle (A), liver (B), and hypothalamus (C) and subjected to reverse-transcription PCR coupled to Southern blot analysis in the presence of specific probes for chicken Hsp-70 and ribosomal 18S. Data are presented as a ratio of Hsp-70 to 18S, and values are mean ± SEM. *P < 0.05 indicates a significant difference between the cerulenin-treated group and the control. The data are representative of 2 independent experiments.
Figure 2. Effect of cerulenin on carnitine palmitoyltransferase 1 (CPT-1) and UCP gene expression in chicken muscle. Two homogenous weight-matched groups of 2-wk-old broiler chickens (n = 4) were treated with cerulenin or RPMI medium as a control. Birds were cervically dislocated, and total RNA was isolated from muscle and subjected to reverse-transcription PCR coupled to Southern blot analysis in the presence of specific probes for chicken CPT-1, UCP, and ribosomal 18S. Data are presented as a ratio of target gene (CPT-1 or UCP) to 18S, and values are mean ± SEM. *P < 0.05 indicates a significant difference between the cerulenin-treated group and the control. The data are representative of 2 independent experiments.
REGULATION OF Hsp-70 GENE EXPRESSION IN CHICKENS
2749
Figure 3. Effect of food deprivation on heat shock protein (Hsp)-70 gene expression in broiler chickens. Three-week-old male broiler chickens were submitted to 2 different nutritional states (food deprivation for 16 h or feeding ad libitum). Birds were cervically dislocated and total RNA was isolated from muscle (A), liver (B), and hypothalamus (C) and subjected to reverse-transcription PCR/Southern blot analysis. Data are presented as ratio of Hsp-70 to 18S, and values are means ± SEM (n = 4). The data are representative of 2 independent experiments.
and hypothalamic Hsp-70 mRNA levels were not affected by this treatment (Figure 2B and C, respectively).
Effect of Cerulenin on CPT-1 and UCP Gene Expression in Chicken Muscle Cerulenin treatment significantly (P < 0.05) increased CPT-1 and UCP mRNA levels in muscle of 2-wk-old broiler chickens compared with the vehicletreated group (Figure 2).
Effect of Food Deprivation on Hsp-70 Gene Expression in Broiler Chickens Food deprivation for 16 h did not affect Hsp-70 mRNA levels in all tissues examined (Figure 3).
Effect of Cerulenin on Hsp-70 Gene Expression in LMH and QM7 Cell Lines Cerulenin did not significantly affect Hsp-70 gene expression in both cell lines (Figure 4).
Effect of Cerulenin on Cell Viability and DNA Synthesis in LMH and QM7 Cell Lines Cerulenin treatment did not significantly affect the viability of cells and DNA synthesis as measured by [3H]-thymidine uptake after 24 h (Figure 5).
Effect of Cerulenin on Blood Parameters Cerulenin treatment did not elicit a change in plasma leptin, corticosterone, and oxidative stress indices (TBARS, FRAP, and ceruloplasmin oxidase activity) levels (Table 2).
DISCUSSION The Hsp-70 gene is expressed in normal cells, but is highly induced by physiological, pathological, and environmental stressors (for review, see Kiang and Tsokos, 1998). It has been shown that Hsp-70 gene expression is regulated by various hormones including feedingrelated hormones (Dhahbi et al., 2002; Chen et al., 2006). Leptin, the adipocyte-derived hormone, and the key regulator of food intake and energy homeostasis (Zhang et al., 1994) has been shown to modulate key processes involved in stress responses (Bouloumie et al., 1999; Oates et al., 2000). Kita et al. (2006) showed that leptin administration induce phosphorylation of the stress glucose-regulated protein (GRP)-58, which belongs to Hsp families and is induced by glucose starvation and viral infection (Lee, 1987; Mazzarella et al., 1994). We have shown also that recombinant chicken leptin downregulates Hsp-70 gene expression in normal chicken liver and hypothalamus (Figueiredo et al., 2007). Because the naturally occurring fatty acid synthesis inhibitor, cerulenin (Omura, 1976; Funabashi et
2750
Dridi et al.
