Characterisation of Short tandem repeats for genotyping ...

Lepr Rev (2009) 80, 250– 260

Characterisation of Short tandem repeats for genotyping Mycobacterium leprae THOMAS GILLIS*, VARALAKSHMI VISSA**, MASANORI MATSUOKA***, SAROJ YOUNG****, JAN HENDRIK RICHARDUS*****, RICHARD TRUMAN*, BARRY HALL******, PATRICK BRENNAN** & THE IDEAL CONSORTIUM PARTNERS *National Hansen’s Disease Programs, Baton Rouge, LA, USA **Colorado State University, Ft. Collins, CO, USA ***Leprosy Research Center, National Institute of Infectious Diseases, Tokyo, Japan ****London School of Hygiene and Tropical Medicine, London, UK *****Erasmus MC, University Medical Center Rotterdam, The Netherlands ******Bellingham Research Institute, Bellingham, WA, USA Accepted for publication 01 September 2009 Summary Objective Establish a typing system for Mycobacterium leprae based on polymorphic DNA structures known as short tandem repeats (STR). Design Assess 16 polymorphic STR for sensitivity, specificity and reproducibility in standard assays using reference strains of M. leprae. Results Primers for 16 STR loci were selected based on PCR product size and for their ability to sequence each STR locus from both directions. All primer pairs produced a visible PCR amplicon of appropriate size from PCR reactions containing 10 M. leprae cells. DNA sequences for each STR locus, except (AT)15, was correctly identified as M. leprae-specific in replicate samples containing 1000 M. leprae using either the forward or reverse PCR primers. Twelve of 13 M. leprae STR loci were stable during passage in heavily infected armadillo tissues over a 5 year and 7 month infection cycle. Conclusions Certain M. leprae STR provide suitable targets for strain typing with the potential for grouping M. leprae with shared genotypes that may prove useful for establishing linkages between leprosy cases within geographical regions. Correspondence to: Thomas Gillis, National Hansen’s Disease Programs, Skip Bertman Drive, Baton Rouge, LA 70803, USA (Tel: þ 00 225 578 9836; e-mail: [email protected])

250

0305-7518/09/064053+11 $1.00

q Lepra

Short tandem repeats for Mycobacterium leprae

251

Introduction Global public health efforts to control leprosy have been in place now for over 25 years. The World Health Organization (WHO) has estimated the current global registered prevalence of leprosy to be 212,802 cases compared to over 10 million in 1985, and the number of new cases detected in 2007 was 254,525 (Anonymous 2008). The disparity between prevalence rates and new case detection rates (a proxy for incidence rates) over many years emphasises our lack of knowledge about the transmission and incubation period of leprosy. Approaches to address these issues are impeded by a lack of fundamental knowledge on the epidemiology of leprosy, the sources of infection, its precise mode of transmission, and the importance of contact patterns. Recent advances in genotyping bacteria based on DNA insertion and deletions, single nucleotide polymorphisms (SNP) and other polymorphic DNA structures, such as short tandem repeats (STR), have revolutionised our understanding of disease origins and migration as well as drug resistance and its spread. These tools have enhanced our understanding of disease outbreaks and their associated transmission patterns. The availability of the full genome sequence of Mycobacterium leprae has resulted in the description of over 50 STR loci which are being tested as potential genotyping tools. At least half of these STR have been partially characterised and shown to be polymorphic among M. leprae isolates from human, non-human primate and armadillo sources selected from various parts of the world.1 – 7 A critical aspect of genotyping strains is to establish clear procedures and parameters allowing for comparisons between strains at both the region and global levels. The studies described in this paper and the following communications are the result of a collaborative effort of clinicians and researchers who formed a consortium for assessing STR polymorphisms in DNA extracts of M. leprae.8 The ultimate goal of the working group was to apply the typing tools to isolates of M. leprae to define geographic distributions of M. leprae in various endemic regions with the potential of understanding sources of infection and transmission patterns of leprosy. In this introductory study we describe a set of 16 STR loci selected for assessment as strain markers. Protocols are described and assessed for sensitivity, specificity and reproducibility to detect STR using reference strains of M. leprae.

