Characterization of 10 polymorphic microsatellite markers for ...

c Indian Academy of Sciences

ONLINE RESOURCES

Characterization of 10 polymorphic microsatellite markers for Mediterranean blue mussel Mytilus galloprovincialis by EST database mining and cross-species amplification HONGJUN LI1 , YU LIANG2 , LIJUN SUI3 , XIANGGANG GAO1 and CHONGBO HE1 ∗ 1

The Key Laboratory of Marine Fishery Molecular Biology of Liaoning Province, Liaoning Ocean and Fishery Science Institute, Dalian 116023, People’s Republic of China 2 College of Life Sciences and Biotechnology, Dalian Ocean University, Dalian 116023, People’s Republic of China 3 College of Life Sciences, Liaoning Normal University, Dalian 116029, People’s Republic of China [Li H., Liang Y., Sui L., Gao X. and He C. 2011 Characterization of 10 polymorphic microsatellite markers for Mediterranean blue mussel Mytilus galloprovincialis by EST database mining and cross-species amplification. J. Genet. 90, e30–e33. Online only: http://www.ias.ac.in/jgenet/OnlineResources/90/e30.pdf]

Introduction Mussels are economically and ecologically important marine mollusks in coastal areas of China, with the Mediterranean blue mussel Mytilus galloprovincialis being the dominant cultivated species in northern China, with a nation-wide production of about 0.23 million tons in 2004 (Yu and Li 2007). In addition, M. galloprovincialis has been used for environmental biomonitoring through the ‘mussel watch’ (Goldberg and Bertine 2000) and various programmes (Narbonne et al. 2005; Zorita et al. 2007). The popularity of this organism as a sentinel derives from several aspects, such as its wide distribution, sessile life and filter-feeding habit that can bioaccumulate contaminants from sea water. Therefore, M. galloprovincialis has been the focus of research in genetics, biochemistry, physiology and ecology (Gosling 1992). Despite its commercial importance, little information is available about the genetic diversity and population structure of M. galloprovincialis. The lack of sufficient polymorphic molecular markers has limited the development of molecular phylogeny, population genetic analysis and marker-assisted breeding in this species. Among the various currently available DNA markers that can be used to examine genetic diversity at the molecular level, the most informative and polymorphic are microsatellite DNA markers (Liu and Cordes 2004; Li et al. 2007), which consist of tandem DNA repeats of 2–6 base pairs (Weber and May 1989). They have been widely used for monitoring genetic variation of farmed stocks, parentage assignment, and fine-scale studies of population structure ∗ For correspondence. E-mail: [email protected].

(Geist and Kuehn 2005; Zhan et al. 2009; Gao et al. 2010). Despite their utility, few microsatellite markers have so far been published for mussels and only 17 microsatellite loci are reported for M. galloprovincialis (Presa et al. 2002; Varela et al. 2007; Yu and Li 2007). More polymorphic microsatellites are definitely required for further work such as genetic mapping and trait improvement studies. Traditionally, microsatellite markers are developed by cloning and sequencing enriched genomic libraries, a technique that is complicated and costly. Recently, large number of expressed sequence tags (EST) have become available for most aquaculture species, providing valuable resources for the development of microsatellite markers (Wang and Guo 2007; Li et al. 2011). Furthermore, many studies have shown that the flanking regions of microsatellite loci are often conserved among closely related species (Primmer et al. 1996). In the present study, we describe the identification and characterization of polymorphic microsatellite markers through mining M. galloprovincialis EST database and cross-species amplification.

Materials and methods Thirty individuals of M. galloprovincialis were collected from the Heishijiao seafood market (Dalian, Liaoning Province, People’s Republic of China). The adductors were dissected and frozen in −80◦ C. Total genomic DNA of each mussel was isolated with the traditional phenol–chloroform method and stored at −20◦ C. Expressed sequence tags of M. galloprovincialis obtained from GenBank (http://www.ncbi. nlm.nil.gov) database were analysed with the software MISA (MIcroSAtellite: http://pgrc.ipk-gatersleben.de/misa/) to

Keywords. microsatellite; EST-SSR; cross-species amplification; null allele; Mytilus galloprovincialis. Journal of Genetics, Vol. 90, No. 1, April 2011

e30

Microsatellites for Mediterranean blue mussel Table 1. Characteristics of microsatellite loci in M. galloproviancialis. Locus GenBank

Primer sequence

Sequence source

Ta Repeat (◦ C) motif

MGES1 FL500528 MGES4 FL498564 MGES11 FL495084 MGES27 AJ623869 Myco-E3 GQ888521 Med362 FJ174675 Med 379 FJ174677 Med733 FJ174680 Med737 FJ174681 Med744 FJ174683