Figure 4. Effect of cerulenin on heat shock protein (Hsp)-70 gene expression in Leghorn male hepatoma (LMH) and quail myoblast (QM7) cell lines. Cells were treated for 24 h with increasing doses (2.5, 5, and 10 μg/mL) of cerulenin. Total RNA was extracted and subjected to reversetranscription PCR/Southern blot analysis. Results are expressed as mean ± SEM of 3 replicates.
al., 1989) has been shown to reduce, as leptin, food intake and induce profound reversible weight loss (Loftus et al., 2000; Dridi et al., 2006) and because this antibiotic product was hypothesized to alter centrally, as leptin, the expression profiles of feeding related neuropeptides (Shimokawa et al., 2002), we predict that cerulenin may affect, like leptin, Hsp-70 gene expression. The present study provided important information about the interaction between cerulenin and Hsp-70 gene in normal (unstressed) conditions as estimated by plasma corticosterone and oxidative stress parameter (TBARS, FRAP, ceruloplasmin oxidase activity) levels. Cerulenin upregulated Hsp-70 mRNA levels in chicken
muscle, but not in liver or hypothalamus, indicating that the regulation of Hsp-70 gene expression is tissuespecific. This result corroborates previous data in birds (Leandro et al., 2004; Mahmoud et al., 2004) and mammals (Tanguay et al., 1993; Flanagan et al., 1995). In contrast to leptin treatment, which reduced chicken hepatic and hypothalamic Hsp-70 gene expression, treatment with cerulenin at doses that produce similar effects on food intake increased muscle Hsp-70 mRNA levels. Thus, these data indicate that cerulenin does not act as leptin at least for the Hsp-70 gene regulation; however, it does mimic some effects of leptin to reduce food intake (Dridi et al., 2006).
Figure 5. Effect of cerulenin on DNA synthesis in Leghorn male hepatoma (LMH) and quail myoblast (QM7) cell lines. Cells were treated for 24 h with increasing doses (2.5, 5, and 10 μg/mL) of cerulenin. The DNA synthesis is expressed as [3H]-thymidine incorporation in cpm/dish. Data are means from 3 wells ± SEM. The experiment was repeated at least 2 times.
REGULATION OF Hsp-70 GENE EXPRESSION IN CHICKENS
The causal link(s) between cerulenin and muscle Hsp-70 gene as well as the underlying molecular mechanism(s) are still unknown and further studies are warranted. It is known that Hsp-70 can interact directly with fatty acids (Guidon and Hightower, 1986) and the inhibition of fatty acid biosynthesis by cerulenin might trigger a so far (un)identified signal for subsequent induction of Hsp-70 gene expression. Among several potential candidates, we choice to analyze the expression of CPT-1 and UCP genes because of their key roles in β-oxidation and thermogenesis (McGarry and Brown, 1997; Ricquier and Bouillaud, 2000; Cha et al., 2004). In addition, these genes, particularly UCP (Raimbault et al., 2001), are specifically expressed in chicken muscle, the main site of thermogenesis and whole body β-oxidation (Duchamp and Barré, 1993). The CPT-I is the rate-limiting step for the entry of fatty acids into the mitochondria and the pace-setting enzyme of β-oxidation (McGarry and Brown, 1997). The UCP is a transporter of the inner mitochondrial membrane (Cinti et al., 1989), which is known to uncouple respiration from ATP synthesis by short circuiting the inward proton flow, resulting in heat production. Our data showed that cerulenin administration upregulates the expression of both genes (CPT-I and UCP) in broiler chicken muscle, corroborating previous findings in rodents (Cha et al., 2004; Jin et al., 2004). Avian UCP gene has previously been shown to be responsive to food deprivation (Toyomizu et al., 2006) and high fat feeding (Collin et al., 2003), suggesting sensitivity to alterations in fat abundance and oxidation