Materials and Methods REFERENCE STRAIN M. LEPRAE NHDP 55

NHDP55 was isolated in nude mice in 1996 from a US patient residing in Texas who had no history of foreign residency. M. leprae were harvested from mouse foot pad tissues after infection for approximately 7 months. Mice were killed by CO2 asphyxiation and the hind feet were removed and soaked in 70% ethanol and Betadinew to kill surface contaminants. The skin was removed aseptically and the highly bacilliferous tissue excised, minced and homogenised in 10 ml of RPMI-10% FBS medium. Tissue debris was removed by slow speed centrifugation (50 £ g for 10 seconds) and the bacilli-rich supernatant was enumerated by direct counting following staining using the Ziehl-Neelsen method. The bacteria were resuspended for 15 minutes in 0·1 N NaOH, and washed 4 times in Tris EDTA (TE) buffer to remove extraneous mouse tissue and DNA adsorbed to the bacilli. Bacteria for PCR were fractured by freeze/thaw (2 70 8C for 20 min/ 95 8C for 5 min) three times prior to PCR analysis.

252

T. Gillis et al.

ARMADILLO TISSUE EXTRACTION

A single isolate of M. leprae (NHDP60) was passaged serially (H1, H2 and H3) through three armadillos following the first propagation cycle (H0) in an armadillo for a total propagation time of 5 years and 7 months. The passage times were H0, 31 months; H1, 12 months; H2, 11 months and H3, 13 months. M. leprae-infected nodules or lymph node tissue from each passage was processed for DNA extraction using the DNeasy Kit (QIAGEN, Inc., Valencia, CA). Briefly, 25 mg of frozen tissue was placed in 70% ethanol for 48 hours. The tissue was rehydrated by placing in TE buffer for 2 hours at room temperature. The rehydrated tissue was minced with scissors transferred into a 1·5 ml microfuge tube with 200 ul of ATL buffer containing Protease K (2 mg/ml) and held at 56 8C for 18 hours. A second round of Protease K treatment was performed for 2 hours to reduce the viscosity of the samples. Total DNA from the samples was captured in 100 ml of DNeasy elution buffer and stored at 2 20 8C. Five microliters of each DNA extract was used in a 25 ml PCR.

POLYMERASE CHAIN REACTION

The following description represent the components used in a single 25 microliter PCR reaction: 2·50 ml PCR Mastermix (10X, Amplitaq Gold, Applied Biosystems, USA), 2·50 ml MgCl2 (stock concentration 25 mM ), 1·25 ml forward primer (stock concentration 10 mM ), 1·25 ml reverse primer (stock concentration 10 mM ), 12·5 ml sterile deionized water and 5·0 ml template DNA. In all cases a larger stock using these concentrations were made to run multiple samples. The mixture was gently vortexed and then centrifuged briefly to collect all drops from walls of tube. Target amplifications used the following PCR program: Step 1: Activation of Amplitaq Gold at 95 8C for 5 min; Step 2: 40 cycles of amplification; Denaturation at 95 8C for 15 sec; Annealing at 60 8C for 15 sec; Extension at 72 8C for 60 sec; Step 3: Final extension at 72 8C for 7 min; Step 4: Termination and storage of PCR samples at 4 8C. Final annealing temperature for locus 18-8 was 65 8C.

PCR AMPLICON SEQUENCING PROTOCOL

PCR products were purified using QIAquick PCR purification kit (QIAGEN) as per the manufacturer’s instructions. In some instances PCR products were diluted prior to sequencing without the need for purification. For each sequencing reaction the following reagents were added: 8·0 ml of 1X Big Dye 1·1 Terminator Ready Reaction Mix; up to 11 ml of 10 – 50 ng of DNA in deionized water; 1·0 ml of 3·2 pmol/ml primer; appropriate amount of water to 20·0 ml. The reaction was mixed and spun briefly. The tubes were placed in a thermocycler and programmed as follows: 1 cycle of 96 8C for 30 sec; 25 cycles of [96 8C for 10 seconds, 50 8C for 5 sec, and 60 8C for 4 min] and hold cycle at 4 8C.

AGAROSE GEL ELECTROPHORESIS OF PCR PRODUCTS

Agarose gels (4% NuSeive 3:1, Lonza Walkersville, Inc, Walkersville, MD or equivalent grade from other suppliers) were prepared and run in TBE buffer. 6X loading dye was diluted to 2X and 3 ml were combined with 3 ml of the PCR sample and 4 ml applied to each well. Electrophoresis was performed for 2 hours at 8 volts/cm.