F: AAGGAACATCGCTTCCGAC R: CTGATTACCAACAGCTTGACATT F: AGTCAGCAGTCGTCTGTTTCA R: TATTTAATGTTGTTATGGGTAATGG F: CATCCCCGTATGGACATCAAG R: ATCTGACACTGTGCAAATTGAGATC F: TCTAAGTAGACGTTGCCATCG R: GTTGTAAGTCGTGTTGGTTCA F: GGTCATTGTAGTGCAGTGGGTG R: ATGCAGTAGGCGGAGGTGC F:TTTATTGATTGCTTCTAACTATTGACG R:TGTTTATGGACTATGAAAATTAAAAGG F: TGAAGACCGCTATGTTTATAGCAA R: GCACGTTTTGGTGCTCATTA F: AAAGTGTGAATAAGCAGCGTGA R: TTTAAGCATGCAAAACCCTGT F: CGGCAAATGTGGTCAAAACT R: GGGTCGACCATTGATAGTATCTG F: TTTTTCATCGTGTTTTGGTTG R: CGCCATGGAATAGCCAATAG

M. galloproviancialis 60

(CAA)6 137–140 2 0.3929 0.3214 0.116


(CAA)8 97–109


(CAA)7 191–254 7 0.8333 0.8305 0.012


(TGA)6 245–263 3 0.2222 0.4920 0.003∗

M. coruscus

52

(CTC)6 240–258 3 0.1724 0.2777 0.059

M. edulis

55

(GT)8

113–151 8 0.5517 0.8457 0.001∗

M. edulis

56

(TG)9

154–244 8 0.7500 0.8644 0.007

M. edulis

56

(AG)14 182–216 6 0.2857 0.7571 0.002∗

M. edulis

52

(CA)14 153–191 4 0.6667 0.5910 0.043

M. edulis

51

(CA)28 220–296 6 0.6000 0.8107 0.017

Size (bp) A Ho

He

HWE P value

5 0.2857 0.6779 0.004∗

Ho , observed heterozygosity; He , expected heterozygosity; A, number of alleles; Ta , annealing temperature; HWE, Hardy–Weinberg equilibrium; *indicates significant departure from the equilibrium after Bonferroni correction (P < 0.005).

identify regions containing simple sequence repeats. For this study, the criteria for microsatellites were set as sequences having at least eight repeats in the case of di-repeats and five repeats for all other repeats (tri-, tetra-, penta- and hexanucleotide). To assess transferability, 14 previously reported genus Mytilus microsatellite markers (Myco-E3, Myco-E4, Myco-E6, Myco-E8 from Xu et al. (2010) and 10 from Lallias et al. (2009)) were tested on M. galloprovincialis. Polymerase chain reaction (PCR) amplification was performed in a thermal cycler (Applied Biosystems, USA). The reaction mixture contained approximately 20 ng of template DNA, 0.2 μM of each primer, 200 μM of each dNTP and 1 U rTaq (Takara, Japan) with 1× PCR buffer in a total volume of 20 μL. The PCR programme was as follows: one cycle of denaturation at 95◦ C for 5 min, followed by 35 cycles for 30 s at the annealing temperature of each primer pair (table 1) and 30 s at 72◦ C, and a final step at 72◦ C for 10 min. The amplified PCR products were separated on a 10% nondenaturing polyacrylamide gel at 300 V for 1.5 h, stained with ethidium bromide (EB) and visualized under ultraviolet light. Microsatellite data were tested for deviation from Hardy–Weinberg equilibrium (HWE) based on likelihood ratio tests for different locus-population combinations using POPGENE 32 (Yeh et al. 2000).

Results and discussion A search of the EST database at GenBank found 19707 ESTs for M. galloprovincialis. The screening of the 19707 ESTs using MISA identified 87 sequences that contained