rates. Furthermore, UCP was recently found to operate in recombinant system (yeast) as the mammalian thermogenic UCP-1 (Criscuolo et al., 2005) and its expression was concomitant to the variation of body temperature in chickens (Taouis et al., 2002). Altogether, these data suggest that cerulenin may alter sympathetic activity, induce CPT-1 and avian UCP gene expression, increase thermogenesis and energy expenditure, leading thereby to the elevation of core temperature (Jin et al., 2004), and then subsequently induce Hsp-70 gene expression. Further detailed biochemical studies are warranted to shed light on these possible mechanisms. Whereas cerulenin treatment led to a modest increase in plasma corticosterone in ad libitum-fed chickens, consistent with a mildly food-restricted state, cerulenin did not affect plasma oxidative stress indices (TBARS, FRAP, ceruloplasmin). Altogether, the present data suggest that cerulenin may act through mechanisms related to food intake rather than known effects of toxins or nonspecific stressors (Dridi et al., 2006). Nevertheless, such effects cannot yet be ruled out completely. In attempt to discriminate between the effect of cerulenin and cerulenin-reduced food intake on Hsp-70 gene expression, we also evaluated the effect of food deprivation on the same cellular responses. Food deprivation for 16 h was incapable of triggering Hsp-70 induction in all tissues examined, corroborating previous studies in rodents (Leoni et al., 2000). In contrast, Zulkifli et
2751
al. (2002) have reported that food restriction induced brain Hsp-70 protein expression in female broiler chickens. The mechanisms behind these differences are not clear and may be related to many factors such as sex, environmental and physiological context, and experimental protocols. Overall, our data indicated that the effect of cerulenin on Hsp-70 gene expression is independent of the reduction of food intake with respect to several variables. Therefore, heat shock proteins are considered as cell sensor of temperature variations and the induction of Hsp-70 is not a generalized response to stress but a specific consequence to hyperthermia that leads to protein denaturation. In fact, food deprivation for 16 h, which did not increase body temperature (Ozkan et al., 2003), did not affect Hsp-70 gene expression. However, cerulenin, which has been shown to increase core temperature (Jin et al., 2004) triggers Hsp-70 induction. To gain additional insight into the interaction between cerulenin and Hsp-70 gene expression and to ascertain whether this interaction is direct or indirect, we investigated the effect of cerulenin on Hsp-70 gene expression in LMH (Kawaguchi et al., 1987) and QM7 (Antin and Ordahl, 1991) cell lines. Cerulenin treatment did not affect Hsp-70 gene expression in both cell lines, suggesting that the effect of cerulenin observed in vivo may be mediated via the central nervous system, because intracerebroventricular administration of cerulenin activated the sympathetic nervous system, induced muscle CPT-1, and elevated core temperature in rats (Jin et al., 2004). In conclusion, the present study is the first to report the effect of cerulenin on Hsp-70 gene expression in different metabolically important tissues. Independent of its effect on food intake, cerulenin affects Hsp-70 gene expression in a tissue-specific manner, with an upregulation in muscle but not in liver or hypothalamus consistent with higher muscle CPT-1 and UCP mRNA levels. Further studies are warranted to shed light on the underlying molecular mechanisms and to ascertain whether cerulenin would have a similar effect in chickens following stress events.
ACKNOWLEDGMENTS The authors thank Gérard Cabello (INRA, Montpellier, France) for providing the QM7 cells.
