Changes in transferrin gene expression after ...

Agri Gene 1 (2016) 79–87

Contents lists available at ScienceDirect

Agri Gene journal homepage: www.elsevier.com/locate/aggene

Changes in transferrin gene expression after exposure to iron and Aeromonas hydrophila infection in yellow snapper (Lutjanus argentiventris) Martha Reyes-Becerril, Carlos Angulo, Miriam Angulo, Felipe Ascencio-Valle ⁎ Centro de Investigaciones Biológicas del Noroeste (CIBNOR), Av. Instituto Politécnico Nacional 195, Col. Playa Palo de Santa Rita, La Paz, B.C.S. 23096, Mexico

a r t i c l e

i n f o

Article history: Received 14 December 2015 Received in revised form 30 March 2016 Accepted 4 April 2016 Available online 9 August 2016 Keywords: Transferrin Iron Aeromonas hydrophila Yellow snapper Gene expression

a b s t r a c t Transferrin (Tfa) plays an important role in iron regulation and is also known to be involved in response to infections. In this study, the full-length cDNA of the transferrin gene from Lutjanus argentiventris was cloned and characterized. The full-length cDNA of the tfa was 2482 bp encoding 690 amino acids containing an N-terminal signal peptide and the two conserved lobes. Tfa protein was highly similar to fish transferrins such as those from Larimichthys crocea (80%), Pagrus major (80%) and Dicentrarchus labrax (80%). Transferrin constitutive expression was found to be the highest in spleen and head-kidney. Moreover, the mRNA expression levels of tfa were measured by real-time PCR at 24 and 96 h in juveniles exposed to iron (Fe2x) during Aeromonas hydrophila infection. In general, the expression of tfa decreased in liver and intestine and increased in gill and skin in the iron group compared to control. The iron followed by Aeromonas hydrophila infection group caused a down-regulation in transferrin gene expression in all analyzed tissues at any point during the experiment. These findings demonstrate the evolutionary conservation of transferrin functions in vertebrates, involved in both the immune response and iron metabolism. © 2016 Elsevier Inc. All rights reserved.

1. Introduction Iron homeostasis is crucial for most organisms' health, including fish. However, excessive accumulation of free iron in cells is potentially toxic for human and other animals (Wu et al., 2010; Hao et al., 2011). Therefore, to alleviate the potential deleterious effects of iron, cells have evolved many proteins that regulate transport, storage sequestration, and mobilization of this free iron, such as transferrin (Emerit et al., 2001). The central role of transferrin as an iron transporting protein has been extended by observations that modified versions of this protein, which also participates in the regulation of innate immunity (Haddad and Belosevic, 2009). For example, Ong et al. (2006) reported that transferrin acts as a positive acute phase protein and that it can create a bacteriostatic environment by sequestering free iron from invading pathogens. However, in conditions of inflammation, transferrin is known to act mostly as a negative acute phase protein (Bayne and Gerwick, 2001). As a major iron transporter in the blood of vertebrates, transferrin absorbs iron mainly in the gut, shuttles between peripheral

Abbreviations: DFX, Deferasirox; Fe2x, iron overload; LaTf, Lutjanus argentiventris transferrin; NUP, Nested Universal Primer A; OD, optical density; PCR, polymerase chain reaction; qRT-PCR, quantitative real-time RT-PCR; RACE, rapid amplification of cDNA ends; Tf, transferrin; UPM, Universal Primer A Mix. ⁎ Corresponding author. E-mail address: [email protected] (F. Ascencio-Valle).

http://dx.doi.org/10.1016/j.aggene.2016.04.002 2352-2151/© 2016 Elsevier Inc. All rights reserved.

sites of storage and use, and maintains sufficient iron level to support cells having a particular demand for iron (Jamroz et al., 1993; Yoshiga et al., 1997). Transferrin has been characterized in a variety of vertebrates including mammals, reptiles, and birds (Carpenter and Broad, 1993; Ciuraszkiewicz et al., 2007). Only few investigations have been performed in fish, especially on transferrin and its involvement in immune responses (Kvingedal et al., 1993; Wang et al., 2012; Ding et al., 2015). Induced expressions of transferrin by pathogens have been reported in Indian major carp, sea bass, Chinese black sleeper, catfish, and wuchang bream (Sahoo et al., 2009; Neves et al., 2009; Liu et al., 2010; Gao et al., 2013; Ding et al., 2015). From those pathogens, several Aeromonas spp. are of major importance because they produce diseases known as motile aeromonad septicemia (Austin and Austin, 1999), and they are implicated in the occurrence of severe diseases in aquatic animals. Aeromonas hydrophila have significantly caused mass mortalities in both wild and farmed freshwater/marine fish species with consequent catastrophic economic losses to the aquaculture sector (Sahoo et al., 2008). The identification of the iron-related immune genes would assist in better understanding their involvement in fish immune system. Therefore, the objective of our study was to characterize the transferrin gene in yellow snapper (Lutjanus argentiventris), an important fishery resource in the Gulf of California (México), and to analyze the transcriptional modulation of transferrin after treatment with iron (Fe2x) in the water and throughout a bacterial infection with A. hydrophila, one of the major bacterial diseases affecting fish.

