Journal of Clinical Neuroscience 23 (2016) 120–122
Contents lists available at ScienceDirect
Journal of Clinical Neuroscience journal homepage: www.elsevier.com/locate/jocn
Clinical Study
Characterization of anaplastic lymphoma kinase-positive medulloblastomas Benedict Yan a,⇑, Chik Hong Kuick b, Malcolm Lim b, Min Hwee Yong b, Chi Kuen Lee c, Sharon Y.Y. Low d, David C.Y. Low e, Diana Lim c, Shui Yen Soh f, Kenneth T.E. Chang b a Department of Laboratory Medicine, Molecular Diagnosis Centre, National University Hospital, National University Health System, 5 Lower Kent Ridge Road, Singapore 119074, Singapore b Department of Pathology and Laboratory Medicine, KK Women’s and Children’s Hospital, Singapore c Department of Pathology, National University Hospital, National University Health System, Singapore d Department of Neurosurgery, National Neuroscience Institute, Singapore e Neurosurgical Services, KK Women’s and Children’s Hospital, Singapore f Haematology/Oncology Service, Department of Paediatric Subspecialties, KK Women’s and Children’s Hospital, Singapore
a r t i c l e
i n f o
Article history: Received 23 August 2015 Accepted 29 August 2015
Keywords: ALK Immunohistochemistry Medulloblastoma Tyrosine kinase
a b s t r a c t Medulloblastomas are the most common pediatric malignant primary brain tumor. To our knowledge, there are no known critical and druggable tyrosine kinases in medulloblastomas, precluding the use of established tyrosine kinase inhibitors that have shown efficacy in other tumor types. We studied the expression of anaplastic lymphoma kinase (ALK), a well-characterized tyrosine kinase and drug target, in a cohort of medulloblastomas by immunohistochemistry, and identified three ALK-positive cases. Mutational analyses did not reveal a definite underlying genetic mechanism for the ALK expression, although one of the cases showed increased ALK copy number. Our findings have clinical implications and warrant further pharmacological and functional studies, as well as evaluation in larger patient cohorts, to fully characterize the value of ALK as a prognostic and predictive therapeutic marker in medulloblastomas. Ó 2015 Elsevier Ltd. All rights reserved.
1. Introduction Medulloblastomas are the most common pediatric malignant primary brain tumor [1]. To our knowledge, there are no known critical and druggable tyrosine kinases in medulloblastomas, precluding the use of established tyrosine kinase inhibitors that have shown efficacy in other tumor types. Anaplastic lymphoma kinase (ALK) is an established oncogenic driver and therapeutic target in several tumors including lung carcinomas [2] and neuroblastomas [3]. ALK is known to be expressed in the central nervous system [4,5], and ALK rearrangements have been identified in ependymoma-like gliomas [6]. ALK gene expression has previously been reported in medulloblastomas, with three of 16 cases showing ALK overexpression relative to normal cerebellar tissue [7]. However, clinical information of the ALKoverexpressing patients, and elucidation of the mechanism of ALK overexpression, was not provided. In this study, we sought to identify ALK-positive medulloblastomas using immunohistochemistry, ⇑ Corresponding author. Tel.: +65 6772 2360. E-mail address:
[email protected] (B. Yan). http://dx.doi.org/10.1016/j.jocn.2015.08.017 0967-5868/Ó 2015 Elsevier Ltd. All rights reserved.
and to further understand the mechanism of ALK expression. We also characterized the clinicopathological profile of the ALKpositive medulloblastoma patients. 2. Materials and methods 2.1. Study population and clinicopathological data A total of 37 medulloblastoma formalin-fixed, paraffinembedded (FFPE) samples (34 primary and three recurrent) from 34 patients were identified from the archives of the Department of Pathology and Laboratory Medicine, KK Women’s and Children’s Hospital, Singapore. Clinicopathological data including demographics, staging, histology, treatment and outcome was extracted. Ethics approval was obtained from the SingHealth Centralized Institutional Review Board (ref: 2014/450/B). 2.2. Tissue microarray construction Thirty-one samples were analyzed using a tissue microarray construction platform. One tissue core (1.0 mm diameter) was
121
Mixed (WNT/SHH) Non-amplified M0 Posterior fossa – fourth ventricle 0.5 years 12.8 years Female Classic medulloblastoma 242014
* Modified Chang Staging [12]. ALK = anaplastic lymphoma kinase, MYCN = V-Myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog, SHH = sonic hedgehog.
