Changes in Mouse Granulosa Cell Gene Expression during Early ...

0013-7227/05/$15.00/0 Printed in U.S.A.

Endocrinology 146(1):309 –317 Copyright © 2005 by The Endocrine Society doi: 10.1210/en.2004-0999

Changes in Mouse Granulosa Cell Gene Expression during Early Luteinization R. S. McRae, H. M. Johnston, M. Mihm, and P. J. O’Shaughnessy Department of Veterinary Preclinical Studies, University of Glasgow Veterinary School, University of Glasgow, Glasgow G61 1QH, United Kingdom Changes in gene expression during granulosa cell luteinization have been measured using serial analysis of gene expression (SAGE). Immature normal mice were treated with pregnant mare serum gonadotropin (PMSG) or PMSG followed, 48 h later, by human chorionic gonadotropin (hCG). Granulosa cells were collected from preovulatory follicles after PMSG injection or PMSG/hCG injection and SAGE libraries generated from the isolated mRNA. The combined libraries contained 105,224 tags representing 40,248 unique transcripts. Overall, 715 transcripts showed a significant differ-

ence in abundance between the two libraries of which 216 were significantly down-regulated by hCG and 499 were significantly up-regulated. Among transcripts differentially regulated, there were clear and expected changes in genes involved in steroidogenesis as well as clusters of genes involved in modeling of the extracellular matrix, regulation of the cytoskeleton and intra and intercellular signaling. The SAGE libraries described here provide a base for functional investigation of the regulation of granulosa cell luteinization. (Endocrinology 146: 309 –317, 2005)

T

HE TERMINAL DIFFERENTIATION event of ovarian follicles that avoid atresia is luteinization to form the corpus luteum. Studies using hypophysectomized, mutant, and knockout animals have shown that FSH regulates granulosa cell proliferation and development from the secondary stage to the preovulatory stage (1–3). Luteinization of these cells occurs after the ovulatory LH surge and is dependent upon expression of LH receptors on the developing granulosa cells. The regulatory mechanisms inducing luteinization remain uncertain, but it is clear that granulosa cells begin to luteinize before ovulation and the process may be linked to disintegration of cell-to-cell communication between granulosa cells and the oocyte (4, 5). After the LH surge and ovulation, the corpus luteum rapidly develops to become a highly active steroidogenic tissue and it plays an essential role in the establishment and maintenance of pregnancy. Several functional differences between presurge granulosa cells and luteal cells have been identified but the underlying, early molecular events that occur during terminal granulosa cell differentiation remain unclear. Earlier studies using microarray, differential display and subtractive hybridization techniques have identified a number of genes that show changes in expression during early luteinization (6, 7). This work has provided valuable insight into the luteinization process, but it is likely that genes identified in these studies represent a small fraction of those

undergoing change. As a step toward understanding the process of luteinization, and to identify genes undergoing regulation during the early phase of terminal differentiation, we have used the technique of serial analysis of gene expression (SAGE) (8) to provide a comprehensive profile of gene expression in granulosa cells before and after a luteinizing dose of human chorionic gonadotropin (hCG). Materials and Methods Animals and treatments The mice used in this study were bred at the University of Glasgow Veterinary School and were maintained as required under United Kingdom Home Office regulations. Normal mice, bred on a C3H/Heh-101/H genetic background, were derived from stock animals originally obtained from the MRC Radiobiology Unit (now the MRC, Mammalian Genetics Unit, Harwell, UK). To generate a preovulatory granulosa cell SAGE library, immature mice (aged 18 –22 d) were injected ip with a single dose of 5 IU pregnant mare serum gonadotropin (PMSG) and granulosa cells were collected 48 h later. To generate a SAGE library of granulosa cells undergoing luteinization, immature mice were treated with PMSG followed 48 h later by hCG, and granulosa cells were isolated after a further 12 h. To isolate the cells, ovaries were placed in DMEM (Invitrogen Ltd., Paisley, Scotland, UK) and granulosa cells were released from large antral follicles using needles. No attempt was made to remove oocytes from the isolated granulosa cells. Cells were stored in liquid N2 until RNA extraction.

Construction and analysis of SAGE libraries First Published Online September 30, 2004 Abbreviations: ATM, Ataxia-telangiectasia mutated; EST, expressed sequence tag; 3␤HSD, 3␤-hydroxysteroid dehydrogenase type 1; PMSG, pregnant mare serum gonadotropin; RACE, rapid amplification of cDNA ends; SAGE, serial analysis of gene expression; SPARC, secreted acidic cysteine-rich glycoprotein; Spp1, secreted phosphoprotein 1; SRB1, scavenger receptor class B type 1; StAR, steroidogenic acute regulatory protein; ZP, zona pellucida. Endocrinology is published monthly by The Endocrine Society (http:// www.endo-society.org), the foremost professional society serving the endocrine community.

The RNA from PMSG and PMSG/hCG-treated granulosa cells was extracted using TRIzol reagent (Invitrogen Ltd.). The SAGE libraries were constructed from RNA pooled from granulosa cells of 30 different mice. Poly-A⫹ RNA was isolated using oligo deoxythymidine cellulose (Invitrogen Ltd.) and SAGE libraries were constructed and analyzed as previously described (9). Fourteen nucleotide SAGE tags, representing individual transcripts, were extracted from the sequence data and initially analyzed using SAGE 2000 software (http://www.sagenet.org/ sage_protocol.htm). Differences in tag frequency between SAGE libraries were statistically analyzed using the ␹2 test (10). Tags were identified through mouse SAGEmap database build 136. The original SAGE data

309

310

Endocrinology, January 2005, 146(1):309 –317

McRae et al. • Gene Expression during Luteinization

from each library described here have been deposited in the National Center for Biotechnology Information (NCBI) public gene expression database (http://www.ncbi.nlm.nih.gov/geo/) accession nos. GSM30721 and GSM30722.

Rapid amplification of cDNA ends (RACE) For those tags which could not be identified by comparison to the NCBI database, it was necessary to generate additional 3⬘ sequence to identify the source mRNA species. This was done using a 3⬘ RACE technique similar to that described previously (11) but using biotinylated primer TTCTAGAATTCAGCGGCCGC(T)30(AGC)(AGCT) to prime reverse transcription.

Real-time PCR Levels of specific mRNA species were measured by real-time PCR using the Taqman method as described previously (12). The tissue used to generate RNA for real-time PCR was prepared using the same protocols as above for generation of SAGE libraries (see Construction and analysis of SAGE libraries). The sequences of primers and probes used for real-time PCR were as shown in Table 1 and in previous studies (12, 13).

