USA. 9. Water bath. Memmert. Germany. 10. Hood (Fume cabinet). Lab tech. USA. 11 ... recommended by the manufacturing company and autoclaved at. 121 o.
Chapter three
Materials & Methods
3.0. Materials and methods 3.1. Equipments The following equipments and apparatus were used throughout the present study: No.
Item
Company
Source country
1
Incubator
Carbolite
England
2
Oven
Gallenkamp
England
3
Refrigerator
Admiral
Japan
4
Autoclave
Daikyo
Japan
5
2600U/VIS
Unico
USA
Spectrophotometer 6
UV light (Transluminater)
Viber lourmat
EEC
7
Minispin
Eppendrof
Germany
8
Vortex
Vortex – genie
USA
9
Water bath
Memmert
Germany
10
Hood (Fume cabinet)
Lab tech
USA
11
Thermal cycler
Esco
USA
12
Electrophoresis
Major science
Taiwan
13
Electrical balance
Sartorius
Germany
33
Chapter three
Materials & Methods
3.2. Culture media The following culture media were employed in the present work: No.
Medium
Company
Source country
1
Nutrient agar
Himedia
India
2
Chocolate and blood agar
Himedia
India
3
MacConkey agar
Himedia
India
4
Brain heart infusion broth
Himedia
India
5
Mueller hinton agar
Himedia
India
6
Mueller hinton broth
Himedia
India
7
Coagulase mannitol broth
Himedia
India
base
3.3. Chemicals No.
Material
company
Source country
1
Ethanol
Applichem
Germany
2
EDTA powder
BDH
England
3
Isopropanol (C3H8O)
Applichem
Germany
4
Glycerol
Fisher
UK
5
Crystal violet powder
Fluka
Switzerland
6
Gram stain
Vaccines and
Baghdad
sera institute
34
Chapter three
Materials & Methods
3.4. Enzymes No.
Material
Company
Source
1
Lysosome
Merck
Germany
2
enzyme Lysostaphin
Sigma
USA
3.5. Other material No.
Material
Company
1
Human blood
Hospital clinical laboratory (Ramadi Teaching Hospital)
2
Aluminum foil
Santina, (Lebanon)
3
Parafilm
Lab. Film, (USA)
4
Pipettes
Eppendorff, (Germany)
5
Sterile cotton swab
China
6
Benzene burner
China
3.6. Control group One hundred twenty five of apparently individuals from Anbar population were randomly included in the study.
3.7. Patients and methods 3.7.1. Patient study and sample collection A total of 125 specimens obtained from patients admitted to dermatology Private clinics were studied during the period from October 2010 to March 2011. 35
Chapter three
Materials & Methods
The patients were of different sex, out of 125 specimens, 45 specimens were female while the male gender were 80 specimens, the ages were distributed between a year to 70 years, the mean of age were 19 with standard deviation + 17 years. Full informative history had been taken directly from the patient or his parents or relatives, and the information were arranged in formula sheet (appendix No. 1).
3.7.2. Bacteriological part 3.7.2.1. Detection of Staphylococcus aureus Swabs were inoculated immediately and routinely using culture media, Nutrient agar, Blood agar, MacConky agar and Chocolate agar plates and they were inoculated for two days at 37 oC, the suspected Staphylococcus colonies were identified as bacteriological according to the following confirmatory methods by (Baron et al., 1994). They include staining with gram stain, morphology of colony, MIC, agar screening which includes (mannitol salt agar, meuller hinton agar with 6mg/100ml oxacillin, coagulase test (Frebourg et al., 1998; Sakoulas et al., 2001).
3.7.2.2. Preparation of culture media A- Nutrient agar, macConky agar, nutrient broth, brain heart infusion broth, meuller hinton agar, and mannitol salt agar, were prepared as recommended by the manufacturing company and autoclaved at 121 oC for 15 minutes (Collee et al., 1996). B- Blood agar and chocolate agar: the medium was prepared by adding sterile blood to sterile nutrient agar that has been melted and cooled to 50 oC, 75 oC respectively, The concentration of blood was 10% (Collee et al., 1996).
36
Chapter three
Materials & Methods
3.7.2.3. Maintenance of bacterial strains A- In short term preservation, strains of bacteria were maintained in slant culture. Such cultures were prepared in screw-capped bottles containing 10 ml of nutrient agar medium and stored at 4 oC and sub cultured monthly (Sambrook et al., 1989). B- In intermediate term preservation, bacteria were stored in a medium containing 20% glycerol. This was done by adding 20 ml of sterilized glycerol to 80 ml brain heart infusion broth and distributed to 5 ml into each screw-capped bottle with full loop from exponential growth of bacteria and left for 30 minutes at room temperature then stored at -20 o
C (Sambrook et al., 1989).
