Characterization of Evolutionarily Conserved Motifs Involved in Activity

Molecular Plant • Volume 7 • Number 2 • Pages 422–436 • February 2014

RESEARCH ARTICLE

Characterization of Evolutionarily Conserved Motifs Involved in Activity and Regulation of the ABA-INSENSITIVE (ABI) 4 Transcription Factor Josefat Gregorio, Alma Fabiola Hernández-Bernal, Elizabeth Cordoba, and Patricia León1 Departamento de Biología Molecular de Plantas, Instituto de Biotecnología, Universidad Nacional Autónoma de México, Av. Universidad # 2001, Col. Chamilpa, Cuernavaca, Morelos, C.p. 62210, Mexico

ABSTRACT In recent years, the transcription factor ABI4 has emerged as an important node of integration for external and internal signals such as nutrient status and hormone signaling that modulates critical transitions during the growth and development of plants. For this reason, understanding the mechanism of action and regulation of this protein represents an important step towards the elucidation of crosstalk mechanisms in plants. However, this understanding has been hindered due to the negligible levels of this protein as a result of multiple posttranscriptional regulations. To better understand the function and regulation of the ABI4 protein in this work, we performed a functional analysis of several evolutionarily conserved motifs. Based on these conserved motifs, we identified ortholog genes of ABI4 in different plant species. The functionality of the putative ortholog from Theobroma cacao was demonstrated in transient expression assays and in complementation studies in plants. The function of the highly conserved motifs was analyzed after their deletion or mutagenesis in the Arabidopsis ABI4 sequence using mesophyll protoplasts. This approach permitted us to immunologically detect the ABI4 protein and identify some of the mechanisms involved in its regulation. We identified sequences required for the nuclear localization (AP2-associated motif) as well as those for transcriptional activation function (LRP motif). Moreover, this approach showed that the protein stability of this transcription factor is controlled through protein degradation and subcellular localization and involves the AP2-associated and the PEST motifs. We demonstrated that the degradation of ABI4 protein through the PEST motif is mediated by the 26S proteasome in response to changes in the sugar levels. Key words: ABI4; posttranslational regulation; transcription factor; sugar signaling; abscisic acid-insensitive; proteasome; nuclear localization signals.

Introduction Survival of sessile organisms like plants depends on their capacity for rapid adjustment to changes in environmental conditions. These responses rely on efficient signal transduction networks that permit concerted responses as a result of interconnected signaling pathways. Transcription factors play a pivotal role in these responses by the altering gene expression of target genes via specific binding to cis-acting elements in target gene promoters. The Abscisic Acid-Insensitive 4 (ABI4) transcription factor plays a central role in plant development. Although ABI4 was initially identified as an important factor for ABA responses (Finkelstein et al., 1998, 2002), in the past decade, ABI4 has emerged as a central player in many processes during plant life. ABI4 is required for proper ABA signaling during seed development and germination. Mutations in this gene result in seedlings that are highly resistant to exogenous ABA during

germination (Finkelstein et al., 1998). ABI4 is also essential for sugar signaling responses during seedling establishment (Arenas-Huertero et al., 2000; Huijser et al., 2000; Laby et al., 2000), as well as in the control of the lipid reserve mobilization in the embryo (Penfield et al., 2006) and salt tolerance (Quesada et al., 2000). Recent studies support the notion that ABI4 mediates responses in later stages of plant development. For example, ABI4 is involved in nitrate and sugar modulation of root growth, in lateral root formation, in mediating ABA and cytokinin lateral root inhibition (Signora 1 To whom correspondence should be addressed. E-mail patricia@ibt. unam.mx, tel. 52 (55) 5622 7856, fax 52 (777) 313 9988.

© The Author 2013. Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPB and IPPE, SIBS, CAS. doi: 10.1093/mp/sst132, Advance Access publication 17 September 2013 Received 30 August 2013; accepted 2 September 2013

Gregorio et al. • Functional Analysis of the ABI4 Protein Motifs

et al., 2001; Shkolnik-Inbar and Bar-Zvi, 2010), and in some defense responses mediated by JA and oxidative challenges (Kaliff et al., 2007; Kerchev et al., 2011; Yang et al., 2011; Cui et al., 2012). ABI4 is also required for redox control mediated by ascorbate (Kerchev et al., 2011), and has recently emerged as a central factor in the organelle to nucleus communication. The lack of ABI4 affects chloroplast (Oswald et al., 2001; Koussevitzky et al., 2007) and mitochondria (Giraud et al., 2009) retrograde signaling. Although ABI4 seems to act as a node of integration for different signals in plants, little is known about its mechanism of action. The expression of ABI4 is induced in the presence of high levels of glucose and ABA (Arroyo et al., 2003) and also by stress treatments (Sun et al., 2011). Alterations in the expression of ABI4 affect the expression of a variety of genes positively and negatively (Soderman et al., 2000; Acevedo-Hernandez et al., 2005; Rook et al., 2006; Bossi et al., 2009; Koussevitzky et al., 2007; Kerchev et al., 2011; Reeves et al., 2011). Experimental evidence has demonstrated that genes such as ABI5, SBE2.2, AOX1a, LHCB, RBCS, and ABI4 itself are direct targets of ABI4 (Acevedo-Hernandez et al., 2005; Rook et al., 2006; Bossi et al., 2009; Giraud et al., 2009). ABI4 binds to the CE1-like element (CACCG) present in the upstream regions of its target genes (Niu et al., 2002; Bossi et al., 2009; Hu et al., 2012). However, recent work suggests that ABI4 may also recognize other binding sites, including the minimal core CCAC or the G(A/C)CACGT(G/A) and GC(C/G) GCTT(T) sequences (Koussevitzky et al., 2007; Reeves et al., 2011; Shkolnik-Inbar et al., 2013; Wind et al., 2013). Whether these different binding site preferences result from specific protein modifications or from the interaction with other proteins is currently unknown. ABI4 belongs to the AP2/EREBP family of plant-specific transcription factors, characterized by the APETALA 2 (AP2) DNA-binding domain (Okamuro et al., 1997; Shigyo et al., 2006). ABI4 is a unique member of the A3 subgroup of the DREB subfamily (Mizoi et al., 2012). This family of transcription factors is involved in many signaling processes and stress responses (Mizoi et al., 2012). Orthologs of ABI4 from maize and rice have been identified and, in the former case, shown to rescue the ABA and glucose sensitivities in Arabidopsis abi4 mutant (Niu et al., 2002). The highest similarity between the maize and rice orthologs with the Arabidopsis ABI4 gene is found in the AP2 domain. However, other structural similarities have been observed, including proline-rich and acidicrich regions present at the carboxy-termini of the proteins (Finkelstein et al., 1998). Recent evidence supports that ABI4 is regulated posttranscriptionally, since the accumulation of its transcript does not correlate with its protein levels (Finkelstein et al., 2011). Transgenic plants that overexpress ABI4 have undetectable protein levels despite high transcript accumulation and, in most cases, the transgene was silenced after a few generations, suggesting that high ABI4 levels may be deleterious to the plant (Finkelstein et al., 2011). Analysis of the Arabidopsis

