Characterization and establishment of a reference ...

YPEST-04040; No of Pages 5 Pesticide Biochemistry and Physiology xxx (2017) xxx–xxx

Contents lists available at ScienceDirect

Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest

Characterization and establishment of a reference deltamethrin and cypermethrin resistant tick line (IVRI-IV) of Rhipicephalus (Boophilus) microplus Srikant Ghosh a,⁎, Snehil Gupta a, Ajith Kumar KG a, Anil Kumar Sharma a, Sachin Kumar a, Gaurav Nagar a, Rinesh Kumar a, Souvik Paul a, Ashutosh Fular a, Gajanan Chigure a, Abhijit Nandi a, HV Manjunathachar a, Aquil Mohammad a, MR Verma b, BC Saravanan a, Debdatta Ray a a b

Entomology Laboratory, Division of Parasitology, ICAR-Indian Veterinary Research Institute, Izatnagar, 243122, U.P., India Division of Economics and Statistics, ICAR-Indian Veterinary Research Institute, Izatnagar, 243122, U.P., India

a r t i c l e

i n f o

Article history: Received 11 June 2016 Received in revised form 31 January 2017 Accepted 1 March 2017 Available online xxxx Keywords: Rhipicephalus (Boophilus) microplus Pyrethroid resistant Sodium channel gene mutation CES gene mutation Enzyme alteration

a b s t r a c t The problem of ticks and tick borne diseases is a global threat and growing reports of resistance to commonly used insecticides further aggravated the condition and demands for country specific resistance monitoring tools and possible solutions of the problem. Establishment of standard reference is prerequisite for development of monitoring tools. For studying possible role of different mechanisms involved in development of resistance in Rhipicephalus (Boophilus) microplus population and to develop newer drug to manage the problem of resistance, a deltamethrin exposed and selected tick colony, referred to as IVRI-IV, was characterized using reference susceptible IVRI-I tick line as control. The RF values of IVRI-IV ticks against deltamethrin, cypermethrin and diazinon were determined as 194.0, 26.6, 2.86, respectively, against adults. The esterase enzyme ratios of 2.60 and 5.83 was observed using α-naphthyl and β-naphthyl acetate while glutathione S–transferase (GST) ratio was 3.77. Comparative analysis of IVRI-I and IVRI-IV carboxylesterase gene sequences revealed 13 synonymous and 5 non synonymous mutations, reported for the first time. The C190A mutation in the domain II S4-5 linker region of sodium channel gene leading to leucine to isoleucine (L64I) amino acid substitution was also detected in the IVRI-IV population. In the present study, monitorable indicators for the maintenance of the reference IVRI-IV colony, the first established deltamethrin and cypermethrin resistant tick line of India, were identified. © 2017 Elsevier Inc. All rights reserved.

1. Introduction Ticks are obligate hematophagous arthropods which parasitize every class of vertebrates in almost every region of the world [1]. In India, Rhipicephalus (Boophilus) microplus has been reported from almost all states except Andaman and Nicobar islands, Manipur and is responsible for transmission of Babesia bigemina and Anaplasma marginale in cattle [2,3] and the cost of controlling ticks and tick borne diseases has been estimated at the tune of 498.7 million USD per annum [4]. The R. (B.) microplus has been ranked 6th amongst the resistant arthropods and resistance to almost every chemicals has been reported from different parts of the world including India [5,6]. Reference resistant homogenous tick colonies are the essential biological material required to study the mechanism of development of resistance and to formulate newer tick management strategy for field situation. In recent years, resistance reports have gained paramount attention amongst the tick researchers and drug manufacturers, but little

⁎ Corresponding author. E-mail address: [email protected] (S. Ghosh).

attention has been paid towards development of country specific reference tick line for generation of country specific base line data [7,8]. For the last several years, a number of reference R. (B.) microplus strains susceptible and resistant to SP compounds are being maintained by CFTRL (Texas), CSIRO (Australia), UFGRS (Brazil) etc. for generation of country specific tools for resistance monitoring [9]. In India, specific susceptible lines viz., IVRI-I, R. (B.) microplus and IVRI-II, Hyalomma anatolicum strains were characterized and registered in the national registration system (NBAII/IVRI/BM/1/1998 and NBAII/IVRI/HA/1/ 1998). However, as such no reference resistance tick lines were available to study the mechanism of development of resistance. In the present study, an attempt was made to characterize and establish a reference resistant tick line to support the resistance studies. Development of resistance against cypermethrin, and deltamethrin had been reported from various parts of India and considered to be a serious issue in livestock development programme [10–12]. To unravel the factors associated with development of SP resistance, a deltamethrin exposed and selected tick colony is maintained since 2009 in the Entomology laboratory of the institute, as IVRI-IV. Attempts have also been made to develop diazinon and multi drug resistant R. (B.) microplus lines in the entomology laboratory, IVRI by providing continuous selection

http://dx.doi.org/10.1016/j.pestbp.2017.03.002 0048-3575/© 2017 Elsevier Inc. All rights reserved.