80

M. Reyes-Becerril et al. / Agri Gene 1 (2016) 79–87

Table 1 Sequences of the primers used in this study. Gen

Gen abbreviation

Primer sequence (5′-3′)

Transferrin

TfRACE3′ TfRACE5′ TfNes5′ TfqPCRFw TfqPCRRv EF-1αqPCRFw EF-1αqPCRRv

CCGCAACGAGCCTTACTATGACTAC TGTCTGGTGCCATCTTTACAC GCCATCTTTACACAGCAGCTCGTAG TGTGTCAGCTGTGCAAGG TGTCTGGTGCCATCTTTACAC GCTGTAAGGGGGCTCGGTGG CCCTGCTGGCCTTCACCCTC

Transferrin Transferrin Elongation factor-1 α

2. Materials and methods 2.1. Bacterial preparation Aeromonas hydrophila strain Ah-315 used in this study was originally isolated from infected Atlantic salmon, (Salmo salar L.) by the Department of Medical Microbiology, University of Lund, Sweden. The Ah-315 strain was re-isolated from infected yellow snapper juveniles in the Laboratory of Microbial Pathogenesis, Centro de Investigaciones Biologicas del Noroeste (CIBNOR), La Paz, B.C.S., Mexico. The presumed Aeromonas isolates were confirmed according to Popof criteria (1984) and polymerase chain reaction (PCR) detection (Vazquez-Juarez et al., 2003). After culture harvest by centrifugation (3000g, 4 °C, 10 min), the supernatant was discarded and the pellet was re-suspended in phosphate-buffered saline (PBS 7.4). The optical density (OD) of the solution was adjusted to 1.0 at 600 nm, which corresponds to 1 × 109 cells ml−1. The bacterial suspensions were diluted with PBS to a final concentration of 1 × 108 cells ml−1 for the challenge experiment.

FeCl3·6H2O at 2x (where 1x is based on the normal concentration of sea water (Reyes-Becerril et al., 2014)). The groups were designed as follows: (1) control (marine water); (2) Fe2x (6.8 μg/ml) and injected intraperitoneally with PBS (0.85% NaCl, pH = 7.2); (3) Control (marine water); and (4) Fe2x (6.8 μg/ml) and injected intraperitoneally with 100 μl A. hydrophila (1 × 108 cells ml−1). The Fe2x treatment remained in marine water 24 h before the first (100%) water exchange. 2.4. Fe determination by atomic absorption spectrophotometry The concentrations of Fe in water samples (time 0 post-treatment) and tissues (96 h post-treatment) were analyzed using an atomic absorption spectrometer (AVANTA; GBC Scientific Equipment, Dandenong, Australia) with an air-acetylene flame. Similarly, kinetic of Fe concentration in marine water was determined during the first 24 h. Certified standard reference material TORT-2 (National Research Council of Canada, Ottawa) was used to check the accuracy of the instrument. The analytical values were within the range of certified values. 2.5. Fish sample collection The studies in this manuscript were approved by the Bioethical Committee of CIBNOR. Each fish was anesthetized with clove oil (Merck, Germany) at 50 μl per liter of water before collecting samples from fish. Two fish from each aquarium (6 fish/treatment) were randomly sampled at 24 and 96 h post-treatment. Liver, intestine, gill, and skin tissues were sampled and immediately stored at − 80 °C in TRIzol Reagent (Invitrogen) for the gene expression assay while the untreated healthy fish were used for tissue distribution gene analysis. 2.6. Cloning and sequencing of transferrin from yellow snapper

2.2. Fish Yellow snapper (Lutjanus argentiventris) specimens, with an average weight of 50 g, were obtained from a captive brood stock held in the marine finfish hatchery of Centro de Investigaciones Biologicas del Noroeste (CIBNOR), La Paz, B.C.S., México. Water quality in the recirculation system was ensured through biological and mechanical filtration (1, 10, and 100 μm irradiated with UV) and with 100% of water exchange each 24 h. Temperature and salinity were maintained at 26 °C (with a 12 h dark/12 h light photoperiod) and 35 psu, respectively; dissolved oxygen at 4.3–6.9 mg l−1 and pH at 7.7–8.1. Total ammonia and nitrite concentration remained below 0.02 mg l−1. Forty-eight yellow snappers were randomly placed in twelve running seawater tanks (100-l tanks/four fish per tank). Fish were acclimatized in the laboratory for one week before experimental manipulation. During the experiment, juveniles were fed once daily with commercial feed. 2.3. Experimental infection Yellow snappers were exposed to the different treatments (each one in triplicate) where the iron was added into the marine water as