Results Ovarian response to hormone treatment

After a single injection of PMSG, the ovaries of immature mice contained numerous large antral follicles which provided granulosa cells for the PMSG SAGE library. These follicles ovulated around 13–14 h after a subsequent injection of hCG and luteinizing granulosa cells were, therefore, collected from intact follicles 12 h after hCG injection to generate the PMSG/hCG library. SAGE libraries

The total number of tags sequenced in the PMSG library (treatment with PMSG alone) was 51,528, and the total number sequenced in the PMSG/hCG library (treatment with PMSG followed by hCG) was 53,696. The combined total of 105,224 tags corresponded to 40,248 unique transcripts, of which 9,877 were represented by two or more tags. Of the transcripts represented by more than one tag, 5,689 were shared between both libraries, 1,806 were unique to the PMSG library, and 2,382 were unique to the PMSG/hCG library. Using ␹2 analysis to test for significant differences in

tag abundance between those tags with greater than five transcripts present in the combined libraries, 499 tags were significantly up-regulated by hCG treatment (P ⬍ 0.05), and 216 tags were significantly down-regulated (P ⬍ 0.05). Abundant, differentially expressed SAGE tags

The most abundant tags that were shown to be differentially expressed between SAGE libraries by ␹2 test are shown in Table 2. Most of these tags match unambiguously to known genes and a number of them are known to be expressed in granulosa cells during FSH-dependent development [e.g. inhibin ␤B and follistatin (14, 15)] or to show a change in expression after luteinization [e.g. P450 11a1, 17␤hydroxysteroid dehydrogenase type 1 and scavenger receptor class B type 1 (SRB1) (16 –18)]. This list also contains 36 tags, including six of the eight most abundant tags, which have no match, are linked to sequence of unknown function or have multiple assignments. A number of these tags, without confirmed or reliable matches in the SAGEmap database, were analyzed further using 3⬘RACE (indicated by an asterisk in Table 2). The transcript associated with the tag CAGTCAATAC is of interest because it shows abundant, differentially regulated expression. The 3⬘RACE data from this tag matched it to Unigene cluster Mm.290944, which shows 95% homology with a noncoding human mRNA sequence. This tag, in addition, is not highly expressed in other mouse SAGE libraries and appears to show a degree of selectivity for the granulosa cell. The expression pattern for this sequence has been confirmed using real-time PCR (Fig. 1, noncoding RNA). Other tags extended by 3⬘RACE could be linked to Unigene clusters or to individual expressed sequence tags (ESTs). These ESTs may be linked to Unigene clusters (e.g. TTGTTGCTAC matches EST BY419395, which is located on the genome close to Mm.190648) or may represent unique transcribed regions. Functional groups

Table 3 shows the frequency of expression of a number of tags in the PMSG and PMSG/hCG libraries, which represent genes linked with established functional groups. The list is

TABLE 1. Sequences of real-time PCR primers and probes used in this study Gene

Aromatase Riken 9530076L18 Kit ligand FSH receptor LH receptor Wbscr 1 Cholesterol scc GAPDH StAR 3␤HSD I a

Primer/probea

Sequence

F R P F R P

CCGAAAAAGAATGACCTGTCCTT TTGTCTGAATTCCTTGGAGAGAAAA CACCCAAATGAGGACAGGCACCTTGT TTCTTTAACCAATGTCTGGCTAATG TCCAACCGTTATCTCTTTAAACATAT TGAGTGCATTTCAACTATGTCAATGGTTTCTT As previously published (13) As previously published (13) As previously published (12) As previously published (12) As previously published (12)

F R P

TGCCCCCATGTTTGTGATG TCATGAGCCCTTCCACAA TTGTCAGCAATGCATCCTGCACCAC As previously published (12) As previously published (12)

F, Forward primer; R, reverse primer; P, probe; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; scc, P450 side chain cleavage.


not exhaustive and does not, in general, include genes with low levels of expression. This table is designed to show changes (or lack of them) in the expression of selected genes during granulosa cell luteinization. In each of the categories, there are genes listed that have been shown previously to be regulated during luteinization or which are know to be expressed in the corpus luteum [e.g. gap junction protein Cx43 (␣1), steroidogenic acute regulatory protein (StAR), adrenodoxin, tissue inhibitor of metalloproteinase 1 (TIMP 1), and cathepsin L (6, 19 –23)]. In addition, there are a number of genes listed which have not previously been shown to be regulated during luteinization such as cofilin, seizure-related 6 homolog (mouse)-like 2 (Sez6l2), and the listed transcription factors. To determine the contribution of oocyte mRNA to the SAGE libraries, the frequency of tags representing oocytespecific genes (24 –26) was determined in the two libraries. There were no tags representing the genes Nobox, factor in the germline-␣ (Fig␣), and ataxia-telangiectasia mutated (ATM) present in either library, whereas zona pellucida (ZP)-2 and ZP-3 were represented by a single tag each in one library. The signaling molecules bone morphogenic protein 15 (BMP15) and growth differentiation factor 9 (GDF9) were represented by a maximum of four and 11 tags, respectively. Real-time PCR

Real-time PCR was used to determine whether differences in gene expression between granulosa cell SAGE libraries could be confirmed for a number of transcripts. To normalize the data from real-time PCR, the housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used because it is expressed equally in both SAGE libraries (Table 3). Results in Fig. 1 show that, for these selected transcripts, there is good correlation between data obtained by real-time PCR and data derived from SAGE libraries. Discussion

The SAGE method allows for a quantitative, qualitative, and comprehensive measurement of gene expression patterns in cell populations and tissues. We have applied SAGE, in this study, to an examination of the changes in transcript expression patterns in granulosa cells from mature antral follicles before and after the start of gonadotropin-induced luteinization. One potential problem with the SAGE technique is that it can be time consuming, and this can impose a practical limitation on the number of libraries generated in any one particular study. Thus, in this report we have limited identification of genes involved in luteinization to a single time after induction by hCG. Nevertheless, the data produced from these studies provide both a base for studies into granulosa cell development and function and a comprehensive list of genes undergoing regulation during early granulosa cell luteinization. A number of previous studies have examined changes in gene expression in granulosa cells during luteinization (6, 18, 19, 21, 22, 27, 28). In general, these studies examined changes in a single or limited number of genes over the time course of luteinization and have served to provide a valuable insight into the development of the corpus luteum. Genes that have