423

ABI4 amino acid sequence showed the presence of a putative degradation motif (PEST) near the amino terminus of the protein (Finkelstein et al., 2011). PEST sequences are involved in proteasome-mediated instability of different proteins (Rechsteiner and Rogers, 1996) but the role of this sequence in ABI4 protein stability is not yet fully clear. A major limitation for the analysis of the ABI4 factor is its very low transcript and protein levels due to multiple levels of regulation. Until now, the direct detection of this protein even in overexpressing transgenic plants has not been reported. To advance in the understanding of the mechanism of action and regulation of ABI4, we identified amino acid sequences conserved among the ABI4 proteins in different plant species and analyzed their possible role in the function of this transcription factor. Based on an in silico analysis of ABI4 homologs from 31 different plant species, we identified conserved sequences among these putative ABI4 proteins. Based on the conservation of these sequences, we hypothesized that they are good markers to identify ABI4 orthologs. Supporting this hypothesis, we demonstrate that one of these putative orthologs from Theobroma cacao activates gene expression through the CE1-like binding site, similar to the Arabidopsis ABI4, and restores ABA, glucose, and salt sensitivity of the abi4 Arabidopsis mutant. The function of these conserved motifs was investigated through mutagenesis or deletion in the Arabidopsis ABI4 protein. Due to the low expression levels of the ABI4 protein in plants, we use an alternative approach in which we immunodetect the intact ABI4–green fluorescent protein (GFP) fusion protein in transient assays with Arabidopsis protoplasts. We found that one of these motifs, named AP2-associated motif, is required for the nuclear localization of the ABI4 protein whereas the LRP motif is important, but not essential, for the regulation of ABI4 transcriptional activity. Interestingly, we observed that alteration in the nuclear localization of the ABI4 protein results in an accumulation of this protein. Finally, we determined that the previously identified PEST motif (Finkelstein et al., 2011) directly modulates the degradation of the ABI4 protein via the 26S proteasomal pathway. We further corroborated that the ABI4 protein instability is modulated by the level of sugars but not by the level of ABA.

RESULTS Conservation of ABI4 Genes in Other Plant Species Extensive literature supports the central role that ABI4 has in various plant developmental processes; therefore, we conducted a comparative analysis of this factor in different plant species to identify conserved regions that could help further dissect its mechanism of action. Apart from Arabidopsis, little is known about the ABI4 protein in other plant species, with the exception of maize and rice (Niu et al., 2002). One reason is that the sequence similarity of ABI4 among plants is low and apparently mostly limited to the AP2 DNA-binding domain (Niu et al., 2002). However, a detailed analysis of the

424


alignment with the ABI4 protein sequences from Arabidopsis thaliana (AT2G40220.1), Zea mays (AY125490), and Oryza sativa (Os05g28350) demonstrated that, besides the highly conserved AP2 domain, two additional regions with a high degree of conservation exist. One region includes a stretch of about 10 amino acids (KGGP(D/E)NXKFR) contiguous to the AP2 domain (named the AP2-associated motif), and the other a stretch of eight amino acids (LRPLLPRP) named here LRP, located around amino acid 140 (Figure 1A). To further test whether these motifs were conserved in other ABI4 proteins, an extended analysis with 31 putative ABI4 ortholog proteins from different plant species was done (Supplemental Table 1). This analysis showed that, in all ABI4 proteins analyzed, the AP2-associated and the LRP motifs are highly conserved. The former motif is also found in the closely related DREB transcription factors that belong to the A2 subgroup (Figure 1B). The identity of the AP2-associated motif extends to 15 amino acids among dicotyledonous plants (RKCKAGKGGPDNxKFR; Figure 1A and Supplemental Figure 1). Notably, the LRP motif is invariable in all species analyzed, with the exception of Pinus taeda that contains seven of the eight conserved amino acids (Supplemental Figure 1). In contrast to the AP2-associated motif, the LRP motif is found exclusively in the ABI4 proteins and not in members of the A2 subgroup (Supplemental Figure 2). This analysis also corroborated that the previously reported

Figure 1. Structural Characteristics of the ABI4 Proteins. (A) Schematic diagram of the ABI4 protein showing conserved domains. The PEST sequence, the AP2-associated motif, the AP2 domain (AP2), the serine/threonine-rich region (S/T), the LRP motif, and the acidic domain present in the carboxy terminal region are indicated. The bipartite sequences predicted as NLS are marked with the *. The homology of the PEST sequence and LRP motifs are shown for Arabidopsis thaliana (Ath), Arabidopsis lyrata (Aly), Capsella rubella (Cru), Brassica rapa (Bra), and Thellungiella halophila (Tha). The consensus motifs of the AP-associated motif and of the acidic domain obtained from the comparison of 31 ABI4 sequences are shown. (B) The AP2-associated-like motif present in members of the A2 subgroup (A2) is shown. Members of the A2 subgroup include AT2G40340, AT2G40350, AT3G11020, AT5G05410, AT2G38340, AT1G75490, AT5G18450, and AT3G57600.

serine/threonine- (113–137) and glutamine (Q)-rich (188– 208) regions as well as the acidic domain (Finkelstein et al., 1998) are present in all the proteins analyzed (Supplemental Figure 1) but without specific sequence conservation. Finally, although the amino terminus of the protein is more divergent, the presence of a sequence that fits into the consensus for a degradation motif (PEST sequence) and which will be described in more detail later was also found (Figure 1). This in silico analysis demonstrates that the ABI4 protein is conserved in its overall architecture consistent with its central role in plants. These results lead us to propose that the AP2-associated and the LRP motifs, together with the AP2 domain, can be used as hallmarks to identify the ABI4 orthologs in different plants.