With the homologous alignment of different cDNA of transferrin in other fish, the partial sequence of transferrin in yellow snapper was obtained by RT-PCR. Gene-specific primers were designed according to the known EST sequence of transferrin. To isolate the full-length cDNA of tfa, rapid amplification of cDNA ends (RACE) PCR was carried out using SMARTer™ RACE cDNA Amplification Kit (Clontech, USA). Briefly, total RNA was extracted from fish liver using TRIzol Reagent (Invitrogen, USA) and first strand cDNA was synthesized using the protocol recommended by the SMARTer™ RACE cDNA Amplification Kit. Then, 5′ strand was amplified using gene-specific primer TfaRACE5′ and Universal Primer A Mix (UPM), followed by a nested PCR using gene-specific primer TfaNes5′ and Nested Universal Primer A (NUP). For 3′ strand, cDNA was amplified by gene-specific primer TfaRACE3′ and Universal Primer A Mix (UPM). The PCR conditions were: 94 °C for 5 min, 30 cycles of 94 °C for 30 s, 67 °C for 30 s, 72 °C for 3 min, followed by a 10 min final extension. The generated PCR products were purified using Wizard® SV Gel and PCR Clean-Up System Kit (Promega Co., USA), and ligated with pGEM-T Easy Vector (Promega) and subsequently sequenced (GENEWIZ, Inc.). All primers used are listed in Table 1.

Table 2 Water and tissues samples exposed to different concentration of waterborne iron analyzed (mean ± SD) by atomic absorption spectrophotometry. Treatments

Control Fe2x DFX

Marine water (mg/ml)a

ND 1.63 ± 0.04 ND

ND: Not detected. Exjade Deferasirox® for iron deficiency therapy, DFX. a Sampling: 0 h post-treatment. b Sampling: 96 h post-treatment.

Tissues (mg/kg) Liverb

Intestineb

Gillb

Skinb

72.74 ± 1.24 135.83 ± 3.54 110.93 ± 1.89

149.81 ± 6.54 19.38 ± 0.56 50.41 ± 1.21

98.69 ± 1.99 240.92 ± 6.25 63.47 ± 3.77

20.46 ± 1.11 9.82 ± 0.89 8.17 ± 0.78


81

Fig. 1. Amino acid sequence alignment of known fish, human, and mouse transferrin. Identical (*), strong (:) and weak (.) similar residues are shown in the last line. The region of N-lobe and C-lobe, which was predicted by SMART program (http://smart.embl-heidelberg.de/), are indicted by arrows. Anion- and iron-binding residues are marked by blue and yellow boxes, respectively. Characteristic features of the transferrin family are underlined as follows: transferrin signatures 1, transferrin signatures 2, and transferrin signatures 3.

82


Fig. 1. (continued)

2.7. DNA sequence and structure analysis DNA sequences were analyzed for identity with other known sequences using the BLAST program. Putative amino acid sequence

alignment was performed using the Clustal Omega program. The phylogenetic tree was constructed by MEGA 5.0 software using neighbour-joining method. Identification of conserved regions was performed by the PROSITE program (http://prosite.expasy.org/) and


the secondary structure-3D model by the Phyre2.0 program (http:// www.sbg.bio.ic.ac.uk/phyre2). Iron Responsive Elements were analyzed by Rfam 11.0 program (http://rfam.sanger.ac.u/). 2.8. Tissue expression profile analysis of transferrin Various tissues (0.5 g), including gill, eye, muscle, skin, intestine, brain, liver, head-kidney and spleen were collected from six healthy juvenile yellow snapper and total RNA was extracted to detect the transferrin expression level. The concentration of each RNA sample was measured using a Nanodrop 2000 spectrophotometer (Thermo, USA). Only RNA samples with a 260/280 ratio (an indication of protein contamination) of 1.9–2.1 and a 260/230 ratio (an indication of reagent contamination) N2.0 were used for analysis. The integrity of the RNA samples was also assessed by agarose gel electrophoresis. First strand cDNA was synthesized from 1 μg of each total RNA and used as template for real-time PCR analysis. Real-time PCR was performed with a CFX96 Touch™ Real-Time PCR Detection System Bio-Rad, using Ssofast™ EVAGreen® Super Mix. The reaction mixtures were incubated for 30 s at 98 °C, followed by 40 cycles of 10 s at 98 °C, 10 s at 60 °C, and finally 65–95 °C (In 0.5 °C Inc) for melt curve. Specificity of the qPCR product was analyzed by a dissociation curve performed after amplification, observing a single peak at the expected melting temperature (Tm). To maintain consistency, the baseline was set automatically by the software. RNA templates were included as negative controls for each sample to rule out the possibility of genomic DNA contamination. A relative mRNA expression level of the target gene was normalized to the most stable house-keeping gene (Livak and Schmittgen, 2001). 2.9. Statistical analysis Genes chosen as candidate housekeeping genes in our study were both orthologs and members of clusters with stable expression trends. In addition, three commonly used housekeeping genes, 18S, EF-1a and β-ACT, and GAPDH were selected as candidates. Gene expression stability was analyzed using GeNorm v3.4 software (Vandesompele et al., 2002). Data were expressed as fold increase (mean ± standard error, SE), obtained by dividing each sample value by the mean control value at the same sampling time. Values N1 expressed an increase while values b 1 expressed a decrease in the indicated gene (Pfaffl, 2001). Data were statistically analyzed by one-way analysis of variance (ANOVA) and Tukey comparison of means when necessary. The assumptions of homogeneity of variances and normality were checked using the available tools in SPSS software (Levene and Kolmogorov Smirnov/Shapiro Wilk tests, respectively). All treatment groups showed a normal distribution and homogeneity of variances. Statistical analyses were made with the obtained data for each sample. Differences were considered statistically significant when P b 0.05. 3. Results