311

been shown to alter expression during luteinization include, for example, the steroidogenic enzymes and associated proteins [e.g. P45011a1, adrenodoxin, P45019a1, StAR, and SRB1 (6, 18, 21, 22)], extracellular matrix modifiers [e.g. A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif 1 (ADAMTS-1), cathepsin L (6, 19)], signaling molecules [e.g. epiregulin, secreted frizzledrelated protein-4 and wnt 4 (27, 28)] and others [e.g. regulator of G protein signaling protein-2 and cell surface antigen CD63 (6)]. In general, results from these previous studies correlate well with the SAGE data reported here. When taken alongside results using real-time PCR (Fig. 1), this is a further indication that the SAGE results are a reliable measure of changes in gene expression at the selected stage of luteinization. Previous SAGE studies have also shown that the technique is highly reproducible and accurate (29). The SAGE libraries reported in this study were generated predominantly from granulosa cell mRNA, but oocytes were present in the isolated cell mix and would have contributed to the total mRNA pool used in library construction. The expression of tags representing the oocyte-specific genes (24 –26) Nobox, Fig␣, ATM, ZP-3, and ZP-2 was very low or undetectable, and only BMP15 and GDF9 were represented by more than a single tag. Both ZP-3 and ATM are known to be highly expressed within the oocyte (24), and it is unlikely, therefore, that oocyte-derived genes will contribute significantly to the overall tag number. Care in interpretation may be required for low abundance tags, however, because these could have an oocyte origin. Genes known to be associated with luteinization

The most fundamental change in granulosa/luteal cell function after induction of luteinization is a marked increase in steroidogenic activity by the developing corpus luteum. It has been shown previously that this is associated with increased expression of P45011a1, SRB1, StAR, ferredoxin, and low-density lipoprotein receptor and decreased expression of P45019a1 (aromatase) and 17␤-hydroxysteroid dehydrogenase type 1 (18, 21, 22). The overall effect is a reduction in estrogen production and a marked increase in progesterone production through increased availability of substrate and converting enzymes. As described above in second paragraph of Discussion, each of these previously reported changes in gene expression correlates well with changes in the tag numbers associated with the SAGE libraries generated for this study. One possible anomaly, however, between the SAGE data and previous studies is the expression of 3␤-hydroxysteroid dehydrogenase (3␤HSD) during luteinization. It has previously been shown that 3␤HSD activity and expression increase in the developing corpus luteum in line with the general increase in steroidogenic activity (30, 31). Data from the SAGE libraries, in contrast, indicate that 3␤HSD type 1 expression is reduced in granulosa cells 12 h after hCG treatment. This change was confirmed by real-time PCR and it appears likely, therefore, that luteinization leads to a temporary decrease in 3␤HSD expression, perhaps through down-regulation induced by exposure to high gonadotropin levels, which reverses as the corpus luteum develops.

312



TABLE 2. Most abundant differentially expressed tags Tag sequence

PMSG tags

hCG tags

Total tags

P

Unigene ⫺39

TAATGTAGAC CCTTTAATCC TTGCTGCCTT TCGCTGCTTT TTGTTGCTAC TTGCTACTTT AACTGAGGGG ATGACTGATA CAAACACCGT GGTTAAATGT AGCAAGAATT CAGTCAATAC TGGTTGCTGG GCTCTGGGAG ACTGAAGCAA AACAGGGCCA GAAAATGAGA GGATTTGGCT TAACTGACAA AGGCAATAAA CAAACTCTCA AAAGCACACA AAGAGGCAAG GGGCATTTGA TACAGTATAA AAAACAGTGG ATACTAACGT GGAAGCCACT AGAATGTTAT CCTCCCCTTG ACACATTATT TTGCTGCTTT TTGTCAGGTA GCGAAGCTCA CCATCGTCCT GAAAAGTGGA GATACTTGGA TGCTGTGCAT TGTCATCTAG GTGGCGCACG TAGTGGGGAG GGATGGGGAG TGGCTCGGTC ACAGTTAATT TATGAATGCT TACTACATAG AGACACTTCC CCCTTCTTCT TAGATATAGG TAAATGTGCA AGGACAAATA TATAGTGTAA GGTCAAGATA AAGATCAAGA CTCTGAATAC GGGGGAGCAT

405 397 39 13 8 6 49 105 2 56 28 212 149 152 46 13 133 107 11 3 16 0 87 11 98 91 6 79 3 1 15 0 20 5 13 9 3 14 1 54 10 3 4 0 7 0 6 44 6 45 9 8 46 6 6 42

116 61 410 418 387 367 306 215 278 206 226 30 70 56 146 159 28 51 140 143 116 128 37 108 9 16 99 26 97 98 81 89 68 74 66 69 73 60 67 10 50 54 53 55 48 54 48 10 47 8 44 43 4 44 43 6

521 458 449 431 395 373 355 320 280 262 254 242 219 208 192 172 161 158 151 146 132 128 124 119 107 107 105 105 100 99 96 89 88 79 79 78 76 74 68 64 60 57 57 55 55 54 54 54 53 53 53 51 50 50 49 48

2.4 ⫻ 10 1.5 ⫻ 10⫺58 2.7 ⫻ 10⫺65 4.0 ⫻ 10⫺81 1.3 ⫻ 10⫺77 1.2 ⫻ 10⫺74 6.4 ⫻ 10⫺40 9.8 ⫻ 10⫺09 2.0 ⫻ 10⫺58 6.4 ⫻ 10⫺19 1.9 ⫻ 10⫺33 5.0 ⫻ 10⫺33 2.4 ⫻ 10⫺08 5.5 ⫻ 10⫺12 6.6 ⫻ 10⫺12 3.6 ⫻ 10⫺27 2.5 ⫻ 10⫺17 3.5 ⫻ 10⫺06 2.6 ⫻ 10⫺24 2.0 ⫻ 10⫺29 5.0 ⫻ 10⫺17 3.8 ⫻ 10⫺28 3.6 ⫻ 10⫺06 9.3 ⫻ 10⫺18 2.6 ⫻ 10⫺18 1.7 ⫻ 10⫺13 1.7 ⫻ 10⫺18 1.2 ⫻ 10⫺07 9.0 ⫻ 10⫺20 3.4 ⫻ 10⫺21 1.2 ⫻ 10⫺10 6.3 ⫻ 10⫺20 1.4 ⫻ 10⫺06 7.9 ⫻ 10⫺14 1.4 ⫻ 10⫺08 7.9 ⫻ 10⫺11 10 ⫻ 10⫺15 4.3 ⫻ 10⫺07 1.2 ⫻ 10⫺14 3.0 ⫻ 10⫺08 1.1 ⫻ 10⫺06 9.8 ⫻ 10⫺11 5.5 ⫻ 10⫺10 9.9 ⫻ 10⫺13 1.6 ⫻ 10⫺07 1.6 ⫻ 10⫺12 5.6 ⫻ 10⫺08 3.4 ⫻ 10⫺06 8.9 ⫻ 10⫺08 3.4 ⫻ 10⫺07 6.1 ⫻ 10⫺06 3.9 ⫻ 10⫺06 2.7 ⫻ 10⫺09 3.6 ⫻ 10⫺07 5.7 ⫻ 10⫺07 2.0 ⫻ 10⫺07