The ABI4 Gene from Theobroma cacao Activates Gene Expression through the CE1-Like Element Previous studies demonstrated that the Arabidopsis and maize ABI4 protein specifically recognize the CE1-like element present in several of the ABI4 target genes and transactivate their expression (Niu et al., 2002; Bossi et al., 2009). To further support that the selected proteins used in our in silico analysis correspond to true ABI4 orthologs, we isolated the corresponding gene from one of the plants used and analyzed its capacity to recognize the ABI4 binding site and to trans-activate gene expression in a transient mesophyll protoplast system (Yoo et al., 2007). Among the different putative orthologs, we selected the one from T. cacao whose genome was recently sequenced because this plant contains highly sensitive desiccation seeds (recalcitrant seeds) and is agronomically important (Pence, 1991). The full open reading frame of the T. cacao ABI4 gene (CGD0006858) was amplified from total DNA based on the published genome sequence (www.cacaogenomedb.org). This fragment was cloned into the pJD301 vector under the control of the 35S promoter, generating the p35S::TcABI4 effector plasmid; this plasmid was used to test TcABI4 transactivation capacity in an Arabidopsis protoplast transient assay. We found that the TcABI4 recognizes the Arabidopsis CE1-like element present in the reporter plasmid and transactivates the expression of the LUC reporter gene (Figure 2A). The level of transactivation detected was approximately half of that observed for the AtABI4 gene, which may be a consequence of the heterologous system used. These results support the hypothesis that this protein corresponds to the T. cacao ABI4 ortholog, and also supports the prediction that the AP2-associated and LRP elements are good identifiers of ABI4 proteins. To further substantiate the function of this gene as a true ABI4 ortholog, a complementation test was performed. The full open reading frame of the TcABI4 gene was cloned into the pK2GW7 gateway vector and introduced into homozygous abi4 mutant plants. Independent transgenic lines were selected and the presence of the transgene was verified by PCR (Supplemental Figure 3). It is known that the absence of ABI4


425

high sensitivity to each condition was found in the transgenic lines in contrast to the tolerance observed for the abi4 mutant plant. The sensitivity towards these conditions is particularly noticeable in the L5 transgenic line. We also corroborated that these differences in growth and germination are not due to defects in the seed viability, since no difference in growth and germination was observed when growth was performed in GM media (Figure 2B). Based on the suppression of the abi, gin, and salt-tolerant phenotypes of the abi4 mutant in the presence of the transgene, we conclude that the TcABI4 gene encodes a true ABI4 ortholog capable of complementing different signaling pathways as does its Arabidopsis counterpart.

The AP2-Associated Motif Is Involved in the Nuclear Subcellular Localization and Stability

Figure 2. Function of the ABI4 Protein of Theobroma cacao as a Transcriptional Activator. (A) Relative luciferase (LUC) activity from protoplasts transfected with the pABI4–CE1 as a reporter construct alone (black bar) or cotransfected with the Arabidopsis ABI4 (AtABI4; white bar) or the putative ABI4 protein from Theobroma cacao (TcABI4; gray-dotted bar). The LUC specific activity was corrected by GUS-specific activity. Relative units of LUC activity are displayed normalized to the levels in the pABI4–CE1 construction. Error bars indicate SD from biological triplicates. Germination and greening in 1X GM (B), 3 μM ABA (C), 7% glucose (D), and 150 mM NaCl (E) of L1, L5, and L7 independent transgenic lines (abi4 35S::TcABI4), Col-0 wild-type, and abi4 mutant. Germination and greening were scored after 15 d for GM, 18 d for ABA and glucose media, and 24 d for NaCl conditions of transfer to the growth chamber.

results in ABA- (abi), glucose-insensitive (gin), and salt-tolerant phenotypes (Finkelstein et al., 1998; Arenas-Huertero et al., 2000; Quesada et al., 2000). Thus, we assayed the sensitivity to ABA, glucose, and NaCl of three independent abi4::TcABI4 transgenic lines. As can be seen in Figure 2C, in the presence of 3 μM ABA, the transgenic lines germinated but most of the seedlings were unable to green and expand their cotyledons, similarly to wild-type and in contrast to the abi4 mutant grown under the same conditions. A similar result was observed when these transgenic lines were grown in the presence of 7% of glucose (Figure 2D) or 150 mM NaCl (Figure 2E). In both cases,