253

Results SELECTION CRITERIA FOR STR LOCI PRIMERS

Previous studies have identified well over 50 STR loci in the M. leprae TN genome. We selected 16 loci previously reported to establish parameters for assessing polymorphisms in M. leprae DNA. Our typing system was built upon existing technology for detecting STR. It included PCR amplification of the desired sequence followed by DNA sequencing of the PCR fragment to facilitate counting of the STR. The loci selected and their representative primers for amplification are listed in Table 1. Primers were selected from previously published sequences6 such that amplicon size would be large enough for complete sequencing of the STR from both directions and amenable to using additional primers for nested PCR analysis. Our selection of primers for the 16 STR loci produced amplicons ranging from approximately 120 – 350 bp in length. Names given to each locus were from previously published reports or are the result of naming the repeat by the bases comprising the repeat, followed by the number of repeats found in the TN strain of M. leprae.1 Attempts to match melting temperatures (Tm) were not always successful but sensitivity analysis was used to determine suitability of the primer pairs selected. CHARACTERISTICS OF STR TYPING ASSAY

M. leprae NHDP 55 was selected as the reference strain for tests of assay sensitivity, specificity and reproducibility. The ability to detect 10 M. leprae/PCR (2000 bacteria/ml) with each primer pair was used as a measure of lower limit sensitivity. To assess this limit of detection PCR products from five replicate reactions for each STR loci were analysed for amplicon production on agarose gels. Results using primers for STR (AC)9 are shown in Figure 1. Primer pairs for STR loci (AC)8a, (AC)8b, (AC)9, (AT)15, (AT)17, (TA)10, (TA)18, (GGT)5, (GTA)9, 6-7, 12-5, 18-8, 21-3, 23-3,and 27-5 produced a single dominant band in at least 4 of 5 replicates on gels using 10 M. leprae/PCR reaction. Only STR locus (GAA)21 produced a weak secondary band in replicate samples at this concentration. At higher concentrations of M. leprae STR loci (AC)8a, (AT)15, (AT)17, (TA)10, (TA)18, (GAA)21, 18-8 and 6-7 produced at least one other minor band visible on gels. Accordingly, all primer pairs passed the sensitivity criteria for producing a visible PCR amplicon from 10 M. leprae cells under the conditions described. To assess specificity and reproducibility of the various primer pairs the amplicon produced by each STR primer pair was sequenced. Three of the replicate samples (1000 M. leprae/reaction) from the di- and tri-nucleotide STR PCRs and one each from the larger repeat STR PCRs were sequenced and the repeats enumerated by two independent readers (Table 2). DNA sequence was produced for each STR locus using both the forward and reverse primersto evaluate their utility for sequencing the PCR products. All STR loci were correctly identified as M. leprae-specific in replicate samples by two readers using either the forward or reverse PCR primers. Concordance between readers was identical for all STR loci except (AT)15 when the sequencing was performed with the forward primer as shown in Table 2. Concordance between readers was obtained for STR loci (AC)9, (AT)17, (TA)10, (GGT)5, (GTA)9,

No.

F1 F2 F2 F1 F1 F2 F2 F4 F1 F2 F2 F1 F1 F2 F3 F2

Locus (Zhang, Budiawan et al. 2005)

AC8a AC8b AC9 TA10 AT15 AT17 TA18 GTA9 GAA21 GGT5 6-7 12-5 18-8 21-3 23-3 27-5

GTGTTACGCGGAACCAGGCA GATGCGACTATCACTCGCACGCAGTT GCCTGGTGCCCGGACAATGC TAGATTCAAACGACCATGCA GATCAATATGCGGGTTGGCG GACACACTCGATCTCAGTAG CCGCTAGCAGTCAGCATCGA CGCAGATGCAACGATCAC CTACAGGGGGCACTTAGCTC TCACCATCGACGCTCCGGGT CTACTTGCGCGCCACCGCCA CTGGTCCACTTGCGGTACGAC GCCCGTCTATCCGCATCAA TGTTGAAATTTGGCGGCCAT CAGTCGCCCGGATACTGTTA GTGCTGTGCCTGCAGCCGTT

Sequence (50 to 30 )