Please cite this article as: S. Ghosh, et al., Characterization and establishment of a reference deltamethrin and cypermethrin resistant tick line (IVRI-IV) of Rhipicephalus (Bo..., Pesticide Biochemistry and Physiology (2017), http://dx.doi.org/10.1016/j.pestbp.2017.03.002

2

S. Ghosh et al. / Pesticide Biochemistry and Physiology xxx (2017) xxx–xxx

pressure of acaricides for the last five to six years but characterization is awaited. The present study was undertaken to characterize the repeatedly deltamethrin exposed tick colony, IVRI-IV, to establish it as reference material for tick research and to enrich the registry of characterized arthropods of importance. 2. Material and methods 2.1. Acaricides Technical grade cypermethrin, deltamethrin, and diazinon were procured from AccuStandard® Inc./Sigma-Aldrich, U.S.A., and were used for the preparation of stock solutions in methanol/acetone. For dose-dependent bioassay, different working concentrations (in multiples of DC generated using reference susceptible IVRI-I line) were prepared from the stock solution in distilled water. Commercialized insecticide preparations were avoided to maintain repeatability of the results and to avoid additional effect of synergist or any proprietary additives used by manufacturers. 2.2. Animals For maintaining ticks, weaned crossbred (Bos taurus male × B. indicus female) male calves were reared in tick proof animal houses of the division of Parasitology, Indian Veterinary Research Institute and fed with calf starter, milk, concentrate mixture, wheat bran and water ad libitum. Two animals were used alternatively and after 2–3 cycles of release of larvae for feeding, the animal was given rest for 1–2 months and alternatively second animal was used for the recovery of sufficient number of engorged ticks for experimentation. The calves were reared as per the guidelines of statutory Indian body, “Committee for the Purpose of Control and Supervision on Experimentation on Animals” (CPCSEA). 2.3. Reference susceptible IVRI-I line The homogenous colony of acaricide susceptible IVRI-I line of R. (B.) microplus (National strain registration no. NBAII/IVRI/BM/1/1998) was maintained at 28 °C and 85 ± 5% RH in the Entomology Laboratory, Division of Parasitology since 1998. On an average 8–10 h light period was maintained for rearing of ticks in incubator. The genetic homogeneity (99.8%) in the colony was confirmed by PCR amplification and sequence analysis of mitochondrial 16S rDNA [13]. This tick line was adopted in the laboratory and is continuously being reared for the last several years. The discriminating concentrations (DC) of chemical acaricides used for resistance characterization were determined by adult immersion test (AIT) and larval packet test (LPT) using the reference line [14,15]. For biochemical and molecular characterization, larvae and adults were stored in −80 °C. 2.4. Tick colony The colony of R. (B.) microplus is continuously maintained since 2009 exerting repeated selection pressure of deltamethrin in each generation of adults. The ticks were originally collected from Danapur village of Patna district in Bihar, India. To maintain the resistance level, ticks of each generation was selected after exposure to particular concentration of deltamethrin. The resistance factor of the line was calculated at every five generations employing laboratory standardized AIT and LPT procedures. The 40th generation of the colony which developed high rate of survivability to exposed dose of deltamethrin were selected for characterization. 2.5. Bioassays The AIT was performed as described by Benavides et al. [16] with minor modifications [10,17]. To determine LC50 and LC95 values of