Based on the high conservation of the AP2-associated motif, we hypothesized that this sequence is important for ABI4 protein functionality. An in silico analysis of the ABI4 amino terminal region using the NucPred program (www.sbc. su.se/~maccallr/nucpred/) (Brameier et al., 2007) predicted that the Arabidopsis AP2-associated sequence is part of a bipartite nuclear localization signal (NLS) together with a second motif localized in the AP2 DNA-binding domain (PRKRTRK) (Figure 1A and Supplemental Figure 1). Proper nuclear localization is critical for the function of a transcription factor such as ABI4. To examine the function of the AP2-associated motif as a part of the NLS, we constructed chimeric proteins (Figure 3A) with fragments of the Arabidopsis ABI4, including or not including the AP2-associated motif, with the GFP. Previous work has demonstrated that, in transient protoplast assays, the Arabidopsis ABI4 protein binds to various target genes and activates their expression (Bossi et al., 2009), supporting proper subcellular localization. In contrast, subcellular localization in transgenic plants has not been observed, probably because only low levels of the proteins are present due to posttranscriptional regulation (Finkelstein et al., 2011). Thus, we decided to analyze the subcellular localization of these constructs using transient assays. First, we demonstrate that the accumulation of the GFP protein fused to the complete ABI4 open reading frame was localized exclusively to the nucleus (Figure 3B). The subcellular localization of the ABI4 fragment that includes the bipartite NLS with the AP2associated motif (117 amino acids from the ATG) was indistinguishable from that observed with the complete open reading frame (Figure 3B). In contrast, the construct that includes only the first 39 amino acids of the ABI4 protein (ABI4–∆NLS) and lacks the AP2-associated motif was localized in the cytoplasm, supporting the in silico prediction. Because ABI4–∆NLS lacked not only the AP2-associated motif, but also most of the ABI4 protein, a specific deletion of this motif that maintained the rest of the Arabidopsis ABI4 protein was obtained (ABI4– ∆APaM) and fused to the GFP reporter protein (Figure 3A) to specifically dissect its function and subcellular localization. As shown in Figure 3B, transport of the ABI4 protein into the nucleus is reduced with deletion of the AP2-associated motif.

426


This chimeric construct accumulates not only in the nucleus, but also in the cytoplasm. One of the characterized regulatory modes of the ABI4 protein is the alteration of protein stability. Previous studies

analyzing the activity of GUS from an ABI4::GUS fusion protein in transgenic plants showed that some important signals for ABI4 protein stability are localized in a region that includes the AP2-associated motif (Finkelstein et al., 2011). To

Figure 3. Function of the AP2-Associated Motif. (A) Schematic representation of the GFP fusions used in the subcellular localization analysis. The diagrams highlight some important elements such as the AP2-associated motif and NLS (gray boxes), the AP2 domain (black box), and the LRP motif (hatched box). The deletion of the AP2-associated motif and the mutation of the LRP are also indicated in the corresponding construct. (B) Confocal images of GFP localization in protoplasts transformed with the full ABI4::GFP protein (ABI4–WT), an ABI4 fragment including the first 117 amino acids from the ATG (ABI4–NLS), a construct that lacks the AP2-associated motif that includes only the first 39 amino acids from the ATG (ABI4–∆NLS), a deletion of 14 amino acids corresponding to the AP2-associated motif (ABI4–∆APaM), and a mutation of the LRP motif (ABI4–mLRP). Scale bar: 10 μm. (C) Protein levels of ABI4–WT and the ABI4–∆APaM proteins from transfected protoplasts. Total protein extracts were obtained after 15 h of transfection. Each lane contains 80 μg of total protein extracts. Immunodetection was performed using a 1:10 000 dilution of the GFP antibody. The RbcL protein from the Ponceau-stained membrane was used as a loading control. (D) The level of the fusion proteins detected in the Western blot in (C) was quantified by densitometric analysis and expressed in arbitrary units relative to the ABI4–WT (white bar) which was taken as 1. Each bar corresponds to the standard deviation of three biological independent experiments.


directly quantify the accumulation of the ABI4–∆APaM chimeric protein, the protein levels were analyzed by immunedetection from total protein extracts from the transformed protoplasts using GFP specific antibodies (Figure 3C). The specificity of the antibodies and the identity of the fusion protein were corroborated using protoplast extracts without transformation or with the GFP protein alone (Supplemental Figure 4). Using this system, we were able to detect the intact fusion protein by Western blot analysis. We observed that the amount of the ABI4–∆APaM fusion protein is around five times higher than the construct that contains the AP2associated motif (Figure 3D). This result demonstrates that the Arabidopsis AP2-associated motif is required for efficient nuclear localization and also affects the stability of the ABI4 protein. To assess the contribution of the AP2-associated motif in ABI4 function, the ability of the ABI4–∆APaM fusion protein to trans-activate the LUC reporter gene was analyzed in a protoplast transient assay system (Yoo et al., 2007; Bossi et al., 2009). To this end, this mutant gene was cloned into the pJD301 vector under the control of the 35S promoter, generating the p35S:: ABI4–∆APaM effector plasmid and used to trans-activate the pABI4–CE1::LUC reporter (Bossi et al., 2009), as previously described. We found that the ABI4 protein that lacks the AP2-associated motif does not have detectable transactivation capacity compared to the wild-type ABI4 protein (Figure 3E). This result further supports the critical role that this motif has over the activity of this transcription factor.

427

is not a consequence of reduced ABI4–mLRP protein stability, since the accumulation of this protein is similar to the wildtype (Figure 4B and 4C). Altogether, these results demonstrate that the LRP motif plays a role for ABI4 transcriptional activity but is not required for its subcellular localization, or for ABI4 protein stability.

The PEST Sequence in ABI4 Affects Protein Stability Recent evidence has demonstrated that the low accumulation of ABI4 is a consequence of both posttranscriptional and posttranslational regulation (Finkelstein et al., 2011). Sequences involved in the posttranslational regulation were mapped to the amino termini that include the AP2-associated motif. Our previous analysis demonstrated that the AP2associated motif sequence is important for protein accumulation. Analyses using the PESTfind program (Rice et al., 2000) identified a putative PEST degradation signal at the amino

The LRP Motif Is Important for ABI4 Activity Because the LRP motif is highly conserved in all the proteins analyzed, we hypothesized that this sequence should also play an important role in ABI4 function or stability. In contrast to the AP2-associated motif, we could not predict any possible function for this sequence in silico. Therefore, to analyze the function of the LRP motif, this sequence was replaced with eight consecutive alanine residues in the Arabidopsis ABI4 protein, generating the ABI4–mLRP protein. To evaluate whether this sequence affects the subcellular localization of the ABI4 protein, a fusion of the ABI4–mLRP and GFP was analyzed. The subcellular distribution of the mutated ABI4–mLRP::GFP protein was not any different from the wild-type::GFP fusion protein (Figure 3B). These results demonstrate that the LRP motif does not alter the subcellular localization of ABI4. We next examined the possible involvement of the LRP motif in the ability of ABI4 to function as an activator. The ability of the ABI4–mLRP to trans-activate LUC reporter gene expression was analyzed using the protoplast transient assay system as previously reported (Bossi et al., 2009). We observed that the ABI4–mLRP mutant protein activated the pABI4– CE1::LUC reporter construct (Figure 4A), but only to around 50% of the level observed for the wild-type ABI4 protein. We further demonstrated that this difference in protein activity