GACTCAGGGC TACATTCCAA AATTTCAAAA TACCTTGACA TTGAAATTAC AATCACTGTG GATTGTCAGA TTAGAAGTGA ACAATAATGA ACAACTCCAC

0 1 41 0 0 0 2 1 2 0

47 45 5 45 45 44 42 40 38 39

47 46 46 45 45 44 44 41 40 39

4.9 ⫻ 10⫺11 5.5 ⫻ 10⫺10 1.1 ⫻ 10⫺07 1.3 ⫻ 10⫺10 1.3 ⫻ 10⫺10 2.2 ⫻ 10⫺10 5.2 ⫻ 10⫺08 6.4 ⫻ 10⫺09 6.4 ⫻ 10⫺08 2.5 ⫻ 10⫺09

4504 10305 272225 332172 277498 288474 930 1061 290944 140811 4603 14245 147226 27154 291442 234253 108678 3092 21529 34102 180003

250254 148155 265 15295 297 321665 4071 200422 283926 196173 4575 584 196110 4913 261750 188939 214950 2442 2793 2580 3401 42767 4791 4491 33240 12842

Gene

Gap junction membrane channel protein ␣1 Hyaluronidase 1 Multiple match Transcribed sequences EST BY419395a Transcribed sequence Prosaposin Multiple Secreted phosphoprotein 1 Cathepsin L Ferredoxin 1 Riken 9530076L18a Multiple match 3␤-Hydroxysteroid dehydrogenase-1 Scavenger receptor class B, member 1 Multiple match Unmatched Ribosomal protein, large P2 Metallothionein 2 Vanin 1 Secreted acidic cysteine rich glycoprotein Unmatched Ribosomal protein S15a Cytochrome P450 11A1 Inhibin ␤B Rpl37a ribosomal protein L37a Ornithine decarboxylase, structural Ribosomal protein S27a Multiple match EST AA791500a Unmatched RIKEN cDNA Malic enzyme, supernatant Ribosomal protein S25 Unmatched Epoxide hydrolase 2, cytoplasmic Transcribed sequences Fibroblast growth factor inducible 14 Laminin receptor 1 (ribosomal protein SA) Multiple match Expressed sequence AU020206 Seizure-related 6 homolog (mouse)-like 2 ␥-Actin, cytoplasmic Unmatched Chondroitin sulfate proteoglycan 2 Unmatched Annexin A2 Hemoglobin ␣, adult chain 1 Unmatched Follistatin RIKEN B430306D02 Unmatched 17␤-Hydroxysteroid dehydrogenase 1 Actin, ␣ 1, skeletal muscle Calcium binding protein, intestinal Sialyltransferase 4C (␤-galactoside ␣-2,3sialytransferase) Syndecan 1 Proprotein convertase subtilisin/kexin type 5 Ribosomal protein S17 Epiregulin Proline-rich protein MP5 Epithelial V-like antigen Vinculin Multiple match Unmatched EST BG148701a



313

TABLE 2. Continued Tag sequence

PMSG tags

hCG tags

Total tags

P

Unigene ⫺09

1421

⫻ 10⫺05 ⫻ 10⫺08 ⫻ 10⫺07 ⫻ 10⫺08 ⫻ 10⫺06 ⫻ 10⫺08 ⫻ 10⫺06 ⫻ 10⫺08 ⫻ 10⫺08 ⫻ 10⫺07 ⫻ 10⫺07 ⫻ 10⫺07 ⫻ 10⫺07 ⫻ 10⫺06 ⫻ 10⫺06 ⫻ 10⫺07 ⫻ 10⫺07 ⫻ 10⫺06 ⫻ 10⫺06 ⫻ 10⫺06 ⫻ 10⫺05 ⫻ 10⫺06 ⫻ 10⫺06 ⫻ 10⫺05 ⫻ 10⫺05 ⫻ 10⫺06

28405

TACTTTATAA

0

39

39

2.5 ⫻ 10

GGTTATAATA TCCCGGATCA CGAAGCACAA ACTTCCTTTC TTTTTGATAA TGCCCGATCA AACAAAGGTA ACGCAGGTGT TCCCCCCCCT ATCAGTGTGC ACCGGGTCAT ATTTGACTGG TTTGTAATAA TCTCGTAATG GGGAGCGAAA AGGCTGACAA TCCCCCCCCC TTAAATGCAG CTCAGTAAGC GGGCAGATTG AGCGACAAAC CACATTATCA GGAGCAGACC GAAAGCCTCT GATTGGCAGG TAGTATGGTA

5 35 2 0 3 33 3 0 0 1 1 1 0 1 2 0 0 1 1 0 1 0 0 1 23 0

34 2 35 36 32 1 31 33 33 32 30 30 30 29 28 28 28 27 26 26 25 25 25 24 1 23

39 37 37 36 35 34 34 33 33 33 31 31 30 30 30 28 28 28 27 26 26 25 25 25 24 23

1.3 7.1 2.8 1.1 4.0 5.4 6.4 4.9 4.9 3.3 8.8 8.8 2.2 1.4 8.5 5.9 5.9 3.9 6.4 1.6 1.0 2.6 2.6 1.7 1.1 7.1

a

42095 66275 303701 29902 275555 206919 5938 1366 42095 34871 35088 3742 339050 264680 28099 8245 14460

Gene

A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1 (Adamts1) Serum/glucocorticoid-regulated kinase Unmatched Unmatched Unmatched Secreted frizzled-related sequence protein 4 Hypothetical protein B230331P10 RIKEN 9930013L23 Phosphoserine aminotransferase 1 Multiple Calponin 3, acidica RIKEN 3732409C05 Myosin heavy chain IX Endothelin 2 Secreted frizzled-related sequence protein 4 Inhibitor of DNA binding 2 Unmatched Cholinergic receptor, nicotinic, ␤ polypeptide 2 F3 coagulation factor III Carbohydrate sulfotransferase II RIKEN 1810049K24 Unmatched Sterol O-acyltransferase 1 Unmatched Tissue inhibitor of metalloproteinase 1 Multiple match Aldo-keto reductase family 1, member B7

Mappings come from 3⬘ RACE data.