chemical acaricides, the dose-response assay using reference susceptible IVRI-I tick line was conducted using serial dilution prepared from the stock solution. The resistance factor (RF) of IVRI-IV ticks was estimated by dividing the LC50 value of respective chemical acaricide against IVRI-IV ticks with LC50 against susceptible ticks [17]. The LPT was conducted as per FAO guidelines with minor modifications and RF was calculated [18]. Based on the RF value, resistance level of IVRI-IV is categorized [10]. The probit analysis and chi square test of dose-response data of IVRI-IV ticks against deltamethrin, cypermethrin and diazinon were performed using SAS 9.3 statistical software. 2.6. Biochemical characterization 2.6.1. Esterases Esterase activity based on substrate – product reaction was determined according to the method of Hemingway and Brogdon [19] with laboratory standardized modifications. Forty larvae of 10–14 days old stored at − 80 °C were homogenized with 150 μl of distilled water followed by centrifugation at 1100 ×g at 4 °C for 15 min and then supernatant was collected for enzyme assay. A 30 mM stock solution of α and β naphthyl acetate was prepared in acetone and stored separately at 40C. The working solution of α and β naphthyl acetate was prepared fresh by adding 100 μl of 30 mM α or β naphthyl acetate in 9.9 ml of 0.02 M phosphate buffer, pH 7.2. The fast blue stain solution was also made fresh by adding 15 mg fast blue in 1.5 ml distilled water and 3.5 ml of 5% SDS in 0.1 M sodium phosphate buffer (pH 7.2). In a 96 well microtitre plate, 20 μl of the homogenate was added to adjacent wells in duplicate with 150 μl of either α or β naphthyl acetate working solution, respectively. In the control blank wells, 20 μl of distilled water was added in place of tick homogenate. The reaction mixtures were incubated at room temperature for 15 min, 50 μl of fast blue solution was then added to each well and the plates were incubated at room temperature for 5 min to allow the color formation to occur and the absorbance was measured at 570 nm in an ELISA reader. The amount of naphthol produced was divided by the number of minutes the substrate and homogenate were incubated before the stain was added. The total protein concentration of each sample was determined according to dye-binding method of Bradford using a microtiter plate (Axygen, USA). Standard bovine serum albumin (2 mg/ml; Sigma Aldrich) was used for the preparation of protein standard curve. The data were subjected to linear regression analysis. The absorbance was measured at 595 nm and the mean concentration of protein was determined. The amount of naphthol produced per minute obtained as above was again divided by the protein value. Esterase activities were reported as μmoles of product formed/min/mg protein [20]. 2.6.2. Glutathione S-transferase (GST) The GST assay was performed according to Habig et al. [20] with some modifications. Forty 10–14 day old larvae stored at −80 °C were homogenized in mortar with 150 μl of distilled water followed by centrifugation at 1100 ×g at 4 °C for 15 min and then supernatant was collected for GST assay. The working solution for the assay was prepared by adding 2.5 ml of 10 mM reduced glutathione (GSH) in phosphate buffer (pH 6.5) with 125 μl of 63 mM chlorodinitrobenzene (CDNB). In a 96 wells microtitre plate 150 μl working solution was added with10 μl of larval homogenate in duplicate adjacent wells. All the reagents were freshly prepared and used within 2 h. In the control blank well, 10 μl water was added in lieu of tick homogenate. The plates were incubated for 20 min in dark and absorbance was read at 340 nm. The concentration of GST was calculated by Lambert-Beer's law A = εCL. Where, A: Absorbance at 340 nm after 20 min; ε: Extinction coefficient of product (3-(2-chloro-4-nitrophenyl)-glutathione) = 4.39 mM−1; L: Path length, which in this case was 6 mm;



C: Concentration For calculating the specific activity of GST, the GST concentration of the homogenate was divided by total protein as calculated by Bradford assay. Therefore, GST activity in the homogenate was calculated as GSTðmM=mg= minÞ ¼

Optical density 1000 cl homogenate 20 min 4:39 mM−1 6 mm total protein in 10 Ë

For each sample duplicate wells were used and data obtained were analyzed by one way ANOVA.

3

of R. (B.) microplus revealed the RF of 194.0 and 67.46 against deltamethrin, respectively, while 26.6 and 7.67 against cypermethrin with respect to their LC50 estimates. However, the line also showed slight resistance to diazinon in AIT bioassay showing RF of 2.86 while larvae were found sensitive. The results of chi square test (χ2) did not indicate significant difference between observed and expected response of ticks treated with cypermethrin, deltamethrin and diazinon using AIT and LPT bioassay (Table 1). The observed chi square values for AIT against these chemicals were ranged from 0.4607 to 0.7766 and in case of LPT the values were ranging from 2.809 to 9.582 and were insignificant (p N 0.05). The observed level of significance was 0.088 to 0.8584 (p N 0.05). The chi square test of the data revealed the goodness of fit data in probit model and also showed the homogeneity of the IVRI-IV line (Table 1).

2.7. Molecular characterization Total RNA from randomly selected adult female ticks (n = 10 for each) of IVRI-I and IVRI-IV was extracted using Trizol® reagent (Thermo Scientific, USA). The integrity of RNA was checked by gel electrophoresis and the concentration was determined in NanoDrop spectrophotometer and cDNA was synthesized using oligo dT primer. The complete cds of CES gene (1635 bp) was amplified using primers, CES F 5′ATGGCGGTGAAAGCAGCTGTG3′ and CES R 5′ GCGATTTCCCTTAGAAGAGTGACTT3′ custom designed from accession no. AF182283. The 50 μl PCR reaction was set up containing 5 μl 10 × Dream Taq buffer; 5 μl cDNA (1:5 dilution, 100 ng/μl); 2 μl 25 mM MgCl2; 1 μM each primer; 0.4 mM dNTPs and 0.5 μl Dream Taq polymerase (5 U/μl) (Thermo Scientific, USA) and cycling conditions were 95 °C for 3 min, 40 cycles of 95 °C for 30 s, 63 °C for 30 s, 72 °C for 2 min and finally 72 °C for 10 min. The amplified gene was cloned using pTZ57R/T vector and E. coli DH5α cells. Five positive clones, each from a different RNA sample were outsourced to Delhi University DNA sequencing facility for double stranded sequencing. To screen for mutations in the CES gene, the forward and reverse sequence data of IVRI-IV and IVRI-I were aligned, analyzed and compared using Clustal W in laser gene software (DNA Star Inc., Madison, USA) and BTI software (Gene Tool lite, USA). The C190A mutation in S4-5 linker region of sodium channel gene has been detected earlier in the IVRI-IV tick population and regularly monitored at each generation. In the current study, 40th generation was screened for the presence of C190A mutation. The PCR amplification, cloning and sequencing was performed following the protocol of Kumar Rinesh et al. [21]. 3. Results 3.1. Bioassay The results obtained in AIT and LPT based bioassays against pyrethroid resistant tick line-IV as compared to the susceptible IVRI-I line