Figure 4. The LRP Motif Is an Important Element for the ABI4 Transcriptional Activity. (A) Relative LUC activity from Col-0 protoplasts transfected with the pABI4–CE1::LUC reporter construct alone (black bar) or co-transfected with the effector 35S:ABI4 (ABI4–WT, white bar) or the 35S::ABI4mLRP, carrying a mutation in the LRP motif (ABI4–mLRP, dashed bar). Relative units of LUC activity are expressed as the fold-induction between the specific LUC activity in the presence of ABI4 and the activity without ABI4, taken as 1. Each bar corresponds to the standard deviation of at least three independent biological experiments. To correct for transfection efficiency, the LUC specific activity was corrected by GUS-specific activity. (B) Protein levels of the ABI4–WT::GFP and the ABI4–mLRP::GFP were determined by Western blot analysis. Total protein extracts were obtained after 15 h of transfection. Each lane contains 80 μg of total protein extracts. Immunodetection was performed using a 1:10 000 dilution of the GFP antibody. The negative control (Control) corresponds to the pEarlyGate103 destination vector. The RbcL protein from the Ponceau-stained membrane was used as a loading control. The protein gel shown is representative from three independent biological replicates. (C) The amount of the fusion proteins detected in (B) was quantified by densitometric analysis, expressed as arbitrary units relative to the ABI4–WT (white bar), taken as 1.

428


terminus of the Arabidopsis ABI4 protein (Figure 1) with a high probability value (+13.48), in agreement with a previous report (Finkelstein et al., 2011). PEST sequences are characterized by regions enriched in the amino acids proline, glutamic acid, serine, and threonine, and this motif is present in many short-lived proteins (Rogers et al., 1986). The analysis of 30 putative ABI4 orthologs demonstrated that, although the amino terminal region of the ABI4 proteins is highly divergent (Supplemental Figure 1), potential PEST sequences were predicted in 29 of these proteins, with probability score values ranging from +0.68 (Z. mays) to +21.56 (T. cacao) (Supplemental Table 2). In the vast majority (25 of 30 plant species), the potential PEST sequence is located in a similar position to that of Arabidopsis ABI4, in the amino terminal region of the protein. The exceptions are O. sativa and Malus domestica (Supplemental Table 2). In some of these proteins, more than one PEST sequence was predicted (Supplemental Table 2). The conservation in protein location of the potential PEST motif in the majority of these plants supports a role for this sequence in the stability of ABI4. To further evaluate this function independently of the adjacent AP2-associated motif, we generated a deletion of 19 amino acids of the predicted PEST sequence in the Arabidopsis ABI4 protein (ABI4–∆P). Since the detection of the ABI4 protein in plants has been unsuccessful and only analyzed indirectly through the activity of reporters, the impact of this mutation in the overall protein accumulation and function was evaluated in Arabidopsis protoplasts. The ABI4–∆P construct was able to trans-activate the effector gene at a similar level to that observed in the wild-type construct (Figure 5A), demonstrating that this deletion does not have significant impact on the activation activity of this transcription factor under the conditions analyzed. We next examined its subcellular localization and the stability of the ABI4–∆P protein in comparison to the wild-type ABI4 protein. For this purpose, the wild-type ABI4 and the ABI4–∆P sequences were fused to the GFP reporter and introduced into protoplasts. We found that the lack of the PEST sequence did not affect its subcellular localization, since the ABI4–∆P protein localizes into the nucleus, similarly to wildtype ABI4 protein (Figure 5B). Although the GFP intensity is not a quantitative measurement, we noticed in this assay that the protoplasts transformed with the ABI4–∆P::GFP protein consistently showed higher levels of GFP fluorescence. To directly quantify the accumulation of the wild-type ABI4::GFP and ABI4–∆P::GFP fusion proteins, total protein extracts from the transformed protoplasts were used in Western blot analysis. As shown in Figure 5C, the accumulation of the ABI4–∆P::GFP fusion protein was remarkably higher than the wild-type ABI4::GFP fusion, indicating that the PEST sequence has a major effect on the protein stability. Quantification of the protein levels by densitometry analysis from three independent biological

Figure 5. The PEST Sequence Is Involved in the ABI4 Protein Stability. (A) The transactivation activities of the wild-type ABI4 protein (ABI4– WT) and the ABI4 with 19 amino acids corresponding to the PEST sequence deleted (ABI4–∆P) were determined measuring the relative LUC activity from Arabidopsis Col-0 protoplasts transfected with the pABI4–CE1::LUC reporter construct (black bar) or co-transfected with the effector 35S:ABI4 (white bar) or the 35S::ABI4–∆P (gray bar). Relative units of LUC activity are expressed as the fold-induction from the activity without the effector ABI4 plasmid (black bar), taken as 1. Each bar indicates the standard deviation of three independent biological experiments. (B) GFP fluorescence of protoplasts transfected with the ABI4::GFP (ABI4–WT) or ABI4–∆P::GFP fusion proteins was followed using confocal microscopy. Transfection was performed using equal concentration of both constructs. Scale bar: 10 μm. (C) Protein levels of ABI4–WT and ABI4–∆P fusions were analyzed by Western blot from total protein extracts obtained 15 h after transfection. Each lane contains 80 μg of total protein extracts. Immunodetection was performed using a 1:10 000 dilution of the GFP antibody. The negative control (Control) corresponds to the pEarlyGate103 destination vector. The RbcL protein from the Ponceau-stained membrane was used as a loading control. The protein gel shown is representative of three independent biological replicates. (D) The amount of the ABI4–Wt (white bar) or ABI4–∆P (gray bar) fusion proteins detected in the Western analysis (C) was quantified by densitometric analysis and expressed as arbitrary units relative to the ABI4–WT, taken as 1. Error bars indicate SD from three biological independent experiments.