consisted of 690 residues with a calculated molecular mass of 74.24 kDa and the isoelectric point (pI) of 5.58. Comparison of amino acid sequences indicated the presence of the characteristic features of the transferrin family, namely transferrin signatures 1, 2, and 3 (Fig. 1). Tfa was highly similar to fish transferrin. It shared high degree identity to the transferrin of Larimichthys crocea (80%), Pagrus major (80%), Dicentrarchus labrax (80%), human (47%), and mouse (48%) (Table 3). The Tfa protein deduced from the cDNA sequence was composed of a signal peptide (1–18 aa) and two lobes, the N-lobe (24–337 aa) and C-lobe (340–680 aa); the Fe-binding (Asp-73, Tir-103, Tir200, His-256) for N-lobe and (Asp-394, Tir-429, Tir-524, His-592) for C-lobe and anion-binding (Thr-128, Lys-132) (Thr-454 and Arg-458) residues for N-lobe and C-lobe respectively, as determined by the PROSITE program. The secondary-structure prediction revealed the presence of twenty-four helices in the regions corresponding to Tfa subunit positions 11–17, 31–43, 55–63, 117–120, 136–145, 157–170, 179–184, 200–208, 219–221, 265–277, 312–326, 347–361, 376–384, 395–397, 443–446, 478–482, 494–499, 527–532, 543–550, 563–565, 601–615, 652–656, 658–669, and 675–688; while 94% of Tfa residues were modeled at 100% confidence as determined by Phyre2 program (Fig. 2). A phylogenetic tree was further constructed based on the transferrin amino acid sequences from various fish and mammals. Tfa was genetically closer to transferrins from Pagrus major and Sparus aurata than to other fish and mammal transferrins (Fig. 3). 3.3. Yellow snapper transferrin is constitutively expressed and widely distributed The expression stability (M) of each candidate housekeeping gene among the different RNA samples was calculated using GeNorm software. GeNorm uses a statistical algorithm to derive a measure of gene stability (M) for all the genes under investigation. A low M value represents a highly stable expression. For each endogenous control, we obtained the following M values of the candidate housekeeping genes for the elongation factor-1alpha (EF1-α) (1.23), 18S (2.607), and β-ACT (3.682), respectively, of which the elongation factor-1alpha (EF1-α) was the most stable in yellow snapper tissue (data not shown). In order to determine the tissue-specific transcriptional profile of transferrin, quantitative real-time RT-PCR (qRT-PCR) was carried out using different yellow snapper tissues in normal individuals (Fig. 5). The mRNA transcripts of tfa were detected in all the tissues examined with the highest expression in spleen and a lower expression in gill, eye, muscle, and skin.

Table 3 Identity matrix of yellow snapper Lutjanus argentiventris transferrin amino acid sequence as well as its domains with other species.

3.1. Accumulation of waterborne iron Table 2 shows Fe concentration in water and liver, intestine, gill, and skin tissues analyzed by atomic absorption spectrophotometry. These data do not represent metal toxicity; no mortality was observed during the experiment. As shown in Fig. 4, kinetic of Fe concentration was determined during 24 h, where we can observe a reduction of Fe similar to control at 24 h. 3.2. Sequence characterization and phylogenetic analysis of transferrin The cDNA of Lutjanus argentiventris transferrin (tfa) was deposited in GenBank (Accession number: KT254659). The determined full-length cDNA of tfa was 2482 bp in length, containing a 2073 bp open reading frame (ORF). The deduced amino-acid sequence of the Tfa protein

83

Lutjanus argentiventris

Larimichthys crocea Pagrus major Dicentrarchus labrax Lates calcarifer Miichthys miiuy Epinephelus coioides Sparus aurata Trachidermus fasciatus Oreochromis niloticus Monopterus albus Oncorhynchus nerka Trematomus bernacchii Homo sapiens Mus musculus

Query cover (%)

Identity (%)

Accession

100 100 100 97 100 100 100 100 97 97 99 96 98 96

80 80 80 80 79 79 77 75 73 73 69 73 47 48

CAM96032.1 AAP94279.1 ACN80997.1 AEZ51816.1 AFC68981.1 AEW43726.1 AEA41139.1 AEV21971.1 ABB70391.1 AHA05992.1 BAA84096.1 CAL92188.1 AAH59367.1 AAL34533.1

84


observed in the tissues (with the exception of intestine) of fish exposed to Fe2x plus A. hydrophila infection compared with Fe2x group. At 96 h post-exposure, the Fe2x group expressed higher mRNA tfa levels than the Fe2x plus A. hydrophila infection group in all sampled tissues. Overall, liver, gill, and skin have a similar gene expression behavior in which higher tfa transcript levels were observed in fish exposed with Fe2x compared with those fish exposed with Fe2x plus A. hydrophila infection. Although the transferrin gene expression increased in the fish group with Fe2x treatment, a significant decrease was observed in the fish exposed to Fe2x plus infection.

