Characterization of deletion mutants of the catalytic subunit of protein ...

THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 269,No. 19,Issue of May 13,pp. 13766-13770, 1994 Printed in U.S.A.

Characterization of Deletion Mutants of the Catalytic Subunitof Protein Phosphatase-I* (Received for publication, December 2, 1993, and in revised form, February 7, 1994)

Zhongjian Zhang, Sumin Zhao, Ge Bai, and Ernest Y. C. Lee$ From the Department of Biochemistry and Molecular Biology, University of Miami School of Medicine, Miami, Florida 33101

Deletion mutagenesis wasused to define the core re- plex,known as t h e ATP/Mg-dependentPPase-1 (12), a n d a gion of the catalytic subunit of rabbit muscle protein glycogen-bound enzyme form (11). phosphatase-1. Deletionsin the N terminus were found The existence of cellular inhibitors of protein phosphatase-1 to lead to loss of expression. Deletions of up to 33 resi- that were heat-stable proteins was first reported in rabbit liver dues from the C-terminal region were tolerated, and the (13). Later it was shown in muscle that there are two heattruncated enzymes were fully active. Deletion of an ad- stable proteins which inhibit PPase-1 (14): inhibitor-1 and inditional 21 residues led to loss of expression. Mutants hibitor-2 (7,8). The role of inhibitor-2 became significant when which had had 33 and 25 residues deleted maintained it was identified as the regulatory subunit of an inactive cytospecific activities that were comparableto those of the solic form of protein phosphatase, the ATPMg-dependent phoswild type enzyme. The response of these two deletion phatase (12). This consists of a 1:l complex of PPase-1 and mutants to okadaic acid, microcystin, and inhibitor-2 was determined. Only slightly lower IC,, values were inhibitor-2. In this complex inhibitor-2 serves as a regulator is observed in all cases, showing thatthe C terminus itself protein that functions as an activator of the complex when it does not play major a role in the binding of these inhibi- phosphorylated by glycogen synthase kinase-3. In addition to these protein inhibitors, several toxins that are potent inhibitors. The deletion mutantsformedstablecomplexes with inhibitor-2as shown by gel filtration. Thesestudies tors of PPase-1 (and PPase-2A) have been described. Okadaic provide unambiguous evidence that the extreme C-ter- acid, a fatty acid polyketide, which is a toxin produced by a minal region of protein phosphatase-1 is not directly marine dinoflagellate and accumulatesin certain sponges and a powerfulinhibitor of involved in catalytic functionor in the bindingof inhibi- shellfish,wasdemonstratedtobe tor-2, microcystin, or okadaic acid, and they also estab- PPase-1 and PPase-2A (15). Okadaic acid inhibits PPase-2A than it inhibits PPase-l(15) and lish that the first-300 residues of the sequence consti- about 100 times more strongly has become a useful tool for the study of t h e i nvivo functions of tute a sufficient core for protein phosphatase-1 catalytic functions. PPase-2A (7, 8). Two other structurally unrelated toxins have The catalytic subunit of protein phosphatase-1 (PPase-1)' was first isolated from rabbit liver (1, 2) has andbeen purified from rabbit skeletal muscle (1, 3, 41, as well as a number of other eukaryotic sources(for review, see Refs. 5-8). Afeature of a step forthe dissociation the original isolation procedures was of larger molecular forms of the enzyme to a species with M , 35,000 (1). The purification and characterizationof this enzyme form wasa key step in understanding the enzymology of phosphorylase phosphatase (5, 6). Later work showed the 35kDa form was derived froma 37-kDa precursor by proteolysis a cleavage from t h e C during purification; this appeared to be terminus, since all forms of the enzyme exhibit a blocked N terminus (3,9).The original hypothesis (5,101 that this enzyme is the catalytic subunit of a larger holoenzyme is now well established and reflects a complex system in which there a r e severaldistinctholoenzymeformsbasedontheparticular regulatory subunit involved (7, 8, 11).Two of these forms that have been well characterized are the PPase-14nhibitor-2com-

-

been identified as phosphatase inhibitors. These are calyculin (16) a n d microcystin-LR, a cyclic heptapeptide (17, 18). These twoinhibitors inhibit both PPase-1 a n d -2A withsimilar potencies. rabbit muscle PPase-l(19) and We have cloned the cDNAfor have expressed recombinant PPase-1 as a soluble protein in Escherichia coli (20, 21). In this work we have used deletion mutagenesis to examine the effects of truncation of the enzyme in order to define the limitsof the catalytic core and to determine the effects of truncation on the binding of the various inhibitors of PPase-1.