experiments demonstrated that, in the absence of the 19 amino acids of the putative PEST sequence, the ABI4 protein accumulated around six times more than the wildtype protein (Figure 5D). These results demonstrate that the presence of the PEST sequence reduces ABI4 protein accumulation. To determine whether the changes in the protein accumulation are the result of differences in the stability of the ABI4–∆P::GFP versus the ABI4::GFP protein, the half-life of these fusion proteins was analyzed. The accumulation of the ABI4::GFP with or without the PEST sequence was followed in transfected protoplasts at different times after the addition


of the protein synthesis inhibitor cycloheximide (Figure 6A). Under these conditions, it was determined that the half-life of the ABI4::GFP protein was around 3 h (Figure 6B), whereas the half-life of the ABI4–∆P::GFP extends for more than 6 h (Figure 6B). It is interesting that the half-life observed for the ABI4::GFP wild-type protein is similar to that reported in ABI4::GUS transgenic plants (Finkelstein et al., 2011), supporting that the protoplast transient assay used in this study is suitable for these analyses. These results led us to conclude that the PEST sequence present in the amino terminus of the Arabidopsis ABI4 protein plays an important role in regulating ABI4 protein degradation. Previous studies indicated that the degradation of proteins mediated by the PEST sequence involves the participation of ubiquitin-26S proteasome (Rechsteiner and Rogers, 1996).

429

A recent study showed that, within the initial 224 amino acids of the Arabidopsis ABI4 protein, there are included sequences involved in proteasome-mediated degradation (Finkelstein et al., 2011). To determine whether this proteasome-mediated regulation involved the PEST degradation sequence, we analyzed the accumulation of the ABI4::GFP and the ABI4– ∆P::GFP proteins in the presence of the MG132, an inhibitor of the proteasomal degradation machinery, using the transient assays. We observed that the wild-type ABI4 protein accumulates at low levels in the presence of cycloheximide (Figure 7A and 7C). However, when cycloheximide was combined with the MG132 inhibitor, the level of the ABI4::GFP fusion protein was considerably higher, similar to the levels observed without cycloheximide treatment (Figure 7C). However, when the ABI4–∆P protein accumulation was analyzed, the levels of this PEST-deleted protein did not change significantly in any of the treatments previously described (Figure 7B and 7D). These results demonstrate that the degradation of the ABI4 protein observed in this study is mediated by the PEST sequence and is dependent on the 26S proteasome degradation machinery.

Involvement of Environmental Signals in the ABI4 Protein Stability Transcription of the ABI4 gene is up-regulated in response to ABA and glucose levels (Soderman et al., 2000; Bossi et al., 2009) and recent data support that glucose, but not ABA, affects the stability of the ABI4 protein (Finkelstein et al., 2011). Using the protoplast transient assay, we evaluated the impact of ABA and glucose on ABI4 protein accumulation. Transfected protoplasts with the ABI4::GFP fusion protein

Figure 6. Determination of the ABI4 Protein Half-Life in Arabidopsis Protoplast. (A) The level of ABI4::GFP and ABI4–∆P::GFP fusions was determined by immunodetection 12 h after protoplasts transformation, following the addition of the translation inhibitor cycloheximide. Total protein extracts were extracted at times 0, 2, 4, and 6 h after the cycloheximide treatment. Extracts of each time point (80 μg) were resolved in a SDS–PAGE gel and subsequent immunoblotting membrane was performed using a 1:10 000 dilution of the GFP antibody. The negative control (Control) corresponds to the pEarlyGate103 destination vector. The RbcL protein from the Ponceau-stained membrane was used as a loading control. (B) Protein half-life was determined using densitometric analysis. Data points represent the average and SD (error bars) of three biological independent experiments reported as relative units of densitometry normalized to the levels of ABI4–WT::GFP (circles) or ABI4–∆P::GFP (squares) at the beginning of the treatment, taken as 1. The half-life of the ABI4–WT::GFP protein is indicated by the dotted line.

Figure 7. The ABI4 Protein Turnover Mediated by the PEST Motif Involves the 26S Proteasome Pathway. The level of ABI4::GFP (A) and ABI4–∆P::GFP (B) fusion proteins was determined by immunodetection 16 h after protoplast transformation, without any treatment, or after the addition of 50 μM cycloheximide (CHX) and CHX in combination with MG132. The negative control (CN) corresponds to the pEarlyGate103 destination vector. The RbcL protein from the Ponceau-stained membrane was used as a loading control. The ABI4::GFP (C) and ABI4–∆P::GFP (D) fusions in the different treatments were quantified by densitometry and are reported as relative units and normalized to the levels of ABI4–WT (A) or ABI4–∆P::GFP (B) without treatment, taken as 1. Error bars indicate standard deviation from three biological replicates.

430


were incubated in the presence of 1 μM ABA for 15 h (similar to our previous analyses) and the accumulation of the ABI4 protein was analyzed. Under these conditions, we did not observe any significant difference in protein accumulation in the presence of ABA (Figure 8A and 8C). To further substantiate this result, two additional ABA concentrations were used (100 nM and 10 μM) in the transient assay. However, similarly to what we observed in the case of 1 μM ABA, no difference was observed with either of these additional ABA concentrations (data not shown). All together, these data demonstrate that ABA, similarly to what was previously reported in plants (Finkelstein et al., 2011), has a minimal impact on the modulation of ABI4 protein stability. In contrast, the incubation of the transfected protoplasts with 150 mM glucose resulted in >50% increase in the accumulation of ABI4::GFP protein in comparison to the no-glucose treatment (Figure 8B and 8D). These results confirm that sugars regulate the ABI4 protein accumulation, not only by increasing its expression, but also by modulating its accumulation.