Data from the SAGE libraries show that the expression levels of several cytoskeletal-associated transcripts including actin, vinculin, cofilin, tubulin, and tropomyosin, are differentially regulated during luteinization. There is also significant differential expression of actin and tubulin isoforms. It is known that gonadotropins will regulate cytoskeletal gene

FIG. 1. Comparison of SAGE and real-time PCR data. Results show changes in expression of specific genes in granulosa cells of PMSGtreated ovaries from mice before or after injection with hCG. Gene expression was measured by real-time PCR or by SAGE and results are expressed as fold increase or fold decrease in expression after hCG. The real-time PCR data show the mean of six pools of RNA in each group, and each RNA pool was derived from granulosa cells isolated from two or more animals. The SAGE data were derived from that shown in Tables 2 and 3. arom, Cytochrome P450 aromatase; ␤-act, ␤-actin; FSHR, FSH receptor; kit, kit ligand; LHR, LH receptor; ncRNA, noncoding RNA; scc, cytochrome P450 side chain cleavage; wbscr1, Williams-Beuren syndrome chromosome region 1.

expression in granulosa cells (32, 33) and cytoskeletal remodeling during luteinization is likely to be an essential part of the movement and morphological development of the cells. Several membrane-binding and communication-related components such as clusterin, annexin A2, and the gap junction membrane channel proteins (connexins) are known to show fluctuations in expression levels during granulosa cell development and luteinization. The overwhelming level of Cx 43 expression in the PMSG SAGE library supports current thinking that this is the primary means of intercellular communication between granulosa cells and reinforces the hypothesis of a functional granulosa cell syncytium throughout folliculogenesis (34). Expression of Cx43 decreases markedly after induction of luteinization, as shown previously (23), although it may continue to be expressed in the developing corpus luteum (35). Secreted acidic cysteine-rich glycoprotein (SPARC, osteonectin, basement membrane protein 40) is a highly expressed transcript which undergoes a 7-fold up-regulation during luteinization. SPARC is expressed in vivo where cells are undergoing proliferative or reorganizational activity (36), and it has previously been identified in follicular granulosa cells after the LH surge (37). It is possible that SPARC may play an essential role in the development of the corpus luteum because specific peptide fragments of the protein are strongly angiogenic (38). In the follicle, SPARC is found in both granulosa cells and oocytes, although expression in the oocyte may derive from adjacent granulosa cells (37). Calmodulin, a protein with strong structural and functional

314



TABLE 3. Tags associated with specific functional groups PMSG tags

hCG tags

Unigene

Extracellular matrix CCTTTAATCC GCTCCCCCAC CCAACGCTTT AAGATCAAGA TGTGCCAAGT GGTTAAATGT CCTCAGCCTG GTTTGCTGTG GGAGGGGGGA GACCACCTCT GCTCTAGCCA TGTTCATCTT GAAAGCCTCT GTGGCTCACG TGTGGTACGC CTTGCTCTGT GGAGGGATCA

397 7 2 6 36 56 24 12 10 2 6 2 1 11 4 6 14

61 6 10 44 30 206 20 9 7 7 10 13 24 9 8 35 20

10305 2509 193099 44176 190641 930 231395 22753 156919 7386 181021 234850 8245 217116 29373 4712 8131

Hyaluronidase Procollagen type IV Fibronectin 1 Epidermal GF, containing fibulin, like ECM protein 1 Collagen type XXV ␣ 1 Cathepsin L Cathepsin D Cathepsin B Cathepsin Z Microfibrillar-associated protein 2 Procollagen type IV ␣2 Procollagen type III ␣2 Tissue inhibitor of metalloproteinase 1 Matrix metalloproteinase 15 Matrix metalloproteinase 23 Integrin ␤1 Integrin-linked kinase

Membrane proteins GAAGAGAGCA TAATGTAGAC TCTCCAGGCG AGACACTTCC TTGTTACTGC AAGGGTGCTG GTGTTTTGTC GGTGGGACAC

12 415 55 48 1 1 44 6

9 116 31 6 11 10 25 16

243 4504 200608 584 20794 1620 201455 276326

Laminin ␣ 1 Gap junction membrane channel protein ␣1 Clusterin Annexin A2 Annexin A7 Annexin A5 Secretory carrier membrane protein 1 TMP 21 transmembrane trafficking protein

Steroidogenesis GGTCAAGATA CTAAAAAAAA CACCACCACC GTGCATTTCA GGGCATTTGA GAAGCTGTAT TGTGCCGGCC CAAACTGTAT GCTCTGGGAG ACTGAAGCAA GGTAACCTAA TGTCCACACA AGCAAGAATT

46 9 5 13 11 10 1 6 152 46 1 0 28

4 7 1 3 108 0 18 0 56 146 9 8 226

188939 12882 8877 5199 108678 5079 142364 196405 140811 4603 3213 196675 1061

17␤-Hydroxysteroid dehydrogenase 1 (17␤ HSD 1) 17␤ HSD 7 17␤ HSD 2 Cytochrome P450 19a1 (aromatase) Cytochrome P450 11a 1 (cholesterol side chain cleavage) 11␤-Hydroxysteroid dehydrogenase 2 StAR 3␤-hydroxysteroid dehydrogenase type 2 (3␤HSD 2) 3␤HSD 1 Scavenger receptor class B member 1 Low-density lipoprotein (LDL) receptor LDLR-related protein 8 Adrenodoxin

Cytoskeletal TGGCTCGGTC AAGATCAAGA GGCTGGGGGC GGATGGGGAG CCCTCACCCA GCAGGCACTC ATGTCTCAAA AAGGAAGAGA TGGAGCAGAC TTCAGGTGGT CCCGTAGCCC GACTGTGCCA TCCCCAATCA TTATGTTCAG TCTCGGGGGC

4 6 18 3 4 21 48 2 7 6 1 8 2 5 7

53 44 18 54 22 24 30 5 8 9 9 6 9 3 1

196173 214950 2647 4024 246377 1703 231463 7 27685 240839 121878 256858 21109 240433 219663