3.8. Confirmatory Methicillin Resistance Staphylococcus aureus technique 3.8.1. Preliminary screening agar plates for methicillin resistance Staph. Aureus Mueller-Hinton agar plates with 4% NaCl and 6 mg of oxacillin per ml (MHOX; Prepared Media Laboratories, Tualatin, Oreg.) were inoculated as a streak in three directions by using a cotton swab dipped into a direct colony suspension equivalent to a 0.5 McFarland standard in tryptic soy broth (Sambrook et al., 1989; Gerberding et al., 1991). As a control, the same medium containing 4% NaCl without oxacillin was inoculated first. Plates were incubated in ambient air at 37 oC and were read at 24 and 48 hrs. Any growth was considered a positive test result (Villanova, 1993; Brown et al., 2005).
37
Chapter three
Materials & Methods
3.8.2. Antimicrobial susceptibility test 3.8.3.
Broth
dilution
method
(Minimal
Inhibitory
Concentration method) A- Antimicrobial agents used Pure powder of oxacillin was purchased from Himedia company, India.
B- Bacterial standardization Thirty six study isolates were included. The bacterial standardizetion was performed according to McFarland turbidity standard which was prepared as the following procedure: Aliquot of 0.5 ml of 0.048 M BaCl2 (1.175% W/V BaCl2.H2O) was added to 99.5 ml of 0.36 NH2SO4 (1% V/V) in bush and lamb glass tubes. This standard was agitated with a vortex mixer prior to use (Miles and Amyes, 1996). The tube which contained bacterial suspension was compared with the turbidity standard solution and the density of the test suspension was adjusted visually to that of the standard by adding more bacteria or sterile saline. Moreover, for each test suspension, fine adjustment of turbidity was performed until the OD value for the test suspension corresponded to OD value for 0.5 McFarland standard solution which was read previously (Vandepitte et al., 1996; Al-Ouqaili, 2002).
C- Procedure Antimicrobial agent stock solution was filter sterilized and prepared at concentration (1000 mg/ml). Different antibiotic concentrations (0.5-256 mg/ml) were prepared in 5 ml of mueller hinton broth and transferred to sterile capped tubes, at least 4-5 morphological similar 38
Chapter three
Materials & Methods
colonies were inoculated into Mueller hinton broth and incubated at 37 oC until the viable turbidity was equal to the 0.5 McFarland, (about 108 CFU/ml), After that, the suspension was diluted 1:100 and certain volumes transferred to the tubes containing antibiotic dilutions, to reach a final cell concentration of (about 105 CFU/ml), Controls were repressented by two tubes; one of them contained broth only and the other contained broth plus microorganism. Then the tubes were incubated overnight at 37 oC, The result of minimal inhibitory concentration (MIC) was interpretated as the lowest concentration of antimicrobial agents which inhibits visible bacterial growth after overnight incubation (Ferraro et al., 2000).
3.9. Molecular part 3.9.1. DNA extraction 3.9.1.1. DNA extraction kit (Promega TM050) The DNA extraction kit was purchased from Promega company. The components of kit are as following:Components
Amount
Cell lysis solution
500 ml
Nuclei lysis solution
250 ml
Protein precipitation solution
125 ml
DNA rehydration solution
100 ml
3.9.1.2. Protocol of DNA isolation (Promega company) 1.5 ml microcenterfuge tubes Water bath 80 oC. Water bath 37 oC. 39
Chapter three
Materials & Methods
Isopropanol room temperature. Seventy percent ethanol at room temperature. Water bath, 65C (optional, for rapid DNA rehydration). Fifty mM EDTA (pH 8.0) (for gram positive bacteria). Ten mg/ml lysozyme (sigma cat. #L7651) for gram positive bacteria). Ten mg/ml lysostaphin (sigma cat.#L7386) for gram positive bacteria). One ml of an overnight culture was added to a 1.5 ml microcenterfuge tube .
Then centerfuged at 13,000 – 16,000 xg for 2 minute to pellet the cell. And then Removed the supernatant.
Cells were resuspended thoroughly in 480 l of 50 mM EDTA to avoid clotting.