Discussion In the past decade, diverse studies support a central role for the ABI4 transcription factor as a node of convergence for a variety of signaling pathways generated from biotic, abiotic, and nutritional signals (Finkelstein et al., 1998; ArenasHuertero et al., 2000; Soderman et al., 2000; Arroyo et al., 2003; Bossi et al., 2009; Dietz et al., 2010; Wind et al., 2013). As a result, ABI4 affects central metabolic and developmental processes in plants by positively or negatively modulating the expression of a variety of genes (Penfield et al., 2006; Koussevitzky et al., 2007; Shkolnik-Inbar and Bar-Zvi, 2010; Reeves et al., 2011). Many of these signaling pathways are present in diverse plant species and, accordingly, ABI4 is conserved between monocotyledons and dicotyledons (Finkelstein et al., 1998; Niu et al., 2002; Wind et al., 2013). Most of the published data about ABI4 describe its transcription regulation, including the recent identification of various transcription factors that regulate its expression (Sun et al., 2011; Cui et al., 2012; Liu et al., 2012). However, our understanding of the mode of action and the mechanism by which ABI4 protein is regulated is still largely unknown. We hypothesized that the comparison of the ABI4 protein structure in different plants would allow us to identify evolutionarily conserved sequences important for its function and/or regulation. ABI4 belongs to one of the largest families of transcriptional factors, the AP2/EREBP family, with more than 140 members in the Arabidopsis genome (Riechmann and Meyerowitz, 1998; Dietz et al., 2010). All of these factors share the highly conserved AP2 DNA-binding domain, but differ outside of this region. In all cases, with two exceptions (Populus trichocarpa and Glycine max), putative ABI4 orthologs were found as single genes in the genomes of the plants analyzed. Based on the in silico analysis of 31 different

Figure 8. Glucose But Not ABA Affects ABI4::GFP Protein Accumulation. (A) Protein accumulation of ABI4–WT::GFP fusion protein from protoplasts after 15 h of transformation alone (–) or incubated in the presence of 1 μM ABA (+). (B) Protein accumulation of ABI4–WT::GFP fusion protein from protoplasts after 15 h of transformation alone (–) or incubated in the presence of 150 mM glucose (+) were determined by immunodetection as described in Figure 5. The negative control (CN) corresponds to the pEarlyGate103 destination vector. The RbcL protein from the Ponceaustained membrane was used as a loading control. (C, D) Quantification of the ABI4::GFP protein levels was determined by densitometry and is reported as relative units normalized to the levels of ABI4–WT without treatment. Error bars indicate standard deviation from three independent experiments.

ABI4 plant homologs that have diverged over approximately 300 million years, we identified two highly conserved motifs, in addition to the AP2 domain (Supplemental Figure 1). Our characterization of the TcABI4 supports that these motifs are good markers for identifying ABI4 orthologs and distinguish them from other related AP2/EREBP factors. Independent studies have identified several residues in the AP2 domain that participate in DNA-binding of various AP2 transcription factors (Allen et al., 1998; Sakuma et al., 2002). Several of these residues are highly conserved in the ABI4 proteins analyzed (Supplemental Figure 5), supporting the idea that these residues might be also involved in DNArecognition in the ABI4 proteins. Nevertheless, since ABI4 recognizes a different cis–DNA-binding motif than other DREBs (T/GCCGAC; DRE/CRT) or ERFs (AGCCGCC; GCC-box) (Allen et al., 1998; Sakuma et al., 2002), additional residues are expected to participate in DNA-binding specificity. A recent docking analysis using the AP2 domain of ABI4 predicts a similar binding structure to the Arabidopsis ERF1 AP2 domain (Wind et al., 2013). Wind et al. (2013) proposed that glycine 155 (G155), proline 164 (P164), and lysine 170 (K170) residues are important for DNA-binding to the CE1-like motif (Wind et al., 2013). However, of these residues, only the K170 is specific to ABI4 compared with other DREBs and ERFs, suggesting it is a good candidate to participate in the DNA-binding specificity of ABI4 (Supplemental Figure 5). Finally, in our analysis, we observed that residues such as glutamine 151, serine 153, arginine 165, threonine 168, and lysine 170 are highly conserved among the ABI4 sequences but not in other DREB or ERF members (Supplemental Figure 5). Thus, these amino


acids might confer DNA-binding specificity to ABI4. Future studies are needed to determine whether any of these amino acids actually participate in the DNA-binding specificity of the ABI4 factor.

The ABI4 Ortholog Proteins: Structural Characteristics and Conservation in Distant Plant Lineages In addition to the AP2 domain, our in silico analysis found two motifs highly conserved in the ABI4 proteins: the AP2associated motif and the LRP motif. During the writing of this work, a similar analysis was published in which a comparison of different ABI4 proteins identified the same motifs and these were named CMIV-1 (AP2-associated motif) and ABI4 (LRP motif) (Wind et al., 2013). The high conservation of these sequences supports an important role of these motifs for the ABI4 protein function and/or regulation. Recent data have shown major differences between the ABI4 transcript and protein activity, supporting a tight posttranscriptional regulation (Finkelstein et al., 2011). Finkelstein and co-workers also provided the first evidence of posttranscriptional regulation of the ABI4 protein. However, a limitation in these analyses is that the ABI4–GUS fusion protein was undetectable in the transgenic plants and the conclusions were based on the GUS activity from the ABI4–GUS fusion protein, supporting the robust regulation that limits the accumulation of ABI4 protein. Due to the difficulty analyzing protein expression in transgenic plants, in this work, we took an alternative approach, using transient expression assays in Arabidopsis mesophyll protoplasts. This system has been used successfully for the analysis of the molecular bases of the function of diverse factors, including ABI4 (Baena-Gonzalez et al., 2007; Cho et al., 2009; Kang et al., 2010), that specifically recognize various target genes and trans-activate gene expression (Bossi et al., 2009). Also, previous work showed that the factors required for the regulation of ABI4 protein are present in mesophyll cells, since, in transgenic plants that constitutively express the ABI4 gene and accumulate high transcript levels, the ABI4 protein does not accumulate (Finkelstein et al., 2011 and data not shown). All of these findings support the use of a transient assay system as an alternative to circumvent the tight regulation of ABI4 protein accumulation and advance in the understanding the function of conserved elements in this protein. The data presented here support this conclusion, since we successfully immunodetected the full ABI4–GFP fusion protein and analyzed its accumulation under different conditions and in response to specific mutations. According to previous research, multiple regions within the ABI4 protein appear to contribute to this regulation, and probably through different mechanisms (Finkelstein et al., 2011). Our analysis demonstrated that the LRP motif is important, although not essential, for the transactivation activity of this transcriptional regulator. Accordingly, its mutation resulted in lower transactivation activity. Our data also show that the LRP motif does not participate in the regulation of