C terminal

N terminal

Fig. 2. Predicted 3D structural model of transferrin. Where 94% of Tfa residues were modeled at 100% confidence as determined by Phyre2 program.

3.4. Expression profile of transferrin after iron Fe2x treatment and bacterial challenge A clear treatment dependent expression patterns were observed (Figs. 6 and 7). tfa expression was highly up-regulated in all examined tissues at 24 h after exposure to Fe2x. Lower tfa gene expression was

4. Discussion Transferrin is responsible for the transport and delivery of iron to cells and has been identified in a wide range of organisms (Toe et al., 2012; Ding et al., 2015). In our work, the yellow snapper transferrin gene was identified, cloned, sequenced, and characterized, finding that the yellow snapper transferrin gene was 2482 bp in length and encoded 690 aa, which shared similar aa lengths with transferrins in other vertebrates (615–695 aa). Also, the full sequence of yellow snapper transferrin shares a high identity with transferrins in other vertebrates. Similar to human transferrin, L. argentiventris transferrin contained two lobes (N-lobe: residues 24–337 and C-lobe: 340–680 aa). Each lobe of Tfa contained four iron-binding and two anion-binding residues, coordinating the metabolism of one ferric iron (Lambert et al., 2005). The sequence alignment revealed that only one iron-binding residue in the N-lobe was conserved while all the six sites in the C-lobe were conserved, indicating the pivotal role of the C-lobe in maintaining the stable iron-binding ability of Tfa (Lambert et al., 2005; Gao et al., 2013; Fig. 1).

Sparidae Fish

Mammals

Fig. 3. Phylogenetic analysis of the yellow snapper transferrin. The phylogenetic tree was constructed based on ClustalW-generated multiple sequence alignment of amino acid sequences using the neighbour-joining method within the MEGA 6 package. The topological stability of the neighbour-joining trees was evaluated by 10,000 bootstrapping replications, and the bootstrapping percentage values are indicated by numbers at the nodes.


85

0.9

Liver 20

0.7

Relative Tf expression

FeCl3 •6H2O (mg/l)

0.8

0.6 0.5 0.4 0.3 0.2 0.1

b

a a

a

0 Fe

0 Control

0

6

12

n

24

18

Fe

Time

Time (h) Fig. 4. Mean concentrations (+SD) of FeCl3·6H2O (6.8 μg/ml) following a time of 24 h analyzed by atomic absorption spectrophotometry. Marine water was used as control.

Intestine

The sequence alignments showed the presence of the signature features of the transferrin family, namely, transferrin signatures 1, 2, and 3 as reported by Neves et al. (2009), which suggested that yellow snapper transferrin had the necessary structural properties to serve as an iron transport protein. A protein-protein BLAST (BLASTP) at NCBI yielded the highest identity match (80%) with the transferrin protein sequence of the croceine croaker (Larimichthys crocea), red seabream (Pagrus major), and seabass (Dicentrarchus labrax). The phylogenetic tree constructed based on the amino acid sequences of 18 species demonstrated that yellow snapper transferrin was close to that of perciformes fish (red seabream, croceine croaker, and gilthead seabream), as the result of their identity. The phylogenetic analyses also confirmed that transferrin is a medium-highly conserved protein in vertebrate taxa, probably as a result of its important role in iron metabolism and the innate immune response, two processes that impose evolutionary constraints on the amino acid sequence. Since the cDNA sequence of transferrin has been identified in few species of teleosts, there is little research on the tissue expression profile of fish transferrin. In teleost fish, highly abundant expression of transferrin in the liver and reduced expression in the brain have been observed (Kvingedal et al., 1993; Wojtczak et al., 2007; Liu et al., 2010; Ding et al., 2015). By contrast, in our study, yellow snapper transferrin was mainly detected in spleen and head-kidney and in a lesser extent in liver. A complete detailed study of the tissue-specific expression of transferrin genes in closely related species and an investigation of their 50-upstream regulatory sequences may explain this unusual differential gene expression in teleost fish (Denovan-Wright et al., 1996).

Relative Tf expression

1.4 b 1.2 1

a

0.8 0.6 0.4

b

0.2

a

0 Fe

n

Fe

Time Fig. 6. Transferrin gene expression (tfa) in liver and intestine determined by real-time PCR in juvenile of yellow snapper exposed to different treatments (Fe2x and Fe2x followed by experimental infection with Aeromonas hydrophila) at 24 and 96 h. Data are shown as the mean gene expression relative to the expression of endogenous control EF-1α gene ± SD. Columns showing different letters are significantly different between control and treated groups (P b 0.05).