REFERENCES Antin, P. B., and C. P. Ordahl. 1991. Isolation and characterization of an avian myogenic cell line. Dev. Biol. 143:111–121. Benzie, I. F. F., and J. J. Strain. 1996. The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: The FRAP assay. Anal. Biochem. 239:70–76. Bouloumie, A., T. Marumo, M. Lafontan, and R. Busse. 1999. Leptin induces oxidative stress in human endothelial cells. FASEB J. 13:1231–1238. Cha, S. H., Z. Hu, and M. D. Lane. 2004. Long-term effects of a fatty acid synthase inhibitor on obese mice: Food intake, hypothalamic
2752
Dridi et al.
neuropeptides, and UCP3. Biochem. Biophys. Res. Commun. 317:301–308. Chen, H. S., J. Jia, H. F. Su, H. D. Lin, J. W. Chen, S. J. Lin, J. Y. Yang, H. C. Lai, R. Mestril, and P. H. Wang. 2006. Downregulation of the constitutively expressed HSC 70 in diabetic myocardium is mediated by insulin deficiency. J. Endocrinol. 190:433–440. Cinti, S., C. Zancanaro, A. Sbarbati, M. Cicolini, P. Vogel, D. Ricquier, and S. Fakan. 1989. Immunoelectron microscopical identification of the uncoupling protein in brown adipose tissue mitochondria. Biol. Cell 67:359–362. Collin, A., R. D. Malheiros, V. M. Moraes, P. Van As, V. Darras, M. Taouis, E. Decuypere, and J. Buyse. 2003. Effects of dietary macronutrient content on energy metabolism and uncoupling protein mRNA expression in broiler chickens. Br. J. Nutr. 90:261–269. Criscuolo, F., M. M. Gonzalez-Barroso, Y. Le Maho, D. Ricquier, and F. Bouillaud. 2005. Avian uncoupling protein expressed in yeast mitochondria prevents endogenous free radical damage. Proc. Biol. Sci. 272:803–810. Dhahbi, J. M., S. X. Cao, P. L. Motel, B. C. Rowley, J. E. Wingo, and S. R. Spindler. 2002. Postprandial induction of chaperone gene expression is rapid in mice. J. Nutr. 132:31–37. Dridi, S., C. Ververken, F. B. Hillgartner, L. Arckens, E. Vander Gucht, L. Cnops, E. Decuypere, and J. Buyse. 2006. FAS inhibitor cerulenin reduces food intake and melanocortin receptor gene expression without modulating the other (an)orexigenic neuropeptides in chickens. Am. J. Physiol. Regul. Integr. Comp. Physiol. 291:R138–R147. Duchamp, C., and H. Barré. 1993. Skeletal muscle as the major site of nonshivering thermogenesis in cold-acclimated duckling. Am. J. Physiol. 265:R10176–R10183. Feinberg, A. P., and B. A. Vogelstein. 1983. Technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6–13. Figueiredo, D., A. Gertler, G. Cabello, E. Decuypere, J. Buyse, and S. Dridi. 2007. Leptin downregulates heat shock protein-70 (HSP-70) gene expression in chicken liver and hypothalamus. Cell Tissue Res. 329:91–101. Flanagan, S. W., A. J. Ryan, A. C. V. Gisolfi, and P. L. Moseley. 1995. Tissue-specific HSP-70 response in animal undergoing heat stress. Am. J. Physiol. 268:R28–R32. Fryer, S., G. Waller, and B. S. Kroese. 1997. Stress, coping, and disturbed eating attitudes in teenage girls. Int. J. Eat. Disord. 22:427–436. Funabashi, H., A. Kawaguchi, H. Tomoda, S. Omura, S. Okuda, and S. Iwasaki. 1989. Binding site of cerulenin in fatty acid synthesis. J. Biochem. 105:751–755. Gething, M. J., and J. Sambrook. 1992. Protein folding in the cell. Nature 355:33–45. Guidon, P. T. J., and L. E. Hightower. 1986. Purification and initial characterization of the 71-kilodalton rat heat-shock protein and its cognates as fatty acid binding proteins. Biochemistry 25:3231–3239. Haynes, W. G., D. A. Morgan, S. A. Walsh, A. L. Mark, and W. I. Sivitz. 