3.2. Biochemical characterization 3.2.1. Esterase activity The mean specific activity of esterases was found to be 0.687 ± 0.0499 nmol α-naphthol formed/min/mg protein and 1.292 ± 0.0845 nmol β-naphthol formed/min/mg protein using α and βnaphthyl acetate, respectively, for reference susceptible IVRI-I tick. In comparison, IVRI-IV showed immediate color transition with high mean esterase activity of 1.811 ± 0.132 nmol α-naphthol formed/ min/mg protein and 6.862 ± 0.420 nmol β-naphthol formed/min/mg protein indicating 2.60 fold and 5.83 folds elevations. It was observed that esterase activity using β-naphthyl acetate is a better monitoring indicator than use of α-naphthyl acetate (Table 2).

3.2.2. Glutathione S-transferase (GST) activity The specific activity of GST in case of IVRI-I was found to be 0.32 ± 0.02 mmol/min/mg protein, however, a significant (p b 0.001) fold increase of 3.77 in GST activity (1.23 ± 0.41 mmol/min/mg protein) was recorded in IVRI-IV with rapid production of CDNB-GSH conjugate (Table 2).

3.3. Molecular characterization The in silico analysis of full length sequence of IVRI-IV CES (accession no. KT215345) gene detected 18 nucleic acid substitutions of which 13 were found to be synonymous and 5 were non-synonymous. Amongst these, 3 substitutions (A848G, A1175G and C1376T) were found consistently in IVRI- IV tick population (Table 3) which resulted in three amino acid substitutions viz. E283G, E392G and P459L (Table 4). The C190A mutation in the sodium channel gene was also detected in the 25th generation of IVRI-IV tick colony.

Table 1 Comparative dose-response data of IVRI-IV and IVRI-I ticks treated with deltamethrin, cypermethrin and diazinon using LPT and AIT bioassay Acaricides

Cypermethrin

Bioassay

LPT AIT

Deltamethrin

LPT AIT

Diazinon

LPT AIT

LC50 (CL) (ppm)

LC95 (CL) (ppm)

IVRI-IV

IVRI-I

IVRI-IV

IVRI-I

1858.84 (1721.1–1791.5) 3692.45 (3516.6–3877.1) 796.1 (765.5–827.9) 2600.0 (2476.2–2730) 242.57 (220.4–266.7) 1067.93 (998.04–1142.6)

242.4 (241.2–243.6) 138.5 (134.5–142.6) 11.8 (11.6–12.0) 13.4 (12.4–14.5) 499.7 (497.7–501.7) 372.0 (341.3–405.3)

7468.91 (6383.7–8738.6) 9378.90 (8449.4–10,410.6) 1668.70 (1545.1–1802.2) 6686.00 (6023.4–7421.5) 1481.84 (1214.6–1807.8) 3458.54 (3033.8–3942.7)

350.7 (347.2–354.2) 349.1 (323.2–377.0) 35.5 (34.1–36.9) 29.6 (27.7–31.7) 636.6 (630.9–642.3) 635.2 (582.75–692.37)

χ2

p value

RF

9.582

0.088

7.67

0.4607

0.7943

26.60

2.809

0.422

67.46

0.7626

0.8584

194.0

4.577

0.206

0.48

0.7766

0.6782

2.86


4


Table 2 Comparative analysis of enzyme activities in IVRI-I and IVRI-IV lines of R. (B.) microplus using optimum number of larvae and standardized reaction time. Tick lines

α-Naphthol (μmoles/min/mg protein)

β-Naphthol (μmoles/min/mg protein)

GST (mM/mg/min)

IVRI-I IVRI-IV Enzyme ratio

0.687 ± 0.05 1.811 ± 0.13 2.60c

1.292 ± 0.08 6.862 ± 0.42 5.83c

0.32 ± 0.02 1.23 ± 0.41 3.77c

c

Significant at p b 0.001.