To better understand the role of yellow snapper transferrin, we produced an experimental study of iron modulation and bacterial infection. In this study low doses of intraperitoneal injection of A. hydrophila did not cause significant mortality; however a clear effect in the transferrin gene expression were observed after infection. In general, the results obtained in the different tissues showed that bacterial stimuli (infected group) significantly decreased transferrin transcription at 24 and 96 h compared to uninfected groups. In this regard, the functional role of transferrin in yellow snapper might act as a negative acute phase protein, and it deserves to be confirmed. Since transferrin gene expression is down-regulated during the inflammation caused by an

Relative expression of Tf gene

2.5 d 2

1.5 c 1 b

b

b

Brain

Liver

0.5 a

a

a

a

Gill

Eye

Muscle

Skin

0 Intestine

HK

Spleen

Fig. 5. The expression pattern of transferrin (tfa) in different yellow snapper tissues was detected by the quantitative RT-PCR. The EF1-α gene was used as the internal control. The relative expression is the ratio of gene expression in different tissues relative to that in the head-kidney (HK) and gill, respectively. All values represent the mean ± SD (n = 6).

86


Gill Relative Tf expression

5 b

4

b

3 2 1

a a

0 Fe

n

Fe

Time

Skin Relative Tf expression

6

b

4.5

3 a 1.5 a

a

0 Fe

n

release of iron from iron storage and a mobilization towards the erythropoietic organs, such as the head kidney, which in turn would need an increase in circulating transferrin (Neves et al., 2009). In comparison, transferrin gene expression decreased during iron plus A. hydrophila exposure. In contrast, Liu et al. (2010) observed that transferrin gene expression was not significantly different in an overload of iron by iron-dextran intra-peritoneal injection in channel catfish (Ictalurus punctatus) compared with control in a period of 7 days (samplings at 4 h, 24 h, 3 days, and 7 days post-treatment). Moreover, the authors found that transferrin expression was slightly affected in liver by the simultaneous treatment with iron-dextran and Edwardsiella ictaluri infection. In line with these contrasting findings, studies in depth are needed to better understand the interaction between bacterial stimulation and iron level-dependent signaling in the expression and function of teleost iron homeostasis genes. Finally, it is important to note that transferrin gene expression increased in gill and skin after iron treatment, which may be partially explained by the fact that iron was added in the water, suggesting that theses tissues were the predominant route of Fe uptake rather than the intestine (Cooper et al., 2006). Overall, in normal individuals transferrin is saturated only one third whereas in individuals with iron, it is usually completely saturated and the latter could be related with an increase in tfa gene expression.

Fe

Time Fig. 7. Transferrin gene expression in gill and skin determined by real-time PCR in yellow snapper juvenile exposed to different treatments (Fe2x and Fe2x followed by experimental infection with Aeromonas hydrophila) at 24 and 96 h. Data are shown as the mean gene expression relative to the expression of endogenous control EF-1α gene ± SD. Columns showing different letters are significantly different between control and treated groups (P b 0.05).

infection, it means that transferrin might function as a negative acute phase protein under that condition (Ritchie et al., 1999; Neves et al., 2009). Additionally, the expression of tfa was influenced by the tissue and sampling time, in which an increase and decrease in gene expression may be observed during the course of A. hydrophila, Streptococcus agalactiae and Vibrio harveyi infections in fish (Ding et al., 2015; Mu et al., 2013; Das et al., 2011; Poochai et al., 2014; Gao et al., 2013). Moreover, the genetic background may also influence the transferrin gene expression level and disease susceptibility/resistance of fish infected with A. hydrophila (Sahoo et al., 2011). Interesting enough, transferrin (protein) concentration in serum also changes accordingly with the time of the disease progress in Atlantic salmon (Salmon salar) infected with alphavirus (SAV subtype 3) (Braceland et al., 2013). Altogether, these data suggest that the transferrin gene expression was highly modulated by the iron and the infection process, as well as by the genetic background in L. argentiventris and other fish. The functional recombinant transferrin may also exert direct bacteriostatic activity on bacterial pathogens such as E. coli and S. aureus via its binding to iron, supporting its important role during infection (Liu et al., 2009). Interesting enough, transferrin-derived peptides by the host or pathogen digestion may induce antimicrobial activity in macrophages of fish, bovine, mice, and human species (Haddad and Belosevic, 2009). Since no extra iron was introduced in the system, it could be said that circulating transferrin levels in yellow snapper were already high enough to quickly remove circulating iron in the first hours of infection. In addition, it must be taken into account that many bacteria, including A. hydrophila, have several strategies for iron uptake from the host, such as producing siderophores that enable them to get iron from transferrin (Hirst et al., 1991). Therefore, a decrease of newly synthesized transferrin during the course of infection would reduce that possibility. We could observe that iron (Fe2x) treatment had a significant increase on the transferrin gene expression in liver, intestine, gill, and skin. It suggests an increased