Actin ␥ cytoplasmic Actin ␣1, skeletal muscle Profilin Cofilin 1 nonmuscle Tubulin ␤2 Tubulin ␤5 Tubulin ␣2 Vimentin Tropomyosin 4 Tropomyosin ␥3 Tropomyosin ␣1 Dynein, cytoplasmic, light chain 1 Gelsolin Fibulin 5 Fibulin 1

3092 1100 4235 18459 182396 1810 233470 3904

Inhibin ␤B Inhibin ␣ Kit ligand FGF inducible 14 TGF ␤BP3 Connective tissue growth factor IGFBP 7 Fibroblast growth factor 15

Tag sequence

Cytokines, growth factors and signalling molecules TACAGTATAA 89 9 AGGTCCCTAC 39 27 TCTTAATGAA 22 11 TGCTGTGCAT 14 60 GTTTGTACAA 4 24 TTTGCACCTT 7 8 TAGCTTTAAA 5 3 AAAGCACCAT 7 1

Gene



315

TABLE 3. Continued PMSG tags

hCG tags

Unigene

0 45 10 4

45 8 10 24

4791 4913 4132 182396

Epiregulin Follistatin Suppressor of cytokine signalling 2 Latent transforming growth factor binding protein 3

Receptors and associated molecules GCACAATTG 27 CACCACCACA 11 AAGTAATGTG 1 AGGGCACTGG 13 TGTAAGGTGT 1 TTGCCATCTC 8 GGGTAGATAT 6 GCTGTTTTCA 15 TGACTCATCT 4 GGATGGGGAG 3 TGTCATCTAG 1 GGCCCTCTTT 1 CTTGCTCTGT 1 TCCCCCCCCC 0 TACTTGTGTT 3 TTCTTGGTTT 4 GCACTAGCTG 6 TTTAGGGGAG 12

12 16 12 6 4 16 13 11 3 54 67 3 35 28 18 13 9 5

35677 2924 2752 43760 254496 1644 142929 35009 57155 283926 4071 197552 4712 35088 15125 40636 9052 22440

Epidermal GF receptor pathway substrate 15 Platelet-derived growth factor receptor Prolactin receptor Nerve growth factor associated receptor protein FGF receptor LH Receptor AMH type 2 receptor G protein-coupled receptor 27 FSH receptor Seizure-related to homolog (mouse)-like 2 Laminin receptor 1 TGF␤ receptor 1 Integrin ␤1 (fibronectin receptor ␤) Cholinergic receptor, nicotinic, ␤-polypeptide 2 (neuronal) Stromal cell-derived factor receptor 1 G protein coupled receptor 48 Progesterone receptor membrane component 1 Thyroid hormone receptor associated protein 3

Cell cycle TACTGCTGAT TTTAATACAA TCGCTGCTGC AATGACACAA TAGTTGCAAA

11 10 20 10 9

250419 13725 27921 219645 2823

Cyclin 1 Cyclin L2 Cyclin G-associated kinase Cyclin-dependent kinase 8 B cell translocation gene 3

Metabolism and intracellular transport GACTGAATCT 23 GTGGGCGTGT 24 ATTAATCAGT 11 ACAATAATGA 2 GCCTCCAAGG 23 CCAATAAAA 38 TGATATGAGC 18 GCCCCGGAAT 61 GCAATCTGAT 25 ATACTAACGT 99 AGGGTGCAGT 2 TCCTGTGGGA 21 CTGGAGACGC 0 AGCCAAGAGA 5 CAGGCCACAC 46

33 27 32 38 24 31 15 33 23 6 4 7 11 1 30

298 5353 46754 658 5289 29324 9745 196605 188 34102 28146 4533 26743 38901 103838

Solute carrier family 25 member 3 Solute carrier family 29 member 3 Solute carrier family 38 member 2 Solute carrier family 25 member 5 Glyceraldehyde 3-phosphate dehydrogenase Lactate dehydrogenase 1, A chain Lactate dehydrogenase 2, B chain Hexokinase 1 Phosphoglycerate kinase 1 Ornithine decarboxylase Mevalonate (diphospho) decarboxylase Apolipoprotein A-IV Apolipoprotein A-I Fatty acid desaturase 2 ATP synthase Mit. F1 complex, ␤ subunit

Transcription factors ACCAAGAGTC TAGCTTTAGG AAAATGTACT TGCTACTTTA ATTGTAATAT ATCAAAATGT ATCCGGCGCC CCTTCAATCC TAGGCAAAAC TACCTACAAC

2 13 0 9 13 1 8 1 1 6

641 22480 130005 153415 4509 253067 153758 57874 246547 124328

Activating transcription factor 4 Cyclin D binding myb-like transcription factor 1 Myelin transcription factor 1 E2F transcription factor 5 Runt-related transcription factor 2 Myelin transcription factor 1-like Transcription elongation factor B (SIII), polypeptide 2 Transcription factor 23 Pituitary specific transcription factor 1 Trans-acting transcription factor 3

Tag sequence

TACCTTGACA TAAATGTGCA CTTGTATTTA GTTTGTACAA

9 4 3 2 5

12 0 11 0 2 7 0 7 6 1

similarities to SPARC, has been implicated in the resumption of meiosis in the starfish oocyte (39), and it is possible that up-regulation of SPARC after hCG may play a role in allowing resumption of meiosis in the oocyte. Genes with a poorly defined role in luteinization

In addition to confirming changes in gene expression previously reported or predicted, the SAGE data set reported

Gene

here also identifies a number of genes of interest that have not previously been linked to the process of early luteinization. This list is made up of genes with unknown function and genes with known function but no previous association with granulosa luteinization. Genes with known function and differentially regulated during luteinization include syndecan-1, secreted phosphoprotein 1 (Spp1), prosaposin, and vanin 1.