at least eight di-repeats and five tri/tetra/penta/hexarepeats. PCR primers were designed for 29 microsatellite loci that had suitable flanking sequences. When tested in PCR with M. galloprovincialis DNA pool, seven primer pairs could amplify products with scorable bands. Out of the seven functional primer pairs, four revealed length polymorphisms for 30 individuals analysed. Cross-species amplification of 14 genus Mytilus microsatellite markers was carried out in M. galloprovincialis, and six primer pairs proved to be useful. Finally, a total of 10 microsatellite markers (table 1) have been developed for M. galloprovincialis through EST database mining and cross-species amplification. The 10 novel developed M. galloprovincialis microsatellite markers vary widely in their degree of polymorphism, with the number of alleles ranging from 2 to 8, with the average of 5.2 per locus (amplification result of locus MGES4 shown in figure 1). The locus Med362 and Med379 are the most polymorphic (A = 8), followed by four medium–high loci (MGES4, MGES11, Med733 and Med744, A ≥ 5) in terms of allele number and heterozygosity. Observed heterozygosity varies from to 0.1724 to 0.8333 with an average of 0.4761, while expected values range from 0.2777 to 0.8644 averaging 0.6468. Six loci accord statistically with HWE, while the other four (MGES4, MGES27, Med362 and Med733) show significant departure from the equilibrium after Bonferroni correction (P < 0.005), apparently due to heterozygote deficiency. Allozyme genetic studies of bivalves have often revealed significant deficiencies of heterozygotes relative to HWE and a number of explanations were proposed such as selection, Wahlund effect, inbreeding and null alleles (Gaffney

Journal of Genetics, Vol. 90, No. 1, April 2011

e31

Hongjun Li et al.

Figure 1. Amplification result of locus MGES4 in 27 individuals of M. galloprovincialis. Lane M, 100-bp DNA ladder, lanes 1–27, samples. PCR products were visualized by EB.

1994). The deviation from HWE observed in this study maybe caused by the characteristics of microsatellite markers, such as presence of null alleles, large allele ‘dropout’ artifacts in the PCR process, mixing resources of the sample or size homoplasy (Estoup et al. 2002). Of these, the existence of null alleles is regarded as the most likely cause, as it is widely observed in other molluscs including Pacific oyster (Hedgecock et al. 2004), bay scallop (Zhan et al. 2007) and Pacific abalone (Sekino et al. 2006). It is indicated that high frequency of null alleles in microsatellite is due to the extremely high level of polymorphism likely located in flanking regions to which PCR primers are designed to target. Further, evidences from genome sequencing and mass EST data analysis of mollusks in recent years clearly showed a frequency of one SNP every dozens to a hundred of base pairs (Sauvage et al. 2007; Qi et al. 2009; Li et al. 2010). Despite the existence of null alleles, the microsatellite markers developed in the current study would be useful for stock analysis and genetic studies of M. galloprovincialis, especially for a better understanding of the connectivity between M. galloprovincialis and M. edulis (Bierne et al. 2003). Acknowledgements This research was supported by grants from Commonweal Programme of State Oceanic Administration of China (no. 200805037), Programme of Liaoning Province Science and Technology Commission (no. 2008203002), Programme of National Natural Science Foundation of China (no. 30972246) and Programme of Liaoning Ocean and Fisheries Department (no. 200801).

References Bierne N., Borsa P., Daguin C., Jollivet D., Viard F., Bonhomme F. and David P. 2003 Introgression patterns in the mosaic hybrid zone between Mytilus edulis and M. galloprovincialis. Mol. Ecol. 12, 447–461. Estoup A., Jarne P. and Cornuet J. M. 2002 Homoplasy and mutation model at microsatellite loci and their consequences for population genetics analysis. Mol. Ecol. 11, 1591–1604. Gaffney P. M. 1994 Heterosis and heterozygote deficiencies in marine bivalves: more light? In Genetics and evolution of aquatic organisms (ed. A. R. Beaumont), pp. 146–153. Chapman and Hall, London, UK. Gao X. G., Li H. J., Li Y. F., Sui L. J., Zhu B., Liang Y. et al. 2010 Sixteen polymorphic simple sequence repeat markers from expressed sequence tags of the Chinese Mitten Crab Eriocheir sinensis. Int. J. Mol. Sci. 11, 3035–3038.