SHH Non-amplified
Disease recurrence at 3 months; underwent repeat resection, systemic chemotherapy and high dose therapy. In second remission Alive without disease M0 Right cerebellar hemisphere 1.3 years 1.8 years Male
Gross total resection; craniospinal irradiation; ongoing systemic chemotherapy
WNT Non-amplified Alive without disease
Gross total resection; craniospinal irradiation; systemic chemotherapy Gross total resection; declined adjuvant treatment M0
Classic medulloblastoma
ALK hotspot mutational analysis was performed as previously described [9]. In brief, DNA was extracted from FFPE samples using ReliaPrep gDNA FFPE kit (Promega, Madison, WI, USA). Polymerase chain reaction (PCR) amplification of ALK exons 23 (containing the p.F1174 hotspot) and 25 (containing the p.R1275 hotspot) was performed using the following primers: exon 23 forward primer – AAGATTTGCCCAGACTCAGC, exon 23 reverse primer – TGTCCTTG GCACAACAACTG; exon 25 forward primer – TAGTGATGGCCGTTGT ACAC, exon 25 reverse primer – CCAGGAGATGATGTAAGGGA. The
97114
2.4. ALK hotspot mutational analysis
Classic medulloblastoma
ALK immunohistochemistry was performed using the D5F3 antibody (Cell Signaling Technology, Danvers, MA, USA) at 1:100 dilution on the Ventana BenchMark ULTRA (Ventana Medical Systems, Tucson, AZ, USA) using the antigen retrieval protocol of CC1 solution (Ventana Medical Systems) for 64 minutes. Immunohistochemical score was evaluated by the percentage of positive cells as follows: 25% to 50% gave a score of 2+; and >50% gave a score of 3+. Medulloblastoma immunohistochemical subtyping was performed using the GAB1 (ab59362; Abcam, Cambridge, UK) and bcatenin (clone 14; Ventana Medical Systems) antibodies and Ventana BenchMark ULTRA (GAB1 dilution – 1:100; antigen retrieval protocol – CC1 solution for 64 minutes; b-catenin dilution – ready to use; antigen retrieval protocol – CC1 solution for 52 minutes), as previously described [8].
Table 2 Clinicopathological features of ALK 3+ positive medulloblastoma patients
2.3. Immunohistochemistry
Posterior fossa – fourth ventricle
Site of primary tumor
Stage*
punched from a representative tumor area from the donor tissue blocks and deposited into a recipient block using a manual tissue-arraying instrument (Beecher Instruments, Sun Prairie, WI, USA).
12.5 years
ALK = anaplastic lymphoma kinase.
112702
2 1
Duration of follow-up
3+
1 0
Age at diagnosis
2+
3 0
Sex
1+
28 2
Histological diagnosis
0
Primary Recurrent
Case number
ALK D5F3 expression
Treatment
Table 1 ALK D5F3 expression profile in 37 medulloblastoma samples by immunohistochemistry
5.5 years
Fig. 1. Anaplastic lymphoma kinase (ALK) immunohistochemical expression in medulloblastoma (original magnification 600).
Female
Subtype MYCN status Current status
B. Yan et al. / Journal of Clinical Neuroscience 23 (2016) 120–122
122
B. Yan et al. / Journal of Clinical Neuroscience 23 (2016) 120–122
PCR product was analyzed by routine sequencing using the ABI 3730xl DNA sequencer (Applied Biosystems, Foster City, CA, USA).
and pharmacological studies, as well as evaluation in larger patient cohorts, will be necessary to fully characterize the value of ALK as a prognostic and predictive therapeutic marker in medulloblastomas.