5. Conclusion We have obtained the sequence for the yellow snapper transferrin gene that is constitutively and widely distributed in its tissues, most abundantly in the spleen. The transferrin reported in our study suggests conservation of the gene and protein structure compared to those previously reported for other fish species. The molecular analyses suggested that transferrin in yellow snapper could act as an acutephase protein after stimulation with a pathogenic bacterium. This study demonstrates that transferrin gene expression, besides its role in iron metabolism, may have an important function during bacterial infection in fish indicating its involvement in defense against bacterial invasion. Therefore, in order to investigate the function of yellow snapper transferrin, it is necessary to carry out further analyses of its dynamic roles in yellow snapper physiology and immunity. Acknowledgments The authors would like to thank CIBNOR staff Enrique Calvillo, Jorge Calvillo, Ms. Pablo Monsalvo, and Gabriel Robles Villegas for technical support with fish, and Diana Dorantes for English edition. We also thanks Baudilio Acosta and Griselda Peña for helpful with the Atomic Absorption Spectrometer analysis. The project was funded under SEP-CONACYT grant CB-2010/155381 and CONACYT-INFR-2014-01/225924. References Austin, B., Austin, D.A., 1999. Bacterial Fish Pathogens: Disease in Farmed and Wild Fish. Springer-Verlag, New York. Bayne, C.J., Gerwick, L., 2001. The acute phase response and innate immunity of fish. Dev. Comp. Immunol. 25, 725–743. Braceland, M., Bickerdike, R., Tinsley, J., Cockerill, D., Mcloughlin, M.F., Graham, D.A., Burchmore, R.J., Weir, W., Wallace, C., Eckersall, P.D., 2013. The serum proteome of Atlantic salmon, Salmo salar, during pancreas disease (PD) following infection with salmonid alphavirus subtype 3 (SAV3). J. Proteome 6, 423–436. Carpenter, M.A., Broad, T.E., 1993. The cDNA sequence of horse transferrin. Biochim. Biophys. Acta 1173, 230–232. Ciuraszkiewicz, J., Biczycki, M., Maluta, A., Martin, S., Watorek, W., Olczak, M., 2007. Reptilian transferrins: evolution of disulphide bridges and conservation of iron-binding center. Gene 396, 28–38. Cooper, C.A., Handy, R.D., Bury, N.R., 2006. The effects of dietary iron concentration on gastrointestinal and branchial assimilation of both iron and cadmium in zebrafish (Danio rerio). Aquat. Toxicol. 79, 167–175. Das, A., Sahoo, P.K., Mohanty, B.R., Jena, J.K., 2011. Pathophysiology of experimental Aeromonas hydrophila infection in Puntius sarana: early changes in blood and aspects

M. Reyes-Becerril et al. / Agri Gene 1 (2016) 79–87 of the innate immune-related gene expression in survivors. Vet. Immunol. Immunopathol. 15, 207–218. Denovan-Wright, E.M., Bruce Ramsey, N., McCormick, C.J., Lazier, C.B., Wright, J.M., 1996. Nucleotide sequence of transferrin cDNAs and tissue-specific expression of the transferrin gene in Atlantic cod (Gadus morhua). Comp. Biochem. Physiol. 113, 269–273. Ding, Z., Zhao, X., Su, L., Zhou, F., Chen, N., Wu, J., Fu, X., Wu, F., Wang, W., Liu, H., 2015. The Megalobrama amblycephala transferrin and transferrin receptor genes: molecular cloning, characterization and expression during early development and after Aeromonas hydrophila infection. Dev. Comp. Immunol. 49, 290–297. Emerit, J., Beaumont, C., Trivin, F., 2001. Iron metabolism, free radicals, and oxidative injury. Biomed. Pharmacother. 55, 333–339. Gao, J., Ding, S.X., Huang, X.H., Shi, X.F., 2013. Cloning and expression characterization of the serum transferrin gene in the Chinese black sleeper (Bostrichthys sinensis). Gene 515, 89–98. Haddad, G., Belosevic, M., 2009. Transferrin-derived synthetic peptide induces highly conserved pro-inflammatory responses of macrophages. Mol. Immunol. 46, 576–586. Hao, K., Hanawa, H., Ding, L., Ota, Y., Yoshida, K., Toba, K., Ogura, M., Ito, H., Kodama, M., Aizawa, Y., 2011. Free heme is a danger signal inducing expression of proinflammatory proteins in cultured cells derived from normal rat hearts. Mol. Immunol. 48, 1191–1202. Hirst, I.D., Hastings, T.S., Ellis, A.E., 1991. Siderophore production by Aeromonas salmonicida. J. Gen. Microbiol. 137, 1185–1192. Jamroz, R.C., Gasdaska, J.R., Bradfield, J.Y., Law, J.H., 1993. Transferrin in a cockroach: molecular cloning, characterization and suppression by juvenile hormone. Proc. Natl. Acad. Sci. U. S. A. 90, 1320–1324. Kvingedal, A.M., Rorvik, K.A., Alestrom, P., 1993. Cloning and characterization of Atlantic salmon (Salmo salar) serum transferrin cDNA. Mol. Mar. Biol. Biotechnol. 2, 233–238. Lambert, L.A., Perri, H., Meehan, T.J., 2005. Evolution of duplications in the transferrin family of proteins. Comp. Biochem. Physiol. 140, 11–25. Liu, J., Zhang, S., Li, L., 2009. A transferrin-like homolog in amphioxus Branchiostoma belcheri: identification, expression and functional characterization. Mol. Immunol. 46, 3117–3124. Liu, H., Takano, T., Abernathy, J., Wang, S., Sha, Z., Jiang, Y., 2010. Structure and expression of transferrin gene of channel catfish, Ictalurus puntatus. Fish Shellfish Immunol. 28, 159–166. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2(−Delta Delta C(T)). Methods 25, 402–408. Mu, X., Pridgeon, J.W., Klesius, P.H., 2013. Comparative transcriptional analysis reveals distinct expression patterns of channel catfish genes after the first infection and reinfection with Aeromonas hydrophila. Fish Shellfish Immunol. 35, 1566–1576. Neves, J.V., Wilson, J.M., Rodrigues, P.N., 2009. Transferrin and ferritin response to bacterial infection: the role of the liver and brain in fish. Dev. Comp. Immunol. 33, 848–857. Ong, S., Ho, J., Ho, B., Ding, J., 2006. Iron-withholding strategy in innate immunity. Immunobiology 211, 295–314. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime RTPCR. Nucleic Acids Res. 29–45.