Appropriate lytic enzymes (60 l) with (60l) of lysostaphin were added to the resuspended cell pellet in a total volume of 120 l (see note in the margin) and gently pipeted to mix. The purpose of this pretreatment is to weaken the cell wall so that efficient cell lysis can take place according to thickness of cell wall of some strain Staphylococcus. Samples were incubated at 37 oC for 30-60 minutes. Then they were centerfuged for 2 minutes at 13,000-16,000 xg and the supernatant was removed. Six hundred l of nuclei lysis solution was added, gently pipeted until the cells were resuspended. At 80 oC for 5 minute to lyse the cells was incubated, then cooled to room temperature because RNase solution instability for heat . Three l of RNase solution was added to the cell lysate to cancel of RNA, then inverted the tube 2-5 time to mix. 40
Chapter three
Materials & Methods
The mixture was incubated at 37 oC for 15-60 minutes. Then Cooled the sample to room temperature.
Two hundred l of protein precipitation solution was added to the RNase-treated cell lysate. The mixture was Vortexed vigorously at high speed for 20 seconds to mix the protein precipitation solution with the cell lysate.
The sample was incubated on ice for 5 minutes. The sample was Centrifuged at 13,000-16,000xg for 3 minutes The supernatant containing the DNA was transferred to a clean 1.5 ml microcenterfuge tube containing 600 l of room temperature isopropanol. Note: Some supernatant may remain in the original tube containing the protein pellet. Could leave this residual liquid in the tube to avoid contaminating the DNA solution with the precipitated protein. The tube was Gently mixed by inversion until the thread-like strands of DNA from a visible mass. Then was Centrifuged at 13,000-16000 xg for 2 minutes. The supernatant was poured carefully and drained the tube on clean absorbent paper. 600 l of room temperature 70% ethanol was added and gently inverted the tube several times to wash the DNA pellet. The samples were centrifuged at 13,000-16000 xg for 2 minute. Ethanol was carefully aspirated. The tube was drained on clean absorbent paper and allowed the pellet to air-dry for 10-15 minutes. One hundred l of DNA rehydration solution was added to the tube and rehydrate the DNA by incubating at 65 oC for 1 hour. Periodically mixed the solution by gently tapping the tube. 41
Chapter three
Materials & Methods
Alternatively , rehydrate the DNA by incubating the solution overnight at room temperature or at 4oC. and stored the DNA at 28 oC.
3.10. Polymerase Chain Reaction 3.10.1. Procedure Primer dilution All primers were supplied by Promega company as a lyophilized product of different picomols concentrations and resuspension using deionized water to reach a final concentration for 10 picomols /l of suspension.
3.10.2. DNA quantitation DNA samples prepared from bacteria were quantified by Ultraviolet spectrophotometer (Unico, USA) reading at 260 and 280 nm (Sambrook et al., 1989). All samples were stored at -20 oC until use. 1- The DNA for assessment was removed from cold storage for 30 minutes, flicking the bottom of tubes ensured that the entire DNA was suitably resuspended. 2- Samples were then centerfuged at 8000 xg for 5 minutes. 3- A blank was prepared by taking 1000 lof TE buffer, and used to zero the spectrophotometer = first Quartz cuvette. 4- In the second Quartz cuvette, 10 l of the DNA sample was mixed with 990 l TE buffer (sample cuvette). After zeroing the spectrophotometer (Unico, USA) on the first cuvette was brought into place to obtain an absorbance reading. 5- Reading was taken at wavelengths of 260 nm (OD260) for DNA of sample and 280 nm (OD280) for protein concentration of sample, 42
Chapter three
Materials & Methods
the spectrophotometer was rezeroid between each wavelength reading. 6- The ratio between the readings (OD260/OD280) provided an estimation of sample purity, which should be between (1-2). Values of (OD260/OD280) of less than 1 indicate contamination of the DNA by protein (Sambrook et al., 1989). 7- The concentration of DNA (g/l) was estimated by using the following equation:
3.10.3. DNA Concentration (g/I) = (reading in OD260) X (total/sample volume) X constant (50 g/1000 I). The yield was estimated by (concentration X total volume).
3.10.4. Polymerase Chain Reaction (PCR) All bacterial culture samples examined for DNA extraction which were assayed by PCR amplification process. The specific primers were synthesized from Alpha DNA (Alpha DNA Co., Canada), (appendix) and they were designed on the basis sequence information of the gene repeated unit that amplifies a highly repeated sequence of Staph. aureus DNA according to Kobayashi et al., 1994.