316


Syndecan-1 is a heparin sulfate-rich integral membrane proteoglycan, and it is expressed in a developmental and cell type-specific pattern (40), but it has not previously been identified as having a role in folliculogenesis or luteinization. Syndecans have major roles as matrix and cell surface receptors, coreceptors for growth factor signaling, internalization receptors, and soluble paracrine effectors (40). In addition, syndecan-1 appears to be capable of independent signaling and may play a role in regulation of Wnt signaling (40). Syndecan-1 is not expressed in the PMSG-stimulated library but shows a high level of transcript expression after hCG administration. Syndecans have a well-established involvement in the regulation of cytoskeletal organization (40) and a likely function of syndecan-1 in the luteinizing follicle is in the regulation of cytoskeletal assembly. Spp1 (also known as osteopontin or Eta-1) is among the most highly up-regulated tags after hCG administration. It is a multifunctional protein expressed in various cell types and involved in a number of physiological and pathological process including biomineralization, inflammation, leukocyte recruitment, cell survival, tissue repair, cell proliferation, and proliferation of vascular smooth muscle cells (41). It is possible, therefore, that Spp1 has multiple functions during luteinization. For example, it may act as a survival factor preventing onset of apoptosis during the critical phase of ovulation and luteinization. Equally, the effects on vascular smooth muscle suggest a possible role in the angiogenic process that accompanies formation of the corpus luteum. Prosaposin is expressed at a medium level in the antral follicle but shows a 6-fold up-regulation after hCG administration. The protein is either secreted or acts as a precursor of smaller saposins, and it has been shown to have diverse functions including involvement in the MAPK and Akt signaling pathways and maintenance of cell growth, differentiation, and survival (42). The likely role of prosaposin in development of the corpus luteum is uncertain but may, again, relate to overall function as a survival factor. Vanin 1 is a glycosylphosphatidylinositol-anchored cell surface molecule involved in thymic and gonadal development (43, 44). As with Spp1, it is also highly up-regulated in granulosa cells after hCG administration. Vanin 1 is expressed specifically in the Sertoli cells of the developing fetal gonad, and it has been suggested that it may be involved in the migration of mesenchynmal cells from the mesonephros into the developing gonad (43). The likely function of vanin 1 in the developing corpus luteum is unclear but, by analogy with developing thymic and gonadal tissue, it is possible that it may be involved in the cell migration that occurs early in corpus luteum formation to integrate both thecal and endothelial cells into the developing tissue. For those genes already discussed in this section, it is possible to hypothesize a possible function in ovulation and corpus luteum development based on known properties and functions of the genes in other tissues. The SAGE libraries described here also contain many other highly expressed or differentially expressed transcripts for which this not currently possible. Included among this latter group are (Sez6l2), proline-rich protein MP-5, and epithelial V-like antigen. In addition, the list of tags differentially regulated after hCG contains a considerable number that are unmatched in


the SAGEmap database or are matched only to EST clusters or uncharacterized transcripts. The challenge now will be to identify those genes from this list that are fundamentally involved in the process of luteinization and those genes that have a more downstream role in the development of the corpus luteum. Acknowledgments Received July 30, 2004. Accepted September 24, 2004. Address all correspondence and requests for reprints to: P. J. O’Shaughnessy, Institute of Comparative Medicine, University of Glasgow Veterinary School, Bearsden Road, Glasgow G61 1QH, United Kingdom. E-mail: p.j.o’[email protected]. This study was supported by awards from the Biotechnology and Biological Sciences Research Council (BBSRC) and the Wellcome Trust.

References 1. Abel MH, Wootton AN, Wilkins V, Huhtaniemi I, Knight PG, Charlton HM 2000 The effect of a null mutation in the follicle-stimulating hormone receptor gene on mouse reproduction. Endocrinology 141:1795–1803 2. Kumar TR, Wang Y, Lu N, Matzuk MM 1997 Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet 15:201–204 3. Halpin DM, Jones A, Fink G, Charlton HM 1986 Postnatal ovarian follicle development in hypogonadal (hpg) and normal mice and associated changes in the hypothalamic-pituitary ovarian axis. J Reprod Fertil 77:287–296 4. Smith MF, McIntush EW, Smith GW 1994 Mechanisms associated with corpus-luteum development. J Anim Sci 72:1857–1872 5. Simon AM, Goodenough DA, Li E, Paul DL 1997 Female infertility in mice lacking connexin 37. Nature 385:525–529 6. Espey LL, Richards JS 2002 Temporal and spatial patterns of ovarian gene transcription following an ovulatory dose of gonadotropin in the rat. Biol Reprod 67:1662–1670 7. Leo CP, Pisarska MD, Hsueh AJ 2001 DNA array analysis of changes in preovulatory gene expression in the rat ovary. Biol Reprod 65:269 –276 8. Velculescu VE, Zhang L, Vogelstein B, Kinzler KW 1995 Serial analysis of gene expression. Science 270:484 – 487 9. O’Shaughnessy PJ, Fleming L, Baker PJ, Jackson G, Johnston H 2003 Identification of developmentally-regulated genes in the somatic cells of the mouse testis using serial analysis of gene expression. Biol Reprod 69:797– 808 10. Man MZ, Wang X, Wang Y 2000 POWER_SAGE: comparing statistical tests for SAGE experiments. Bioinformatics 16:953–959 11. Chen JJ, Rowley JD, Wang SM 2000 Generation of longer cDNA fragments from serial analysis of gene expression tags for gene identification. Proc Natl Acad Sci USA 97:349 –353 12. O’Shaughnessy PJ, Willerton L, Baker PJ 2002 Changes in Leydig cell gene expression during development in the mouse. Biol Reprod 66:966 –975 13. Johnston H, Baker PJ, Abel M, Charlton HM, Jackson G, Fleming L, Kumar TR, O’Shaughnessy PJ 2004 Regulation of Sertoli cell number and activity by follicle-stimulating hormone and androgen during postnatal development in the mouse. Endocrinology 145:318 –329 14. O’Shaughnessy PJ, Gray SA 1995 Gonadotropin-dependent and gonadotropin-independent development of inhibin subunit messenger ribonucleic acid levels in the mouse ovary. Endocrinology 136:2060 –2065 15. Jorgez CJ, Klysik M, Jamin SP, Behringer RR, Matzuk MM 2004 Granulosa cell-specific inactivation of follistatin causes female fertility defects. Mol Endocrinol 18:953–967 16. Oonk RB, Krasnow JS, Beattie WG, Richards JS 1989 Cyclic AMP-dependent and AMP-independent regulation of cholesterol side-chain cleavage cytochrome P450 (P450scc) in rat ovarian granulosa cells and corpora lutea-cDNA and deduced amino-acid sequence of rat P450scc. J Biol Chem 264:21934 –21942 17. Ghersevich S, Nokelainen P, Poutanen M, Orava M, Autio-Harmainen H, Rajaniemi H, Vihko R 1994 Rat 17␤-hydroxysteroid dehydrogenase type1: primary structure and regulation of enzyme expression in rat ovary by diethylstilbestrol and gonadotropins in vitro. Endocrinology 135:1477–1487 18. Rajapaksha WRAKJS, McBride M, Robertson L, O’Shaughnessy PJ 1997 Sequence of the bovine HDL-receptor (SR-BI) cDNA and changes in receptor mRNA expression during granulosa cell luteinization in vivo and in vitro. Mol Cell Endocrinol 134:59 – 67 19. Oksjoki S, Soderstrom M, Vuorio E, Anttila L 2001 Differential expression patterns of cathepsins B, H, K, L and S in the mouse ovary. Mol Hum Reprod 7:27–34 20. Smith MF, Mcintush EW, Ricke WA, Kojima FN, Smith GW 1999 Regulation of ovarian extracellular matrix remodelling by metalloproteinases and their tissue inhibitors: effects on follicular development, ovulation and luteal function. J Reprod Fertil Suppl 54:367–381