2.5. MYCN and ALK fluorescence in situ hybridization Conflicts of Interest/Disclosures MYCN fluorescence in situ hybridization (FISH) was performed as previously described [10]. For ALK FISH, 4 micron thick sections were treated using the Vysis paraffin pre-treatment IV system (Vysis, Downers Grove, IL, USA). The cells and probes were codenatured at 73°C for 5 minutes and incubated at 37°C using the Thermobrite denaturation/hybridization system (Vysis). Fifty nuclei were scored. A split signal, indicating ALK rearrangement, was defined as the space between two signals being greater than two signal widths. A positive result was defined as more than 15% of the cells possessing split signals. FISH images were obtained using an Olympus BX61 microscope and captured on the Applied Image Analysis System v.3.93 (Applied Imaging, Grand Rapids, MI, USA). 3. Results We identified three ALK 3+-positive medulloblastomas (Fig. 1), comprising two primary tumors and one recurrent tumor. Table 1 shows the expression profile across all the 37 samples. As we had previously observed a positive correlation between ALK expression status and ALK hotspot mutational status and MYCN amplification status [9], we evaluated and did not identify any ALK hotspot mutations or MYCN amplification in these three samples. By FISH analysis, we did not identify any ALK rearrangements. One of the samples (case number 97114) showed lowlevel ALK copy number increase (average copy number/nucleus 3.5) (Supp. Fig. 1). To further understand the clinical implications of ALK-positivity in medulloblastomas, the clinical and pathological features of the ALK 3+-positive medulloblastoma patients were extracted (Table 2). 4. Discussion The identification of ALK expression in medulloblastomas is a novel observation and of potential clinical significance as it is an established therapeutic target in other tumor types. In neuroblastomas, ALK protein expression correlates with a poorer prognosis [11]. We note that one of our ALK-positive patients (case number 97114) with low-level ALK copy number gain had disease recurrence at 3 months after gross total resection. Further functional
The authors declare that they have no financial or other conflicts of interest in relation to this research and its publication. Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jocn.2015.08.017. References [1] Gajjar AJ, Robinson GW. Medulloblastoma-translating discoveries from the bench to the bedside. Nat Rev Clin Oncol 2014;11:714–22. [2] Solomon BJ, Mok T, Kim DW, et al. First-line crizotinib versus chemotherapy in ALK-positive lung cancer. New Eng J Med 2014;371:2167–77. [3] Mosse YP, Lim MS, Voss SD, et al. Safety and activity of crizotinib for paediatric patients with refractory solid tumours or anaplastic large-cell lymphoma: a Children’s Oncology Group phase 1 consortium study. Lancet Oncol 2013;14:472–80. [4] Iwahara T, Fujimoto J, Wen D, et al. Molecular characterization of ALK, a receptor tyrosine kinase expressed specifically in the nervous system. Oncogene 1997;14:439–49. [5] Morris SW, Kirstein MN, Valentine MB, et al. Fusion of a kinase gene, ALK, to a nucleolar protein gene, NPM, in non-Hodgkin’s lymphoma. Science 1995;267:316–7. [6] Olsen TK, Panagopoulos I, Meling TR, et al. Fusion genes with ALK as recurrent partner in ependymoma-like gliomas: a new brain tumor entity? Neuro Oncol 2015;17:1365–73. [7] Coco S, De Mariano M, Valdora F, et al. Identification of ALK germline mutation (3605delG) in pediatric anaplastic medulloblastoma. J Hum Genet 2012;57:682–4. [8] Ellison DW, Dalton J, Kocak M, et al. Medulloblastoma: clinicopathological correlates of SHH, WNT, and non-SHH/WNT molecular subgroups. Acta Neuropathol 2011;121:381–96. [9] Yan B, Kuick CH, Lim M, et al. Platform comparison for evaluation of ALK protein immunohistochemical expression, genomic copy number and hotspot mutation status in neuroblastomas. PLoS ONE 2014;9:e106575. [10] Yong MH, Hwang WS, Knight LA, et al. Comparing histopathological classification with MYCN, 1p36 and 17q status detected by fluorescence in situ hybridisation from 14 untreated primary neuroblastomas in Singapore. Singapore Med J 2009;50:1090–4. [11] Duijkers FA, Gaal J, Meijerink JP, et al. High anaplastic lymphoma kinase immunohistochemical staining in neuroblastoma and ganglioneuroblastoma is an independent predictor of poor outcome. Am J Pathol 2012;180:1223–31. [12] Chang CH, Housepian EM, Herbert Jr C. An operative staging system and a megavoltage radiotherapeutic technic for cerebellar medulloblastomas. Radiology 1969;93:1351–9.