Forward Primer

65·5 68·0 69·2 57·2 61·8 56·8 64·5 59·3 62·1 68·4 70·6 65·1 62·5 61·5 61·5 68·8

Tm R1 R3 R2 R1 R1 R1 R2 R4 R2 R1 R2 R1 R1 R3 R2 R2

No. CCATCTGTTGGTACTACTGA GCTGGTTTCCTTCTAGTCCC ACATCACACTGATCTCGCCGGCGCT TGATAATCACGTGTTTCCGC AGCAAGCAGGTCCAGCAGTG TTAGCAGGACGATTGTACAG CCCGACTCGCCGAAGCGAAAC AATATGCATGCCGGTGGT GGACCTAAACCATCCCGTTTT TCGGCCTGGTTGTCTGCCTT GCCGTCGCCAGGTTTTGCAG GGAGAAGGAGGCCGAATACA GCAAAGATCAGCACGCCAAT TGCAAGGAGTGCTCAGCTAT TAAATCCGCTCCCAAATCTT TCCCCAAAGCCGCCGAATCC

Sequence (50 to 30 )

Reverse Primer

Table 1. Short tandem repeat loci and the primer pairs (forward and reverse) required for PCR amplification and sequencing

53·5 60·1 71·4 58·4 65·4 57·0 68·0 60·0 60·4 66·8 67·2 61·4 61·8 61·5 57·1 67·9

Tm 124 140 145 185 199 180 142 122 201 161 191 289 348 180 190 270

Total length

254 T. Gillis et al.


2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

20 bp DNA marker

1

255

200 bp

160 bp

100 bp

Figure 1. Amplicons produced with primers for STR (AC)9 using M. leprae NHDP55 as template. Lanes 1–5 contained 1000 M. leprae/reaction, lanes 7–11 contained 100 M. leprae/reaction and lanes 13–17 contained 10 M. leprae/reaction. DNA markers (20-bp ladder) are in lanes 6 and 12.

6-7, 12-5, 18-8, 21-3, 23-3 and 27-5 when using the reverse primer for sequencing. It should be noted that unreliable sequence data was obtained for STR 18-8 under standard conditions. In order to produce reliable reads the dominant PCR band had to be purified prior to sequencing. Total observed allele concordance was used to calculate percent concordance and is shown in Table 2. This measure was used to rank the STR loci in terms of reproducibility. As can be seen only loci (AT)15 and (TA)18 fell below 83% concordance for this typed isolate/ strain. Ranking order for the various STR loci primers was also calculated from the observed ability to type the PCR product. As can be seen in Table 2, only (AC)8b and (GAA)21 fell below 100%. In both cases their lower rank is a result of 1 of 6 sequence reactions being unreadable due to sequencing artifacts.

STABILITY OF STR LOCI DURING INFECTION

Armadillo-passaged M. leprae provided a model for leprosy-susceptible host infection in which STR locus stability could be tested over time. We tested 13 of the 16 STR on M. leprae

PCR Trial

Allele Call

Typeability

Reader 2

Obs.Allele Concordance

Typeability (Total)

Allele Call Typeability

Reader 1 Allele Call

2/3

2/3

3/3

0/3

3/3

3/3

0/3

2/3

3/3

3/3

2/3

3/3

3/3

3/3

3/3

3/3

2/3

3/3

3/3


3/3

Typeability

Reader 2

A. Typeability and Allele Concordance Measurements for three PCR Replicates per STR locus for NHDP55 Template DNA (AC)8a 1 10 10 10 10 2 10 10 10 10 3 10 3/3 10 3/3 3/3 6/6 10 3/3 9 (AC)8b 1 7 7 7 7 2 7 7 7 U 3 7 3/3 7 3/3 3/3 6/6 7 3/3 7 (AC)9 1 8 8 8 8 2 8 8 8 8 3 8 3/3 8 3/3 3/3 6/6 8 3/3 8 (AT)15 1 18 17 18 17 2 18 17 18 17 3 18 3/3 17 3/3 0/3 6/6 18 3/3 17 (AT)17 1 13 13 13 13 2 13 13 13 13 3 13 3/3 13 3/3 3/3 6/6 13 3/3 13 (TA)10 1 13 13 13 13 2 13 13 13 13 3 13 3/3 13 3/3 3/3 6/6 13 3/3 13 (TA)18 1 20 20 20 19 2 20 20 20 19 3 20 3/3 20 3/3 3/3 6/6 20 3/3 19 (GAA)21 1 12 12 12 12 2 12 12 12 U 3 12 3/3 12 3/3 3/3 6/6 12 3/3 12 (GGT)5 1 4 4 4 4 2 4 4 4 4 3 4 3/3 4 3/3 3/3 6/6 4 3/3 4 (GTA)9 1 10 10 10 10 2 10 10 10 10 3 10 3/3 10 3/3 3/3 6/6 10 3/3 10