4. Discussion Globally, for generation of scientifically repeatable data, few tick research laboratories established reference characterized tick lines and generated significant data. The reference lines were exploited to establish DC of various acaricides; standardization of various bioassay viz. AIT, LPT, LIT, larval tarsal test [22,23], larval immersion microassay [24]; vaccine trials, for comparative analysis of herbal and chemical acaricides efficacy [25]; mechanism of action of drugs as well as to study the mechanism of development of resistance which may be biochemical [26] or molecular [27,28]. The use of OP and SP compounds forms the backbone of arthropod management in tropical and sub-tropical countries. However, due to indiscriminate use of these acaricides, ticks have developed resistance to most of the introduced acaricides. During the last few years, after determination of DC (at IVRI laboratory) of commonly used acaricides, resistance has been reported comparatively at a faster pace and the subject has been reviewed recently [6]. However, the knowledge on mechanisms of development of resistance and the possible solution is very limited. The present study was focused to characterize a resistant tick population and to correlate the possible role of over-expression of functional enzymes and changes in the targeted genes with development of resistance. Previously, reference tick lines were characterized using resistance monitoring tools like AIT, LPT and by native PAGE profiling for esterase. For instances, following characterization of San Felipe, Corrales and Coatzacoalcos strains, resistance ratio (RR) of 1840, 6900 and 250, respectively, were reported against permethrin, and 1.4, 1.3 and 3.6 against coumaphos, respectively [26]. The RR of 250 against permethrin in Coatzacoalcos strain was reported with a higher esterase activity on native PAGE system [29]. The Brazilian Santa Luiza strain was reported to be highly resistant to permethrin (RR 93.0) and to amitraz (RR 188.0) along with domain II sodium channel mutation [30]. The Pasqueria strain was found to be resistant to both diazinon and coumaphos [31]. In the present study, RF of the IVRI-IV tick against deltamethrin, cypermethrin and diazinon was determined as 194.0, 26.0 and 2.86, respectively, although the ticks were repeatedly selected after treatment with different dosages of deltamethrin only. Mainly three enzymes viz., esterase, monooxygenase and glutathione S-transferase are reported to be involved in metabolic detoxification and often correlated with development of acaricide resistance [32]. Significant increase in esterase, GST and monooxygenase activity in field resistant R. bursa population collected from difference provinces of Iran was reported but failed to correlate the higher enzyme activity with resistance due to non-availability of reference strain for comparison [8]. In the present study, GST activity in IVRI-IV were 3.77

Table 4 Amino acid substitutions detected at different sites of carboxylesterase gene. Tick line

Carboxylesterase gene

Sites IVRI-I IVRI-IV

283 E G

392 E G

459 P L

(p b 0.001) folds higher than IVRI-I line, however, the higher activity cannot be correlated directly with resistance because of high sensitivity of reaction conditions, a small variation can mislead the results. Previously, no role of GST in conferring resistance in Corrales, san Felipe and Coatzacoalcos strains was reported [33]. In the same context, GST activity in field ticks collected from Punjab and Bihar states of India was found to be elevated but could not be correlated with development of resistance [23,34]. Majority of the synthetic pyrethroids are ester compounds, and high esterase activity has been often correlated with the development of resistance [35–37]. In the present study, a significantly elevated esterase activity of 2.60 and 5.83 fold (p b 0.001) in IVRI-IV ticks suggested the possible role of esterases in pyrethroid resistance development. In the quantitative assay of esterases, visual interpretation is possible which persist for a comparatively longer period of time and thus proposed to be a suitable monitorable indicator for maintenance of the tick line in the laboratory. Previously, several tick researchers exploited native PAGE profiling of esterase as a monitorable indicator of resistance in reference tick line. An elevated activity of CzEST-9 esterase in Coatzacoalcos strain was noticed [30] and higher activity of CzEST-9 has been exploited as monitorable indicator by various tick researchers while maintaining tick lines in their laboratories [27,29]. An elevated activity of EST-1, an acetylcholinesterase, was reported and linked with resistance in Brazilian population [36]. In a similar fashion, higher activity of EST-1, in IVRI-IV tick was found to be a monitorable indicator for maintenance of the tick line in the laboratory [37]. Sodium channel is the prime target of synthetic pyrethroids. Mutations in the sodium channel gene have been reported in various arthropods of agriculture and veterinary importance. The C190A mutation in the domain II S4-5 linker region of sodium channel resulting in an amino acid substitution from leucine in the susceptible isolate to an isoleucine (L64I) in the resistant isolate had been reported from Australian ticks [28]. Similar mutation has been identified in the IVRI-IV consistently and thus serves as one of the monitoring indicators for the routine maintenance of the tick line in laboratory condition. A G1120A mutation was identified in CES gene which generates a EcoRI site in gene sequence [38]. However, no such mutation was recorded in IVRI-IV and in the field isolates collected from three Indian states [39]. On the contrary, in this study three novel mutations (A848G, A1175G and C1376T) resulting in amino acid substitutions namely E283G, E392G and P459L were recorded (accession no. KT215345) while analyzing the full length sequence of carboxylesterase gene in IVRI-IV population. Previously, mutations in carboxylesterase gene linked with insecticide resistance have been identified in blowfly [40] and in Anisopteromalus calandrae [41]. Finally, following characters were identified as monitorable indicators for maintenance of IVRI-IV line in the laboratory. These are: high resistance to deltamethrin (RF = 194.0), moderate to cypermethrin (RF = 26.60) and mild to diazinon (RF = 2.86); high esterase activity;