EXPERIMENTALPROCEDURES Materials-The cDNAclone (19) corresponds tothe PPase-la isoform of PPase-1 (22). The expression vector used was the pTACTAC vector (20, 21). DEAF,-Sepharose Fast Flow, heparin-Sepharose CLGB, Sephacryl S-200, Blue-Sepharose,and Q-Sepharosewere obtained from Pharmacia LKB BiotechnologyInc.Polylysine-agarose was obtained from Sigma. Okadaic acid was purchased from Kamiya Corp. and microcystin-LR from Calbiochem.Inhibitor-2 was the recombinant rabbit muscle protein expressed in E. coli as described by Zhang et al. (23). PPase-la used in these studies was the purified recombinant protein (201. * This work was supported by National Institutes of Health Grant Protein Determinations-These were performed by the method of DK18512. The costs of publication of this article were defrayed in part Bradford (24) using bovine serum albumin as a standard. by the payment of page charges. This article must therefore be hereby SDS-PAGE-Electrophoresis in the presence of SDS was performed marked "aduertzsement" in accordance with 18 U.S.C. Section1734 as described by Laemmli (25). solely to indicate this fact. Protein Phosphatase-I Assays-Assaysfor protein phosphatase-1 $. To whom correspondence shouldbe addressed: Dept. of Biochemistry andMolecular Biology (R-6291,University of Miami School of Medi- were performed using 32P-labeledphosphorylase a as a substrate (20, cine, P. 0. Box 016129, Miami, FL 33101. Tel.: 305-547-6242; Fax: 305- 21). Enzymedilutions were made into buffers containing 1mM Mn2+and assayed in the presence of 0.1 mM Mn2+(20). Inhibition assays with 547-3955. The abbreviations used are: PPase-1, catalytic subunit of protein inhibitor-2, microcystin, and okadaic acid were performedas described phosphatase-1; PAGE, polyacrylamide gelelectrophoresis;PCR, polym- previously (20, 21). Construction of Deletion Mutants of PPase-1 inthepTACTAC erase chain reaction.

13766

Deletion Mutants ofPhosphatase-1 Protein

13767

Vector-Deletion mutants of PPase-1 were constructed using a PCR method, essentially a s described for the insertion of the PPase-lacoding sequence into the pTACTAC vector (20, 21). The N-terminal deletions were those in which15 and 60 base pairs that coded for 5 and 20 amino acid residues were removed from the 5' end of the coding sequence. An engineered NdeI site followed by an initiating Met codon was inserted at thebeginning of the 5' end of the deletion primer. For the second strand at the 3' end, the primer TTCAGAATCCAGCTTGACC was used; this corresponded to the complement of the last 19 nucleotides of the PPase-1cDNA clone (20). These two constructs represented mutants in which the N terminus was truncated by 4 and 19 19 residues, respectively, since the initiating Metcodon was restored. For the C-terminal deletions, the same 5' primer was used as for the inser100 2M 3M tion of the PPase-la cDNA (20), together with 3' primers with a n in2 6 1 R Q L V T L F k A P N Y C G E F J I ) N A G 280 serted stop codon. C-terminal deletion mutants were constructed as 2 8 l A M X S V D E T L M C S F O I L K + P A D 300 follows: 75 base pairs that code for 25 aminoacid residues were deleted 3 0 1 K N K G ~ Y G O i S G L N P G G R P I T 320 in Del-305; 99 base pairs that code for 33 amino acid residues were 3 2 ? ? ? ? . S S A K A K K 337 deleted in Del-297; 162 base pairs coding for 54 amino acid residues FIG.1.Deletion mutantsof PPase-1. The diagram showsa linear were deleted in Del-276; 189 base pairs coding for 63 amino acid resi- depiction of the PPase-la sequence (19) drawn to scale. Deletion mudues were deleted inDel-267; and 351 base pairscoding for 117 amino tants were constructed a s described under "ExperimentalProcedures." acid residues in Del-213. The primers for the 3' ends of the five C- The pointsof deletion at residues 267,276,297, and 305 are shown by terminal deletions were a s follows: Del-305, GCGCCACTTGCCCTT- arrows. (Black bars show those constructs for which active proteins GTTCTTGTCT; Del-297, GCGCCTACTTAAGGATCTGGAAGGAGC; were isolated.) Del-276, GTTCTAGAACTCGCCACAGTAGVGG; Del-267, GGCmA GAAAAGTGTCACCAGCTGC; Del-213, GCGCEACACGTCCTTGTCGGGGTC (underlined residues show the position of the stop codons). The PPase-1 cDNA was used as the target template, and the PCR conditions used were 94 "C, 1 mid50 "C, 2 mid72 "C, 3 min for 25 cycles. The PCR fragments were first subcloned by blunt end ligation into the pGEM7z vector, whichhadbeendigestedwithSmaIand treatedwithalkalinephosphatase.Thefidelity of theinsertedsequences was confirmed by DNA sequencing. The cloned cDNAs were then excised from the pGEM7z vector by digestion with NdeI and HindIII (the HindIII site is a unique site in the polylinker region of the pGEM7z vector, downstream from the SmaI site intowhich the cDNA was inserted). TheDNA fragments with a NdeI site at the Met codon and that contained the coding sequences were then ligated into the pTACTAC vector, which had been previously digested with NdeI and HindIII and purified by agarose gel electrophoresis. The constructs were then used to transformE. coli DH5a-competent cells. Purification ofDeletion Mutants-Del-305 and Del-297 were found to be expressed at levels comparable to those observed forPPase-la (20) and were purified as described previously for the isoforms of PPase-1 (21). Lysates of all other mutants were found to be devoid of activity; purification through inhibitor-2-Sepharose (23) also failed to yield detectable amountsof protein by SDS-PAGE. Formation of the PPase-1 .Inhibitor-2 Complex-Formation of the FIG. 2. SDS-PAGE of purified deletion m u t a n t s ofPPase-1. Lane complex was performed by mixture of purified PPase-1 (0.1-0.2 mg) with with a 5-fold molar excess of recombinant inhibitor-2, followed by S, protein standards (phosphorylase, bovine serum albumin, ovalbumin, carbonic anhydrase); lane I , PPase-la; lane 2, Del-297; lane 3, incubation at 30 "C for 1 h. The mixture was then passed through Del-305. The estimatedmolecular masses of PPase-1, Del-297, and DelBlue-Sepharose(26); the complex was not bound, whereas the free 305 were 37, 33, and 34 kDa, respectively. catalytic subunit and inhibitor-2 were retained. RESULTS