VNTR locus ID

Reader 1 Allele Call Typeability

[Microsatellite Loci] Allele determination (Sequence of PCR product in forward direction)

6/6

6/6

5/6

6/6

6/6

6/6

6/6

6/6

5/6

6/6

Typeability (Total)

6/6

6/6

5/6

3/6

6/6

6/6

0/6

6/6

5/6

5/6

Ratio

100

100

83

50

100

100

0

100

83

83

%

1

1

2

3

1

1

4

1

2

2

Rank

12/12

12/12

11/12

12/12

12/12

12/12

12/12

12/12

11/12

12/12

Ratio

100

100

92

100

100

100

100

100

92

100

%

1

1

2

1

1

1

1

1

2

1

Rank

Total Typeability (based onforward plus reverse sequences)

Table 2. Typeability and allele concordance measurements for PCR amplicons per STR locus for NHDP55 template DNA. A. Small di- and tri-nucleotide STR (microsatellite loci). B. Large repeating STR (minisatellite loci)

Total Observed Allele Concordance (based on forward plus reverse sequences)

T. Gillis et al.

Allele determination (Sequence of PCR product in reverse direction)

256

PCR Trial

Allele Call

Typeability

Reader 2


Allele Call Typeability

Reader 1 Allele Call

1/1 1/1 1/1 1/1 1/1 1/1

Typeability

Reader 2

1/1 1/1 1/1 1/1 1/1 1/1


2/2 2/2 2/2 2/2 2/2 2/2

Typeability (Total)

Allele determination (Sequence of PCR product in reverse direction)

STR locus for NHDP55 Template DNA 2/2 7 1/1 7 2/2 5 1/1 5 2/2 8 1/1 8 2/2 2 1/1 2 2/2 2 1/1 2 2/2 4 1/1 4

Typeability (Total)

B. Typeability and Allele Concordance Measurements for one PCR Replicates per 6-7 1 7 1/1 7 1/1 1/1 12-5 1 5 1/1 5 1/1 1/1 18-8 1 8 1/1 8 1/1 1/1 21-3 1 2 1/1 2 1/1 1/1 23-3 1 2 1/1 2 1/1 1/1 27-5 1 4 1/1 4 1/1 1/1

VNTR locus ID

Reader 1 Allele Call Typeability

[Microsatellite Loci] Allele determination (Sequence of PCR product in forward direction)

Table 2. continued

2/2 2/2 2/2 2/2 2/2 2/2

Ratio

100 100 100 100 100 100

%

1 1 1 1 1 1

Rank

Total Observed Allele Concordance (based on forward plus reverse sequences)

4/4 4/4 4/4 4/4 4/4 4/4

Ratio

100 100 100 100 100 100

%

1 1 1 1 1 1

Rank

Total Typeability (based onforward plus reverse sequences)

Short tandem repeats for Mycobacterium leprae 257

258

T. Gillis et al.

Table 3. Stability of STR loci during experimental M. leprae infection in armadillos STR locus

HO

H1

H2

H3

AC8a AC8b AC9 AT17 GAA21 GGT5 GTA9 TA10 6-7 12-5 21-3 23-3 27-5

10 7 8 13 10 4 10 12 7 5 2 2 4

10 7 8 13 9 4 10 12 7 5 2 2 4

10 7 8 13 11 4 10 12 7 5 2 2 4

10 7 8 13 10 4 10 12 7 5 2 2 4

DNA extracted from heavily infected tissues representing four infection cycles for a total growth time of 5 years and 7 months (Table 3). All loci, except (GAA)21, were stable throughout the passages.