3.10.5. Sequences of MecA gene primer Gene
name
nucleotide sequence (5" to 3")
base pair
MecA Mec-Al (+) AAAATCGATGGTAAAGGTTGGC 533 Mec-A2 (-) AGTTCTGCAGTACCGGATTTGC
43
Chapter three
Materials & Methods
3.10.6. Sequences of femA gene primer gene name
Nucleotide sequence (5'-3')
( base pairs)
FemA Fem-Al (+) AGACAAATAGGAGTAATGAT
509
Fem-A2 (-) AAATCTAACACTGAGTGATA
PCR reaction kit (PCR PreMix) was purchased from Bioneer company. The PCR reaction was carried out in 20 l solution containing (Top DNA polymerase), 1 U, each dNTP (dATP, dGTP, dCTP, dTTP) 250 M, 1.5 mM MgCl2, Tris-HCl (pH 9.0), 10 mM, KCl, 30 mM, Template DNA, 5 – 50 ng, Primer, 5 – 10 pmole (Table 3.3).
Thermal cycler (ESCO, USA) was used with a thermal profile for mecA gene involving 3 min at 94 oC, followed by 42 cycle each of 20 second at 94 oC, 45 second at 57 oC, 1 min at 72 oC and a final elongation step at 72 oC for 5 minutes (Table 3.1). Table 3.1: PCR program which used for amplification of the target DNA for MecA gene. PCR Program of mecA gene Initial Denaturation
3 min.
94 oC
Denaturation
20 sec.
94 oC
Annealing
45 sec.
57 oC
Extension
1 min.
72 oC
Final Extension
5 min.
72 oC
44
42 cycles
Chapter three
Materials & Methods
The thermal cycler (ESCO, USA) was used with a thermal profile for femA gene involving 5 min at 95oC, followed by 35 cycle each of 1 min. at 94 oC, 1 min. at 63 oC, 1 min at 72 oC and a final elongation step at 72 oC for 5 minutes (Tab 3.2). Table 3.2: PCR program which used for amplification of the targets DNA for femA gene. PCR Program of femA gene Initial Denaturation
5min.
95 oC
Denaturation
1min.
94 oC
Annealing
1min.
63 oC
Extension
1 min.
72 oC
Final Extension
5 min.
72 oC
35 cycles
Table 3.3: Original PCR reagents which were used in this procedure according to Bioneer company. Component
Volume
Top DNA polymerase
1U
Each: dNTP (dATP, dCTP, dGTP)
250 M 10 mM
Tris-HCl (pH 9.0) dTTP) KCl
30 mM
MgCl2
1.5 mM
Template DNA
5 – 50 ng
Primer
10 pmole
Final volume
20 l
45
Chapter three
Materials & Methods
3.10.7.Initial Denaturation of MecA gene and FemA gene Prior to the first cycle, the mixture was heated at 94 oC for 3 min, for MecA gene, 95 o C for 5 min, to femA gene, which was sufficient to ensure that the DNA as well as the primers were melted, so both the template DNA and the primers completely separated and became single strand (Kobayashi et al., 1994).
3.10.8. Polymerase Chain Reaction Program steps PCR process consisted of a series of forty two cycles for mecA gene and thirty five to femA gene. Each cycle consisted of three steps: 1- Denaturation DNA sample was heated to 94 oC for 20 sec. for mecA gene and 94 oC for femA gene for 1 min. for each cycle in order to separate the strands; it breaks apart the hydrogen bonds that connect the two DNA strands (Sambrook et al., 1989; Kennedy, and Oswald, 2011). 2- Annealing After separating the DNA strands, the temperature was lowered, so the primers attached themselves to the single DNA strand. The temperature of this stage depends on the primers which are usually 5
o
C below their melting temperature, so the
temperature used in mecA gene program was 57 oC for 45 sec. while to femA gene program was 63 oC for 1 min. Wrong temperature during the annealing step may result in unbinding of the primer to the template DNA, or binding at a random. The primers are jiggling around. They are caused by the Brownian motion, and short bonds which are constantly formed between the single stranded primer and the single stranded template (Sambrook et al., 1989; Kennedy, and Oswald, 2011). 46
Chapter three
Materials & Methods
3- Extension Finally, Samples were heated at 72 oC for 1 min. in mecA gene program and femA gene program, the DNA polymerase starts copying the DNA strands. The Taq polymerase elongates optimally at a temperature of 72 oC, and the time for this step depends both on the DNA polymerase itself and on the length of the DNA fragment to be amplified (Sambrook et al., 1989). A final elongation step was used after the last cycle to ensure that any remaining single stranded DNA was completely copied. The PCR products were identified by their size using agarose gel electrophoresis. The size of the PCR products was determined by comparing them with a Bench top PCR Markers (Promega, 1000 bp , USA) which contain DNA fragment of known size (Sambrook et al., 1989).
3.10.9. Negative control DNA negative control was monitored by assaying ten negative controls containing water instead of extracted DNA in the amplification reaction. The PCR products on agarose gel were recorded.