87

Poochai, W., Choowongkomon, K., Srisapoome, P., Unajak, S., Areechon, N., 2014. Characterization and expression analysis of the transferrin gene in Nile tilapia (Oreochromis niloticus) and its upregulation in response to Streptococcus agalactiae infection. Fish Physiol. Biochem. 40, 1473–1485. Reyes-Becerril, M., Angulo, C., Macias, M.E., Angulo, M., Ascencio, F., 2014. Iron bioavailability in larvae yellow snapper (Lutjanus argentiventris): cloning and expression analysis of ferritin-H. Fish Shellfish Immunol. 37, 248–255. Ritchie, R.F., Palomaki, G.E., Neveux, L.M., Navolotskaia, O., Ledue, T.B., Craig, W.Y., 1999. Reference distributions for the negative acute-phase serum proteins, albumin, transferrin and transthyretin: a practical, simple and clinically relevant approach in a large cohort. J. Clin. Lab. Anal. 13, 273–279. Sahoo, P.K., Das Mahapatra, K., Saha, J.N., Barat, A., Sahoo, M., Mohanty, B.R., 2008. Family association between immune parameters and resistance to Aeromonas hydrophila infection in the Indian major carp, Labeo rohita. Fish Shellfish Immunol. 25, 163-139. Sahoo, P.K., Mohanty, B.R., Kumari, J., Barat, A., Sarangi, N., 2009. Cloning, nucleotide sequence and phylogenetic analyses, and tissue-specific expression of the transferrin gene in Cirrhinus mrigala infected with Aeromonas hydrophila. Comp. Immunol. Microbiol. Infect. Dis. 32, 527–537. Sahoo, P.K., Rauta, P.R., Mohanty, B.R., Mahapatra, K.D., Saha, J.N., Rye, M., Eknath, A.E., 2011. Selection for improved resistance to Aeromonas hydrophila in Indian major carp Labeo rohita: survival and innate immune responses in first generation of resistant and susceptible lines. Fish Shellfish Immunol. 31, 432–438. Toe, A., Areechon, N., Srisapoome, P., 2012. Molecular characterization and immunological response analysis of a novel transferrin-like, pacifastin heavy chain protein in giant freshwater prawn, Macrobrachium rosenbergii (De Man, 1879). Fish Shellfish Immunol. 33, 801–812. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., et al., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3. Vazquez-Juarez, R.C., Barrera-Saldana, H.A., Hernandez-Saavedra, N.Y., Gomez-Chiarri, M., Ascencio, F., 2003. Molecular cloning, sequencing and characterization of omp48, the gene encoding for an antigenic outer membrane protein from Aeromonas veronii. J. Appl. Microbiol. 94, 908–918. Wang, Z.S., Qi, Z.T., Zhang, Q.H., Qiu, M., Huang, J.T., Zhao, W.H., Guo, X.J., 2012. The cDNA sequence of the transferrin gene in tongue sole (Cynoglossus semilaevis) and its transcriptional changes under acute hypoxic stress. Ital. J. Anim. Sci. 11, 74. Wojtczak, M., Dietrich, G.J., Imazaraw, I., Jurecka, P., Slowinska, M., Ciereszko, A., 2007. Polymorphism of transferrin of carp seminal plasma: relationship to blood transferrin and sperm motility characteristics. Comp. Biochem. Physiol. 148, 426–431. Wu, C., Zhang, W., Mai, K., Xu, W., Wang, X., Ma, H., Liufu, Z., 2010. Transcriptional upregulation of a novel ferritin homolog in abalone Haliotis discus hannai Ino by dietary iron. Comp. Biochem. Physiol. C 152, 424–432. Yoshiga, T., Hernandez, V.P., Fallon, A.M., Law, J.H., 1997. Mosquito transferrin, an acutephase protein that is upregulated upon infection. Proc. Natl. Acad. Sci. U. S. A. 94, 12337–12342.