Table 3 Results of analysis of nucleotide substitution in complete cds (1635 bp) of carboxylesterase gene. Site

78a

93a

171a

175

207a

237a

243a

306a

345a

366a

386

417a,b

420a

603a

612a

848b

1175b

1376b

IVRI-I IVRI-IV

T C

C T

C T

C G

G A

G A

C G

C T

C T

C T

C T

A G

C T

C T

C T

A G

A G

C T

a b

Synonymous mutation. Consistently found in all clones.



uninhibited EST-1 esterase in the presence of specific inhibitors and sodium channel mutation at S4-5 linker region of domain II. Although the problem of acaricide resistance was witnessed long back but few reference lines were established and maintained globally [9]. The present tick line has recently been registered in the national registration system (NBAIR-IVRI-BM-4-2009) and will be used as reference for tick research. As the RF of the IVRI-IV line against SP compounds is very high it can be presumed that drugs to be developed in future, if found effective against IVRI-IV line may contribute significantly in the management of SP resistant field ticks.

[17]

[18] [19]

[20] [21]

5. Conclusion [22]

A characterized deltamethrin and cypermethrin resistant R. (B.) microplus tick line, IVRI-IV has been established as reference tick line for tick research. Monitorable indicators were identified for continuous maintenance of the line in the laboratory.

[23]

[24]

Acknowledgements The authors are grateful to the Indian Council of Agricultural Research, New Delhi for funding through National Agricultural Science Fund (NFBSFARA/BSA-4004/2013-14) and World Bank through National Agricultural Innovation Project (NAIPcomp-4 C2066/2008-09) and National Fund for Basic Strategic and Frontier Application Research in Agriculture Project No. [NFBSFARA/BSA-4004/2013-14].

[25]

[26]

[27]

References [1] J.T. Snelson, Animal ectoparasites and disease vectors causing major reductions in world food supplies, FAO Plant Protect. Bull. 23 (1975) 103–117. [2] S. Ghosh, P. Azhahianambi, M.P. Yadav, Upcoming and future strategies of tick control: a review, J. Vector Borne Dis. 44 (2007) 79–89. [3] S. Ghosh, G.C. Bansal, S.C. Gupta, D.D. Ray, Q.K. Muhammed, I. Hamid, M. Shahiduzzaman, U. Seitzer, S. Ahmed Jabbar, Status of tick distribution in Bangladesh, India and Pakistan, Parasitol. Res. 101 (2007) 207–216. [4] B. Minjauw, A. McLeod, Tick-borne Diseases and Poverty. The Impact of Ticks and Tick-borne Diseases on the Livelihoods of Small-scale and Marginal Livestock Owners in India and Eastern and Southern Africa. Research Report on Animal Health Programme, Centre for Tropical Veterinary Medicine, University of Edinburgh, UK, 2003. [5] M.E. Whalon, D. Mota-Sanchez, R.M. Hollingsworth, Global Pesticide Resistance in Arthropods, CAB International Wallingford, Cambridge, UK, 2008 118–144. [6] S. Ghosh, G. Nagar, Problem of ticks and tick-borne diseases in India with special emphasis on progress in tick control research: a review, J. Vect. Borne Dis. 51 (2014) 259–270. [7] A.A. Enayati, F. Asgarian, M. Sharif, H. Boujhmehrani, A. Amouei, N. Vahedi, J. Hemingway, Propetamphos resistance in Rhipicephalus bursa (Acari, Ixodidae), Vet. Parasitol. 162 (2009) 135–141. [8] A.A. Enayati, F. Asgarian, A. Amouei, M. Sharif, H. Mortazavi, H. Boujhmehrani, J. Hemingway, Pyrethroid insecticide resistance in Rhipicephalus bursa (Acari, Ixodidae), Pestic. Biochem. Physiol. 97 (2010) 243–248. [9] S. Gupta, K.G. AjithKumar, A.K. Sharma, G. Nagar, S. Kumar, B.C. Saravanan, S. Ghosh, Esterase mediated resistance in deltamethrin resistant reference tick colony of Rhipicephalus (Boophilus) microplus, Exp. Appl. Acarol. 69 (2016) 239–248. [10] S. Kumar, S. Paul, A.K. Sharma, R. Kumar, S.S. Tewari, P. Chaudhuri, S. Ghosh, Diazinon resistant status in Rhipicephalus (Boophilus) microplus collected from different agro-climatic regions of India, Vet. Parasitol. 181 (2011) 274–281. [11] A.K. Sharma, R. Kumar, S. Kumar, G. Nagar, N.K. Singh, S.S. Rawat, S. Ghosh, Deltamethrin and cypermethrin resistance status of Rhipicephalus (Boophilus) microplus collected from six agro-climatic regions of India, Vet. Parasitol. 188 (2012) 337–345. [12] G. Jyothimol, R. Ravindran, S. Juliet, K.G. AjithKumar, N.N. Suresh, M.B. Vimalkumar, S. Ghosh, Low level deltamethrin resistance in ticks from cattle of Kerala, a south Indian state, Vet. Parasitol. 204 (2014) 433–438. [13] Kumar Rinesh, S. Paul, S. Kumar, A.K. Sharma, S. Gupta, A.K.S. Rawat, P. Chaudhuri, D.D. Ray, S. Ghosh, Detection of specific nucleotide changes in the hypervariable region of 16S rDNA gene of Rhipicephalus (Boophilus) microplus and Hyalomma anatolicum anatolicum, Indian J. Anim. Sci. 81 (2011) 1204–1207. [14] S. Kumar, A.K. Sharma, D.D. Ray, S. Ghosh, Determination of discriminating dose and evaluation of amitraz resistance status in different field isolates of Rhipicephalus (Boophilus) microplus in India, Exp. Appl. Acarol. 63 (2014) 413–422. [15] S. Kumar, A.K. Sharma, G. Nagar, S. Ghosh, Determination and establishment of discriminating concentrations of malathion, coumaphos, fenvalerate and fipronil for monitoring acaricide resistance in ticks infesting animals, Ticks Tick Borne Dis. 6 (2015) 383–387. [16] O.E. Benavides, N.A. Romero, Preliminary results of a larval resistance test to ivermectin using Boophilus microplus reference strains, Proceedings of the 5th Biennial