21. Pescador N, Soumano K, Stocco DM, Price CA, Murphy BD 1996 Steroidogenic acute regulatory protein in bovine corpora lutea. Biol Reprod 55:485– 491 22. Rodgers RJ, Waterman MR, Simpson ER 1986 Cytochrome P-450scc, P45017␣, adrenodoxin, and reduced nicotinamide adenine dinucleotide phosphatecytochrome P-450 reductase in bovine follicles and corpora lutea. Changes in specific contents during the ovarian cycle. Endocrinology 118:1366 –1374 23. Itahana K, Morikazu Y, Takeya T 1996 Differential expression of four connexin genes, Cx-26, Cx-30.3, Cx-32, and Cx-43, in the porcine ovarian follicle. Endocrinology 137:5036 –5044 24. Neilson L, Andalibi A, Kang D, Coutifaris C, Strauss JF, Stanton JL, Green DPL 2000 Molecular phenotype of the human oocyte by PCR-SAGE. Genomics 63:13–24 25. Rajkovic A, Pangas SA, Ballow D, Suzumori N, Matzuk MM 2004 NOBOX deficiency disrupts early folliculogenesis and oocyte-specific gene expression. Science 305:1157–1159 26. Soyal SM, Amleh A, Dean J 2000 FIG␣, a germ cell-specific transcription factor required for ovarian follicle formation. Development 127:4645– 4654 27. Hsieh M, Mulders SM, Friis RR, Dharmarajan A, Richards JS 2003 Expression and localization of secreted frizzled-related protein-4 in the rodent ovary: evidence for selective up-regulation in luteinized granulosa cells. Endocrinology 144:4597– 4606 28. Park JY, Su YQ, Ariga M, Law E, Jin SL, Conti M 2004 EGF-like growth factors as mediators of LH action in the ovulatory follicle. Science 303:682– 684 29. Blackshaw S, Kuo WP, Park PJ, Tsujikawa M, Gunnersen JM, Scott HS, Boon WM, Tan SS, Cepko CL 2003 MicroSAGE is highly representative and reproducible but reveals major differences in gene expression among samples obtained from similar tissues. Genome Biol 4:R17 30. Juengel JL, Guy MK, Tandeski TR, McGuire WJ, Niswender GD 1994 Steady-state concentrations of messenger ribonucleic acid encoding cytochrome P450 side-chain cleavage and 3␤-hydroxysteroid dehydrogenase/⌬ 5,⌬4 isomerase in ovine corpora lutea during the estrous cycle. Biol Reprod 51:380 –384 31. Conley AJ, Kaminski MA, Dubowsky SA, Jablonka-Shariff A, Redmer DA, Reynolds LP 1995 Immunohistochemical localization of 3␤-hydroxysteroid dehydrogenase and P450 17␣-hydroxylase during follicular and luteal development in pigs, sheep, and cows. Biol Reprod 52:1081–1094 32. Sasson R, Rimon E, Dantes A, Cohen T, Shinder V, Land-Bracha A, Am-


33. 34. 35. 36. 37. 38.

39. 40. 41. 42. 43. 44.

317

sterdam A 2004 Gonadotrophin-induced gene regulation in human granulosa cells obtained from IVF patients. Modulation of steroidogenic genes, cytoskeletal genes and genes coding for apoptotic signalling and protein kinases. Mol Hum Reprod 10:299 –311 Grieshaber NA, Ko C, Grieshaber SS, Ji I, Ji TH 2003 Follicle-stimulating hormone-responsive cytoskeletal genes in rat granulosa cells: class I ␤-tubulin, tropomyosin-4, and kinesin heavy chain. Endocrinology 144:29 –39 Ackert CL, Gittens JE, O’Brien MJ, Eppig JJ, Kidder GM 2001 Intercellular communication via connexin43 gap junctions is required for ovarian folliculogenesis in the mouse. Dev Biol 233:258 –270 Khan-Dawood FS, Yang J, Dawood MY 1998 Hormonal regulation of connexin-43 in baboon corpora lutea. J Endocrinol 157:405– 414 Lane TF, Sage EH 1994 The biology of SPARC, a protein that modulates cell-matrix interactions. FASEB J 8:163–173 Bagavandoss P, Sage EH, Vernon RB 1998 Secreted protein, acidic and rich in cysteine (SPARC) and thrombospondin in the developing follicle and corpus luteum of the rat. J Histochem Cytochem 46:1043–1049 Reed MJ, Puolakkainen P, Lane TF, Dickerson D, Bornstein P, Sage EH 1993 Differential expression of SPARC and thrombospondin 1 in wound repair: immunolocalization and in situ hybridization. J Histochem Cytochem 41:1467– 1477 Santella L, Kyozuka K 1997 Association of calmodulin with nuclear structures in starfish oocytes and its role in the resumption of meiosis. Eur J Biochem 246:602– 610 Bellin R, Capila I, Lincecum J, Park PW, Reizes O, Bernfield MR 2002 Unlocking the secrets of syndecans: transgenic organisms as a potential key. Glycoconj J 19:295–304 Mazzali M, Kipari T, Ophascharoensuk V, Wesson JA, Johnson R, Hughes J 2002 Osteopontin—a molecule for all seasons. QJM 95:3–13 Morales CR, Zhao Q, Lefrancois S, Ham D 2000 Role of prosaposin in the male reproductive system: effect of prosaposin inactivation on the testis, epididymis, prostate, and seminal vesicles. Arch Androl 44:173–186 Bowles J, Bullejos M, Koopman P 2000 A subtractive gene expression screen suggests a role for vanin-1 in testis development in mice. Genesis 27:124 –135 Aurrand-Lions M, Galland F, Bazin H, Zakharyev VM, Imhof BA, Naquet P 1996 Vanin-1, a novel GPI-linked perivascular molecule involved in thymus homing. Immunity 5:391– 405

Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.