Discussion Our understanding of basic epidemiology and pathogenesis of leprosy has not kept pace with modern advances in microbiology and molecular medicine. This is due primarily to our inability to grow M. leprae on artificial media, precluding studies as basic as using molecular techniques to track transmission of M. leprae and to develop simple tests for early diagnosis of leprosy. Despite the availability of antibiotic treatment, there are hundreds of thousands of new cases of leprosy every year demonstrating that active transmission is occurring in the face of an antibiotic-based leprosy elimination strategy.9 Therefore, understanding the dynamics of transmission of leprosy is fundamental to applying new intervention strategies aimed at eradication. Earlier efforts to associate M. leprae isolates based on DNA mutations resulting in restriction length polymorphisms, insertion and deletions and variable number of tandem repeats (VNTR) at the mycobacterial interspersed repetitive units (MIRU) loci have not produced the tools needed for a robust typing system. Whole genome sequencing of the TN strain of M. leprae and partial genome sequencing of a few other strains has yielded a typing system based on SNP differences allowing continent-wide distribution to be mapped and establishing the basis for proposing how the leprosy bacillus has migrated throughout the world.10 More precise associations were not possible with so few SNP markers making country or village-wide mapping of M. leprae isolates impossible. We report here the characterisation of a different type of typing system based on polymorphic DNA structures called STRs. STR have been used successfully as part of typing schemes for M. tuberculosis as well as other mycobacteria.11 – 15 Of the 50-plus STR identified in the M. leprae genome we selected 16 from previous reports identifying polymorphic micro- and minisatellites and STR with di- and trinucleotide repeats and in STR with repeat lengths of greater than five for further characterisation.1,6


259

Primers selected for amplifying and sequencing the STR loci were robust in that they were able to amplify a single dominant band from a few as 10 M. leprae in the PCR reaction. In addition, DNA sequencing was highly reproducible for all loci with (AT)15 and (TA)18 ranking lowest in terms of sequence concordance. A single primer was selected for further DNA sequencing from these results. In all cases, except (AT)17, (GTA)9 and 27-5, the forward primers were selected for optimal DNA sequencing. STR loci 18-8 was difficult to analyse when tested at higher concentrations of bacteria due to multiple stutter bands. This required gel purification of the dominant PCR band to produce readable sequences. Our final assessment of reproducibility of the selected STR loci was to test M. leprae strain NHDP60 propagated in armadillos over a 5-plus year period. Thirteen of the 16 STR loci were screened for stability and all but (GAA)21 was found stable over time. Since the armadillo represents a naturally susceptible host for M. leprae, it is likely that conditions for growth and potential mutations during propagation are similar to that found in humans at least for a 4– 5 year period. Two recent publications have brought the stability question of STR into focus.16,17 These studies reported on the stability of various STR loci, testing bacteria from biopsies taken from multiple sites or bacteria obtained from sequential biopsies taken from the same patient, over a defined period of time. They reported intrapatient variation for some of the STR and concluded that because of this variation STR typing may have limitations needing a thorough evaluation and appropriate application as a typing tool. We feel that characterising the reproducibility of conditions for PCR amplification and DNA sequencing of STR are critical steps for limiting procedural errors that may manifest as STR counting artifacts. While some of their data could be the result of procedural artifact, particularly with di and tri-nucleotide STR, it is less clear how longer STR, as described by Young et al.17 could produce artifacts as reported. These data underscore the need for highly characterised procedures and specificity, sensitivity and reproducibility testing as presented in our study. Alternatively, the observed variability may be genuine due to the nature of the loci and replication errors occuring in vivo or in vitro during assessment. However, to fully characterise such variability the STR in question should be assessed on larger collections of clinical samples, and in combination with multiple loci for the implications of bacterial diversity and generation of variants in disease and during transmission in different endemic settings. Variability should also be assessed in terms of whether changes in an individual STR impacts the detection of disease clusters, vis-a`-vis, multi-case families (see companion reports in epidemiology section). Finally, one cannot rule out the possibility of co-infection with non-identical strains giving rise to the observed variability at various STR loci. Short-term stability is critical in attempting to use typing schemes to track infectious diseases and is particularly important in leprosy with the long preclinical incubation period often experienced. Accordingly, we report similar studies in individual patients testing reproducibility of STR for typing M. leprae obtained from multiple sites in the same patient. These data are reported in three of the associated companion reports: Xing et al.18 Sakamuri et al.19 and Shinde et al.20 The stability of the STR described in this report form the basis of a robust typing scheme for M. leprae and should be further tested in field settings to determine their utility for identifying strains of M. leprae and related patterns of distribution and movement within leprosy endemic communities. Understanding transmission may lead to better intervention strategies for managing leprosy and could shed light on the epidemiological relationships of new cases that cannot be linked to a known leprosy case.

260

T. Gillis et al.

Acknowledgements This study received funding from the Heiser Program for Research in Leprosy and Tuberculosis of the New York Community Trust as part of the IDEAL (Initiative for Diagnostic and Epidemiological Assays for Leprosy) Consortium. Also NIH Y1-AI-2646, NIH AI-063457, N01-AI-25469, Naoko Robbins and Kyle Andrews (NHDP), Miyako Kimura and Weng Zheng (CSU) for financial and technical support.