[28]

[29] [30]

[31]

[32] [33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

5

Conference of the Society for Tropical Veterinary Medicine, 12–16 June 1999 Key West, FL. E. Castro-Janer, L. Rifran, J. Piaggio, A. Gil, R.J. Miller, T.T.S. Schumaker, In vitro tests to establish LC 50 and discriminating concentrations for fipronil against Rhipicephalus (Boophilus) microplus (Acari: Ixodidae), Vet. Parasitol. 162 (2009) 120–128. K.P. Shyma, S. Kumar, A.K. Sharma, D.D. Ray, S. Ghosh, Acaricide resistance status in Indian isolates of Hyalomma anatolicum, Exp. Appl. Acarol. 58 (2012) 471–481. J. Hemingway, W. Brogdon, Techniques to Detect Insecticide Resistance Mechanism (Field and Laboratory Manual), Document WHO/CTD/CPC/MAL/98.6, World Health Organization, Geneva, 1998. W.H. Habig, M.J. Pabst, W.B. Jakoby, Glutathione S-transferases-the first enzymatic step in mercapturic acid formation, J. Biol. Chem. 249 (1974) 7130–7139. Kumar Rinesh, G. Nagar, A.K. Sharma, S. Kumar, D.D. Ray, P. Chaudhuri, S. Ghosh, Survey of pyrethroids resistance in Indian isolates of Rhipicephalus (Boophilus) microplus: identification of C190A mutation in the domain II of the para-sodium channel gene, Acta Trop. 125 (2013) 237–245. L. Lovis, M.C. Mendes, J.L. Perret, J.R. Martins, J. Bouvier, B. Betschart, H. Sager, Use of the Larval Tarsal Test to determine acaricide resistance in Rhipicephalus (Boophilus) microplus Brazilian field populations, Vet. Parasitol. 191 (2013) 323–331. S. Ghosh, R. Kumar, G. Nagar, S. Kumar, A.K. Sharma, A. Srivastava, Suman Kumar, K.G. AjithKumar, B.C. Saravanan, Survey of acaricides resistance status of Rhipiciphalus (Boophilus) microplus collected from selected places of Bihar, an eastern state of India, Ticks Tick Borne Dis. 6 (2015) 668–675. W.H. White, P.R. Plummer, C.J. Kemper, R.J. Miller, R.B. Davey, D.H. Kemp, S. Hughes, C.K. Smith 2nd, J.A. Gutierrez, An in vitro larval immersion microassay for identifying and characterizing candidate acaricides, J. Med. Entomol. 41 (2004) 1034–1042. K.G. Ajith Kumar, A.K. Sharma, S. Kumar, D.D. Ray, A.K.S. Rawat, S. Srivastava, S. Ghosh, Comparative in vitro anti-tick efficacy of commercially available products and newly developed phyto-formulations against field collected and resistant tick lines of Rhipicephalus (Boophilus) microplus, J. Parasit. Dis. 40 (2016) 1590–1596. L.D. Foil, P. Coleman, M. Eisler, H. Fragoso-Sanchez, Z. Garcia-Vazquez, F.D. Guerrero, N.N. Jonsson, I.G. Langstaff, A.Y. Li, N. Machila, R.J. Miller, J. Morton, J.H. Pruett, S. Torr, Factors that influence the prevalence of acaricide resistance and tick-borne diseases, Vet. Parasitol. 125 (2004) 163–181. M.A. Baffi, G.R.L. de Souza, C.U. Vieira, C.S. de Sousa, L.R. Gourlart, A.M. Bonetti, Identification of point mutations in a putative carboxylesterase and their association with acaricide resistance in Rhipicephalus (Boophilus) microplus (Acari: Ixodidae), Vet. Parasitol. 148 (2007) 301–309. J.A.T. Morgan, S.W. Corley, L.A. Jackson, A.E. Lew-Tabor, P.M. Moolhuijzen, N.N. Jonsson, Identification of a mutation in the para-sodium channel gene of the cattle tick Rhipicephalus (Boophilus) microplus associated with resistance to synthetic pyrethroid acaricides, Int. J. Parasitol. 