1997. Receptor-mediated regional sympathetic nerve activation by leptin. J. Clin. Invest. 100:270–278. Jin, Y. J., S. Z. Li, Z. S. Zhao, J. J. An, R. Y. Kim, Y. M. Kim, J. H. Baik, and S. K. Lim. 2004. Carnitine palmitoyltransferase-1 (CPT-1) activity stimulation by cerulenin via sympathetic nervous system activation overrides cerulenin’s peripheral effect. Endocrinology 145:3197–3204. Kawaguchi, T., K. Nomura, Y. Hirayama, and T. Kitagawa. 1987. Establishment and characterization of a chicken hepatocellular carcinoma cell line, LMH. Cancer Res. 47:4460–4464. Kiang, J. G., and G. C. Tsokos. 1998. Heat shock protein 70 KDa: Molecular biology, biochemistry, and physiology. Pharmacol. Ther. 80:183–201. Kita, K., N. Okumura, T. Takao, M. Watanabe, T. Matsubara, O. Nishimura, and K. Nagai. 2006. Evidence for phosphorylation of rat liver glucose-regulated protein 58, GRP58/ERp57/ER-60, induced by fasting and leptin. FEBS Lett. 580:199–205. Leandro, N. S., E. Gonzales, J. A. Ferro, M. I. Ferro, P. E. Givisiez, and M. Macari. 2004. Expression of heat shock protein in broiler
embryo tissues after acute cold or heat stress. Mol. Reprod. Dev. 67:172–177. Lee, A. S. 1987. Coordinated regulation of a set of genes by glucose and calcium ionophores in mammalian cells. Trends Biochem. Sci. 12:20–23. Leoni, S., D. Brambilla, G. Risuleo, G. De Feo, and G. Scarsella. 2000. Effect of different whole body hyperthermic sessions on the heat shock response in mice liver and brain. Mol. Cell. Biochem. 204:41–47. Li, J. N., M. Gorospe, F. J. Chrest, T. S. Kumaravel, M. K. Evans, W. F. Han, and E. S. Pizer. 2001. Pharmacological inhibition of fatty acid synthase activity produces both cytostatic and cytotoxic effects modulated by p53. Cancer Res. 61:1493–1499. Lin, H., E. Decuypere, and J. Buyse. 2004. Oxidative stress induced by corticosterone administration in broiler chickens (Gallus gallus domesticus). 1 Chronic exposure. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 139:737–744. Loftus, T. M., D. E. Jaworsky, G. L. Frehywot, C. A. Townsend, G. V. Ronnett, M. D. Lane, and F. P. Kuhajda. 2000. Reduced food intake and body weight in mice treated with fatty acid synthase inhibitors. Science 288:2379–2381. Mahmoud, K. Z., F. W. Edens, E. J. Eisen, and G. B. Havenstein. 2004. The effect of dietary phosphorus on heat shock protein mRNAs during acute heat stress in male broiler chickens (Gallus gallus). Comp. Biochem. Physiol. C Toxicol. Pharmacol. 137:11–18. Makimura, H., T. M. Mizuno, X. J. Yang, J. Silverstein, J. Beasley, and C. V. Mobbs. 2001. Cerulenin mimics effects of leptin on metabolic rate, food intake, and body weight independent of the melanocortin system, but unlike leptin, cerulenin fails to block neuroendocrine effects of fasting. Diabetes 50:733–739. Mazzarella, R. A., N. Marcus, S. M. Haugejorden, J. M. Balcarek, J. Baldassare, B. Roy, L. J. Li, A. S. Lee, and M. Green. 1994. ERP61 is GRP58, a stress-inducible luminal endoplasmic reticulum protein, but is devoid of phosphatidylinositide-specific phosphatase C activity. Arch. Biochem. Biophys. 308:454–460. McGarry, J. D., and N. F. Brown. 1997. The mitochondrial carnitine palmitoyltransferase system from concept to molecular analysis. Eur. J. Biochem. 244:1–14. Oates, M., B. Woodside, and C. D. Walker. 