Geist J. and Kuehn R. 2005 Genetic diversity and differentiation of central European freshwater pearl mussel (Margaritifera margaritifera L.) populations: implications for conservation and management. Mol. Ecol. 14, 425–439. Goldberg E. D. and Bertine K. K. 2000 Beyond the Mussel Watch– new directions for monitoring marine pollution. Sci. Total Environ. 247, 165–174. Gosling E. M. 1992 The mussel Mytilus: ecology, physiology, genetics, and culture. Elsevier, Amsterdam, The Netherlands. Hedgecock D., Li G., Hubert S., Bucklin K. and Ribes V. 2004 Widespread null alleles and poor cross-species amplification of microsatellite DNA loci cloned from the Pacific oyster, Crassostrea gigas. J. Shellfish Res. 23, 379–385. Lallias D., Stockdale R., Boudry P., Lapegue S. and Beaumont A. R. 2009 Characterization of ten microsatellite loci in the blue mussel Mytilus edulis. J. Shellfish Res. 28, 547–551. Li H. J., Liu X., Hu J. J., Bao Z. M. and Zhang G. F. 2007 A set of polymorphic microsatellite loci for the bay scallop, Argopecten irradians. Mol. Ecol. Notes 7, 422–424. Li H. J., Zhu D., Gao X. G., Li Y. F., Wang J. and He C. B. 2010 Mining single nucleotide polymorphisms from EST data of hard clam Meretrix meretrix. Conserv. Genet. Res. 2, 69–72. Li H. J., Liu W. D., Gao X. G., Zhu D., Wang J., Li F. Y. and He C. B. 2011 Identification of host-defense genes and development of microsatellite markers from ESTs of hard clam Meretrix meretrix. Mol. Biol. Rep. 38, 769–775. Liu Z. J. and Cordes J. F. 2004 DNA marker technologies and their applications in aquaculture genetics. Aquaculture 238, 1–37. Narbonne J. F., Aarab N., Clerandeau C., Daubeze M., Narbonne J., Champeau O. and Garrigues P. 2005 Scale of classification based on biochemical markers in mussels: application to pollution monitoring in Mediterranean coasts and temporal trends. Biomarkers 10, 58–71. Presa P., Perez M. and Diz A. P. 2002 Polymorphic microsatellite markers for blue mussels (Mytilus spp.). Conserv. Genet. 3, 441– 443. Primmer C. R., Møller A. P. and Ellegren H. 1996 A wide-range survey of cross-species microsatellite amplification in birds. Mol. Ecol. 5, 365–378. Qi H. G., Liu X., Zhang G. F. and Wu F. C. 2009 Mining expressed sequences for single nucleotide polymorphisms in Pacific abalone Haliotis discus hannai. Aqua Res. 40, 1661– 1667. Sauvage C., Bierne N., Lapègue S. and Boudry P. 2007 Single nucleotide polymorphisms and their relationship to codon usage bias in the Pacific oyster Crassostrea gigas. Gene 406, 13–22. Sekino M., Kobayashi T. and Hara M. 2006 Segregation and linkage analysis of 75 novel microsatellite DNA markers in pair crosses of Japanese abalone (Haliotis discus hannai) using the 5 -tailed primer method. Mar. Biotechnol. 8, 453–466. Varela M. A., González-Tizón A., Mariñas L. and Martínez-Lage A. 2007 Genetic divergence detected by ISSR markers and characterization of microsatellite regions in Mytilus mussels. Biochem. Genet. 45, 565–578.


e32

Microsatellites for Mediterranean blue mussel Wang Y. P. and Guo X. M. 2007 Development and characterization of EST-SSR markers in the eastern oyster Crassostrea virginica. Mar. Biotechnol. 9, 500–511. Weber J. L. and May P. E. 1989 Abundant class of human DNA polymorphisms which can be typed using the polymerase chainreaction. Am. J. Hum. Genet. 44, 388–396. Xu T. J., Sun Y. N., Yuan Y. T., Liao Z. and Wang R. X. 2010 Isolation and characterization of polymorphic microsatellite loci in the hard-shelled mussel, Mytilus coruscus (Mytilidae). Genet. Mol. Res. 9, 1388–1391. Yeh F. C., Yang R., Boyle T. J., Ye Z. and Xiyan J. M. 2000 POPGENE 32, Microsoft Windows-based freeware for population genetic analysis. Molecular Biology and Biotechnology Centre. University of Alberta, Edmonton. Free program distributed by the authors over the internet from: http://www.ualberta.ca/∼fyeh.

Yu H. and Li Q. 2007 Development of EST-SSRs in the Mediterranean blue mussel, Mytilus galloprovincialis. Mol. Ecol. Notes 7, 1308–1310. Zhan A. B., Bao Z. M., Hui M., Wang M. L., Zhao H. B., Lu W. et al. 2007 Inheritance pattern of EST-SSRs in self-fertilized larvae of the bay scallop Argopecten irradians. Ann. Zoo. Fennici 44, 259–268. Zhan A. B., Hu J. J., Hu X. L., Zhou Z. C., Hui M., Wang S. et al. 2009 Fine-scale population genetic structure of Zhikong scallop (Chlamys farreri): do local marine currents drive geographical differentiation? Mar. Biotechnol. 11, 223–235. Zorita I., Apraiz I., Ortiz-Zarragoitia M., Orbea A., Cancio I., Soto M. et al. 2007 Assessment of biological effects of environmental pollution along the NW Mediterranean Sea using mussels as sentinel organisms. Environ. Pollut. 148, 236–250.

Received 13 September 2010, in final revised form 18 November 2010; accepted 30 November 2010 Published on the Web: 19 May 2011


e33