References 1 2 3 4

5 6 7 8 9 10 11 12

13

14

15

16 17 18 19 20

Groathouse NA, Rivoire B, Kim H et al. Multiple polymorphic loci for molecular typing of strains of Mycobacterium leprae. J Clin Microbiol, 2004; 42: 1666– 1672. Matsuoka M, Maeda S, Kai M et al. Mycobacterium leprae typing by genomic diversity and global distribution of genotypes. Int J Lepr Other Mycobact Dis, 2000; 68: 121–128. Shin YC, Lee H, Lee H et al. Variable numbers of TTC repeats in Mycobacterium leprae DNA from leprosy patients and use in strain differentiation. J Clin Microbiol, 2000; 38: 4535–4538. Truman R, Fontes AB, de Miranda AB et al. Genotypic variation and stability of four variable-number tandem repeats and their suitability for discriminating strains of Mycobacterium leprae. J Clin Microbiol, 2004; 42: 2558–2565. Matsuoka M, Zhang L, Budiawan T et al. Genotyping of Mycobacterium leprae on the basis of the polymorphism of TTC repeats for analysis of leprosy transmission. J Clin Microbiol, 2004; 42: 714–745. Zhang L, Budiawan T, Matsuoka M. Diversity of potential short tandem repeats in Mycobacterium leprae and application for molecular typing. J Clin Microbiol, 2005; 43: 5221–5229. Young SK, Taylor GM, Jain S et al. Microsatellite mapping of Mycobacterium leprae populations in infected humans. J Clin Microbiol, 2004; 42: 4931–4936. Dockrell HM, Oskam L, Richardus JH. Global collaborations in leprosy research – the future is connected. Lepr Rev, 2008; 79: 358–360. Global leprosy Situation beginning of 2008. WHO Weekly epidemiological Record 2008; 83: 293–300. Monot M, Honore´ N, Garnier T et al. On the origin of leprosy. Science, 2005; 308: 1040–1042. Frothingham R, Meeker-O’Connell WA. Genetic diversity in the Mycobacterium tuberculosis complex based on variable numbers of tandem DNA repeats. Microbiology, 1998; 144: 1189–1196. Mazars E, Lesjean S, Banuls AL et al. High-resolution minisatellite-based typing as a portable approach to global analysis of Mycobacterium tuberculosis molecular epidemiology. Proc Natl Acad Sci U S A, 2001; 98: 1901–1906. Supply P, Allix C, Lesjean S et al. Proposal for standardization of optimized mycobacterial interspersed repetitive unit-variable-number tandem repeat typing of Mycobacterium tuberculosis. J Clin Microbiol, 2006; 44: 4498–4510. Thibault VC, Grayon M, Boschiroli ML et al. Combined multilocus short-sequence-repeat and mycobacterial interspersed repetitive unit-variable-number tandem-repeat typing of Mycobacterium avium subsp. paratuberculosis isolates. J Clin Microbiol, 2008; 46: 4091–4094. Allix-Beguec C, Fauville-Dufaux M, Supply M. Three-year population-based evaluation of standardized mycobacterial interspersed repetitive-unit-variable-number tandem-repeat typing of Mycobacterium tuberculosis. J Clin Microbiol, 2008; 46: 1398–1406. Monot M, Honore N, Baliere C et al. Are variable-number tandem repeats appropriate for genotyping Mycobacterium leprae? J Clin Microbiol, 2008; 46: 2291–2297. Young SK, Po¨nnighaus JM, Jain S et al. Use of Short Tandem Repeat Sequences to Study Mycobacterium leprae in Leprosy Patients in Malawi and India. PLoS Negl Trop Dis, 2008; 2: e214. Xing Y, Liu J, Sakamuri RM et al. VNTR typing studies of Mycobacterium leprae in China: assessment of methods and stability of markers during treatment. Lepr Rev, 2009; 80: 261–271. Sakamuri RM, Harrison J, Gelber R et al. A continuation: study and characterisation of M. leprae short tandem repeat genotypes and transmission of leprosy in Cebu, Philippines. Lepr Rev, 2009; 80: 272–279. Shinde V, Newton H, Sakamuri RM et al. VNTR typing of Mycobacterium leprae in South Indian leprosy patients. Lepr Rev, 2009; 80: 290–301.