Del-297 and Del-305. Attempts to determine if any protein was Deletion mutants of PPase-la were constructed in which expressed for the other deletions were made by affinity chroportions of the N and C termini were deleted in order to gain matography on inhibitor-2 Sepharose (23); loading of 100 ml of information on their roles in maintaining the structure and lysate from 1liter of cell culture for either Del-276 and Del-213 activity of PPase-1 (Fig. 1).The N-terminal mutants, which failed to lead to isolation of proteins with the appropriate sizes were truncated by 4 and 19 amino acid residues, respectively, in the 1M NaCl eluates as determined by SDS-PAGE. displayed no activity in E. coli lysates. Attempts to demonstrate Deletions 297 and 305 were purified to near-homogeneity, and the SDS-PAGE of the purified preparations are shown in the presence of PPase-1 protein by immunoblotting revealed the presence of only small amountsof immunoreactive protein. Fig. 2. The specific activities of Del-297 and Del-305 were found Attempts to demonstrate presence the of the inactive proteinby to be 9% and 61%, respectively, of that for PPase-la in one set its isolation using immunoaffnity chromatography on inhibi- of preparations thatwere compared. Both Del-297 and Del-305 were dependent on Mn2+for their activities (Fig. 31, similar to tor-2-Sepharose (23) were unsuccessful. In the case of the C-terminal mutants, the first two were the full-length recombinant enzyme (20). The sensitivity of the chosen to mimic the tryptic cleavage of PPase-la. Thus, trun- two mutants to inhibition by inhibitor-2 was compared to that cations up to lysine residues 297 and 305 were made so as to of recombinant PPase-la! (Fig. 4). Both were inhibited by inyield proteins of estimated sizes of 33-34 kDa. This is similar tohibitor-2, with similar IC,, values that were slightly higher the size of the catalytic subunit after exposure to trypsin, as (-2-fold) than thatof the full-length enzyme (Fig. 4). The IC,, has been shown both for the wild type (27) and recombinant for PPase-la was similar to that which we have previously determined (-1 nM, Ref. 20) and is comparable with those proteins (28). The next three mutants represented those in which 54, 63, and 117 residues were removed (Fig. 1).It was reported in the literature for native PPase-1 andinhibitor-2 (7, found that PPase-1 activity was present only in lysates for 8).The ability of the deletion mutants toform stable complexes

Deletion Mutants ofPhosphatase-1 Protein

13768

I

7

-

9

c

0 10 20 30 40 50 60 70 80 90 100 Elution Volume (ml) 20

0

40

60

80

IO0

Mnf+ [uM1

FIG.3. M n z + dependence of PPase-1 deletion mutants. PPase-1 preparations were diluted in buffers in the absence of Mn2+and assayed in the presence of the indicated Mn2+concentrations by the addition of MnCl,.

1

10

loo

1000

FIG. 5. Gel filtration of PPase-1-inhibitor-2complexes. Complexes of PPase-la, Del-305, and Del-297 with inhibitor-2 were prepared as described under “Experimental Procedures” and chromatographed on a column of Sephacryl S-200 (1.5 x 60 cm). Fractions were assayed for PPase-1 activity after treatment with trypsin (29). Also shown is the elution of the inhibitor-2 activity (7)in the case of the PPase-la-inhibitor-2 complex (assays show the inhibition of PPase-1 activity after addition of a sample of the fraction after heating to 100 “C for 5 min).

10000

Inhibitor-2 (nglml) FIG.4. Inhibition of C-terminaldeletion mutants of PPase-1 by recombinant inhibitor-2.Assays of PPase-la and Del-297 and Del305 were performed as described under “Experimental Procedures” after preincubation with the indicated concentrations of recombinant inhibitor-2 (23).

with inhibitor-2 was demonstrated by gel filtration when the enzyme activity (assayed after trypsintreatment) was found to be eluted with retention volumes similar to that of the native complex (Fig. 5 ) . Calibration of the column with appropriate standards showed that the apparent molecular weight of the complex was 108,000. This behavior can be largely attributed t o the presence of inhibitor-2, which is known to behave anomalously on gel filtration (reviewed in Refs. 7,8, and 11).The sizes of the truncations made in PPase-l(