39 (2009) 775–779. F.D. Guerrero, A.Y. Li, R. Hernandez, Molecular diagnostics of pyrethroid resistance in Mexican strains of Boophilus microplus, J. Med. Entomol. 39 (2002) 770–776. A.Y. Li, A.C. Chen, R.J. Miller, R.B. Davey, J.E. George, Acaricide resistance and synergism between permethrin and amitraz against susceptible and resistant strains of Boophilus microplus (Acari: Ixodidae), Pest Manag. Sci. 63 (2007) 882–889. R.J. Miller, A.Y. Li, M.A. Tijerina, R.B. Davey, J.E. George, Differential response to diazinon and coumaphos in a strain of Boophilus microplus (Acari: Ixodidae) collected in Mexico, J. Med. Entomol. 45 (2008) 905–911. F.D. Guerrero, L. Lovis, J.R. Martins, Acaricide resistance mechanisms in Rhipicephalus (Boophilus) microplus, Rev. Bras. Parasitol. Vet. 21 (2012) 1–6. R.J. Miller, R.B. Davey, J.E. George, Characterization of pyrethroid resistance and susceptibility to coumaphos in Mexican Boophilus microplus (Acari: Ixodidae), J. Med. Entomol. 36 (1999) 533–538. A. Nandi, H. Jyoti, N.K. Singh, Singh, Esterase and glutathione-S-transferase levels associated with synthetic pyrethroid resistance in Hyalomma anatolicum and Rhipicephalus microplus ticks from Punjab, India, Exp. Appl. Acarol. 66 (2015) 141–157. R. Hernandez, F.D. Guerrero, J.E. George, G.G. Wagner, Allele frequency and gene expression of a putative carboxylesterase-encoding gene in a pyrethroid resistant strain of the tick Boophilus microplus, Insect Biochem. Mol. Biol. 32 (2002) 1009–1016. M.A. Baffi, G.R.L. de Souza, C.S. de Sousa, C.R. Ceron, A.M. Bonetti, Esterase enzymes involved in pyrethroid and organophosphate resistance in a Brazilian population of Rhipicephallus (Boophilus) microplus (Acari, Ixodidae), Mol. Biochem. Parasitol. 160 (2008) 70–73. L. Lovis, F.D. Guerrero, R.J. Miller, D.M. Bodine, B. Betschart, H. Sager, Distribution patterns of three sodium channel mutations associated with pyrethroid resistance in Rhipicephalus (Boophilus) microplus populations from North and South America, South Africa and Australia, Int. J. Parasitol. Drugs Drug Resist. 2 (2012) 216–224. M.A. Baffi, G.R.L. de Souza, C.U. Vieira, C.S.L.R. de Sousa, A.M. Gourlart, Identification of point mutations in a putative carboxylesterase and their association with acaricide resistance in Rhipicephalus (Boophilus) microplus (Acari: Ixodidae), Vet. Parasitol. 148 (2007) 301–309. G. Nagar, A.K. Sharma, G. Chigure, H.V. Manjunathachar, B.C. Saravanan, A. Rai, S. Ghosh, Identification of mutations in acetylcholinesterase 2 gene of acaricide resistant isolates of Rhipicephalus (Boophilus) microplus, Int. J. Sci. Env. Tech. 5 (2016) 3440–3447. R.D. Newcomb, P.M. Campbell, D.L. Ollis, E. Cheah, R.J. Russell, J.D. Oakeshott, A single amino acid substitution converts a carboxylesterase to an organophosphorus hydrolase and confers insecticide resistance on a blowfly, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 7464–7468. Y.C. Zhu, A.K. Dowdy, J.E. Baker, Differential mRNA expression levels and gene sequences of a putative carboxylesterase-like enzyme from two strains of the parasitoid Anisopteromalus calandrae (Hymenoptera: Pteromalidae), Insect Biochem. Mol. Biol. 29 (1999) 417–425.