3.10.10. Optimization of polymerase chain reaction Since PCR is very sensitive, adequate measures were taken to avoid contamination from other DNAs which may present in the lab environment (bacteria, viruses, own DNA, etc), the DNA sample preparation reaction mixture assemblage and the PCR process, in addition to the subsequent product analysis were performed in separated areas. For the preparation of reaction mixture, a laminar flow cabinet with UV lamp was used; fresh gloves used for each PCR step as well as micropipettes with sterile tips. The reagent for PCR was prepared separately in ice and 47
Chapter three
Materials & Methods
used solely for this purpose and optimum concentration was used. Aliquots were stored separately from other DNA samples.
3.10.11. Loading DNA sample 1- The surface of desk was wiped with piece of cotton and ethanol 70%, and in the sterile eppenderof tube, a clean piece tape DNA loading was done. 2- Bench top PCR Markers (Promega, 1000 bp , USA) were transferred onto the gel well by micropipette. 3- Twelve l of the amplification DNA samples were loaded to the wells of the gel. 4- The gel with tray was laid into the chamber with 1x TBE, and assured that the gel was completely covered with TBE, until top surface of the gel submerged with approximately 2min, and that the wells were at the negative electrode. 5- The safety cover was placed onto the chamber carefully ensuring that both plugs were secured and connected with power supply. 6- Electrophoresis condition was set up at 100 volts for 1 hour for small tank and 150 volts for large tank with same time. After that the power supply was turned off. 7- The gel for DNA fragments was observed by examining the gel under UV light of translluminator with protective glasses and photographed (Sambrook et al., 1989).
3.10.12. Reagents used for electrophoresis Ethidium bromide. Methyl red. Bromophenol blue in 1% glycerol (loading buffer). Redsafe staining solution:(iNtRON Biotechnology company). 48
Chapter three
Materials & Methods
Agarose. 1 X TBE buffer. Bench top PCR marker.
3.10.13. Agarose gel electrophoresis 3.10.13.1. Preparation of gel agarose with Redsafe (iNtRON Biotechnology company) Aliquot of 100 ml of agarose gel solution was prepared (0.8-3%) in a 250 ml flask and mixed thoroughly, flasks were placed in a microwave, heated until the solution was completely clear and small floating particles were visible (about 2-3 min.). Note: the thickness of gel should be less than 0.5 cm since thick gels may decrease sensitivity. 1- Aliquot of 5 l of Redsafe nucleic acid staining solution (20,000x) was added to the agarose solution. Flask was gently swirled to mix the solution and avoid forming babbles. 2- When the agarose solution became cool, it was poured into the gel tray until the comb teeth were immersed about 1/4-1/2 into the agarose. Note: repeated melting of gels containing Redsafe may result in low sensitivity. 3- The agarose gel was allowed to cool until solidified. samples were loaded on the gel and electrophoresis was performed. 4- Bands were detected under UV illumination. Note: Redsafe allows visualizing DNA (>50ng) in the agarose gel under visible light. This eliminates the need for exposure to UV light, which may nick and damage DNA. The intact DNA fragment purified from agarose gel can increase the efficiency of subsequent molecular 49
Chapter three biology
manipulation
Materials & Methods such
as
cloning,
transformation
and
transcription .
3.10.13.2. Preparation of agarose gel with ethidium bromide (Sambrook et al., 1989) 1- Aliquot of 1X TBE (100ml) was taken in a beaker 2- Agarose powder (0.7g) was added to the buffer 3- The solution was heated to boiling using water bath until all gel particles were completely dissolved 4- Ethidium bromide (2 l of 10mg/ml) was added to the agarose 5- The agarose was stirred in order to be mixed to avoid making bubbles 6- The solution was left to cool down at 50-60 0C
3.10.13.3. Casting of the horizontal agarose gel After sealing both edges of the gel tray with a cellophane tapes and fixing the comb in 1 cm way from one edge, the agarose solution was poured into the gel tray, the agarose was allowed to solidify at room temperature for 30 min. The fixed comb was carefully removed and the gel tray was placed in the gel tank. The tank was filled with 1X TBE buffer until it reached 1-2 mm over the surface of the gel (Sambrook et al., 1989).
3.10.13.4. Agarose gel electrophoresis After genomic DNA extraction, agarose gel electrophoresis was adopted to confirm the presence and integrity of the extracted DNA (Sambrook et al., 1989).
50
Chapter three
Materials & Methods
3.11. Statistical analysis All data were analyzed using Chi-square (Cross tabulation) test or Mann-Whitney. All the study graphics (bar chart, scatter diagram or dot chart) were done by using Microsoft Excel XP (Simon, 2006).
51