2000. Chronic leptin administration in developing rats reduces stress responsiveness partly through changes in maternal behavior. Horm. Behav. 37:366–376. Omura, S. 1976. The antibiotic cerulenin, a novel tool for biochemistry as an inhibitor of fatty acid synthesis. Bacteriol. Rev. 40:681–697. Ozkan, S., Y. Akbas, O. Altan, A. Altan, V. Ayhan, and K. Ozkan. 2003. The effect of short-term fasting on performance traits and rectal temperature of broiler during the summer season. Br. Poult. Sci. 44:88–95. Raimbault, S., S. Dridi, F. Denjean, J. Lachuer, E. Couplan, F. Bouillaud, A. Bordas, C. Duchamp, M. Taouis, and D. Ricquier. 2001. An uncoupling protein homologue putatively involved in facultative muscle thermogenesis in birds. Biochem. J. 353:441– 444. Ricquier, D., and F. Bouillaud. 2000. The uncoupling protein homologues: UCP1, UCP2, UCP3, StUCP and AtUCP. Biochem. J. 345:161–179. Ryan, J. A., and L. E. Hightower. 1996. Stress proteins as molecular biomarkers for environmental toxicology. Pages 411–424 in Stress Inducible Cellular Responses. U. Feige, R. I. Morimoto, I. Yahara, and B. Polla, ed. Birkhäser Verlag, Basel, Switzerland. Sceiza, M. F., R. L. Daniel, E. M. Santos, and M. M. Jaeger. 2001. Cytotoxic effects of 10% citric acid and EDTA-T used as root canal irrigants: An in vitro analysis. J. Endod. 27:741–743. Shimokawa, T., M. V. Kumar, and M. D. Lane. 2002. Effect of fatty acid synthase inhibitor on food intake and expression of hypothalamic neuropeptides. Proc. Natl. Acad. Sci. USA 99:66–71. Shu, I. W., D. L. Lindenberg, T. M. Mizuno, J. L. Roberts, and C. V. Mobbs. 2003. The fatty acid synthase inhibitor cerulenin and feeding, like leptin, activate hypothalamic pro-opiomelanocortin (POMC) neurons. Brain Res. 985:1–12.
REGULATION OF Hsp-70 GENE EXPRESSION IN CHICKENS Sugiyama, T., Y. Kawarada, and F. Hirasawa. 2000. Caeruloplasmin. Pages 111–113 in Experimental protocols for reactive oxygen and nitrogen species. N. Taniguchi and J. M. C. Gutteridge, ed. The Oxford University Press, New York, NY. Tanguay, R. M., Y. Wu, and E. W. Khandjian. 1993. Tissue-specific expression of heat-shock proteins of the mouse in the absence of stress. Dev. Genet. 14:112–118. Taouis, M., V. De Basilio, S. Mignon-Grasteau, S. Crochet, C. Bouchot, K. Bigot, A. Collin, and M. Picard. 2002. Early-age thermal conditioning reduces uncoupling protein messenger RNA expresión in pectoral muscle of broiler chicks at seven days of age. Poult. Sci. 81:1640–1643. Toyomizu, M., T. Abe, M. Ueda, and Y. Akiba. 2006. Progressive alteration of UCP and ANT in skeletal muscle of fasted chickens. Jpn. Poult. Sci. 43:167–172.
2753
Valles, A., O. Marti, A. Garcia, and A. Armario. 2000. Single exposure to stressors causes long-lasting, stress-dependent reduction of food intake in rats. Am. J. Physiol. Regul. Integr. Comp. Physiol. 279:R1138–R1144. Van Eden, W., R. Van der Zee, and B. Prakken. 2005. Heat-shock proteins induce T cell regulation of chronic inflammation. Nat. Rev. Immunol. 5:318–330. Zhang, Y., R. Proenca, M. Maffei, M. Barone, L. Leopold, and J. M. Friedman. 1994. Positional cloning of the mouse obese gene and its human homologue. Nature 372:425–432. Zulkifli, I., M. T. Che Norma, D. A. Israf, and A. R. Omar. 2002. The effect of early-age food restriction on heat shock protein 70 response in heat-stressed female broiler chickens. Br. Poult. Sci. 43:141–145.