431

the ABI4 protein stability or in subcellular localization. At this point, it is still unclear what the exact function of this motif is, but it is worth noting that this conserved domain is adjacent to a described serine/threonine (ST)-rich region, present in different members of the A2-subgroup that could be a target of phosphorylation (Finkelstein et al., 1998; Niu et al., 2002). Deletion of the ST region in the AtDREB2A transcription factor renders it to constitutively active form (Sakuma et al., 2006). In contrast, a mutation within this region that results in a constitutive phosphorylated form of the DREB2A from Pennisetum glaucum is unable to bind to its DRE/CRT target element (Agarwal et al., 2007). Thus, an interesting possibility is whether the LRP motif could have an influence on the phosphorylation status of the ABI4 protein. Another possibility is that this motif might participate in interactions with other proteins in the transcription machinery. However, these questions remain a subject for future analysis.

The AP2-Associated Motif Is an Important Determinant for the Subcellular Localization of ABI4 Specific deletion of the AP2-associated motif confirmed that this sequence contributes to the correct subcellular localization of the Arabidopsis ABI4 transcription factor. These data corroborated the in silico prediction that the AP2-associated motif is part of a bipartite NLS. Bipartite signals consist of two stretches of basic amino acids that are specifically recognized by α-importins (Lange et al., 2007). This protein complex is then recognized by β-importin in the cytoplasm, forming a trimeric complex capable of correct nuclear import. The core AP2-associated motif is highly conserved in other ABI4 proteins and even in members of the AP2 subfamily, but the in silico predictions do not recognize this sequence as a NLS in several of the putative ABI4 orthologs. However, an exact amino acid sequence is not strictly conserved in the bipartite NLS (Dingwall and Laskey, 1998) and, in many cases, the first cluster includes only a few basic residues. Careful analysis showed the presence of basic amino acids in all ABI4 orthologs (Supplemental Figure 1). Our data support that this well conserved motif has an important role in the efficient translocation of ABI4 to the nucleus—a central step for the function of this transcription factor and for its protein accumulation. It is possible that the AP2-associated motif might interact with some regulatory protein(s) that facilitate nuclear import—a question that remains for future analysis.

Regulation of the ABI4 Protein Stability Previous analysis in transgenic plants has shown that the stability of the ABI4 protein is subjected to complex regulation that involves several regions of the protein, and potentially different mechanisms (Finkelstein et al., 2011). This scenario resembles the regulations observed for the ABI3 and ABI5 proteins, where multiple control mechanisms regulate the accumulation of these proteins during specific stages of plant development (Zhang et al., 2005; Stone et al., 2006; Antoni et al., 2011). In addition, the regulation of the ABI4

432


protein stability appears to be different in specific organs such as shoots and roots (Finkelstein et al., 2011). Previous studies have shown that the regulatory mechanism that results in unstable ABI4 protein is present in leaves, since no accumulation of this protein is detected in spite of constitutive expression and high accumulation of its transcript (Finkelstein et al., 2011 and data not shown). In this study, we found that the half-life of the ABI4 protein observed in the protoplast system is not very different from that reported for whole plants (3 h vs 5 h). Initial studies using a deletion analyses in transgenic plants showed that sequences located within the first 224 amino acids are involved in the proteasomal-mediated degradation of ABI4 (Finkelstein et al., 2011). This region, however, includes a putative PEST degradation signal, as well as the highly conserved AP2-associated motif. The AP2-associated/CMIV-1 motif extends over 15 amino acids, but seven of them are invariable in all ABI4 proteins analyzed, and are also conserved in members of the A2 subgroup (Wind et al., 2013). We demonstrated that the deletion of this AP2-associated sequence affects the nuclear localization of ABI4. However, a surprising finding from this work was that this deletion dramatically affects the trans-activator capacity of this protein but results in higher ABI4 protein accumulation. A possible explanation of these results is that regulation of the ABI4 protein stability takes place inside the nucleus and defects in the nucleus transport affect protein turnover resulting in its accumulation. Proper nuclear localization is an essential step for correct function of many transcriptional factors and, in many cases, this event is regulated either by interaction with other proteins or by the presence of cofactors in specific cell types. It has also been demonstrated that sequences just beyond the NLS signal can be modified by acetylation, phosphorylation, or by disulfide bond formation under certain conditions or presence in a cellular compartment important for activity and/or stability (Jans et al., 1995; Poon and Jans, 2005). Protein modifications are known to affect the recognition of the targets by the E3 ligases of the ubiquitin–26S proteasome system (Vierstra, 2009). The PEST motif has been associated with proteolysis of different proteins (Rechsteiner and Rogers, 1996). Although there is not strict conservation in amino acid sequence in this region, our in silico analysis showed an enrichment of serine (S) and threonine (T) residues among the different ABI4 proteins (Supplemental Figure 6), which are characteristic of PEST domains (Rechsteiner and Rogers, 1996). Accordingly, potential PEST motifs were predicted in most of the ABI4 proteins (Supplemental Table 2). In this study, we provide unequivocal evidence for the role of the PEST motif as a major determinant that modulates the turnover of the Arabidopsis ABI4 protein. Although more experiments are needed in order to unravel the mechanism and factors by which this PEST sequence is recognized, our results also demonstrate that the proteasome pathway mediates this proteolysis. An interesting possibility is that ABI4 could

undergo a modification inside the nucleus that is required for its turnover mediated by the PEST motif. In agreement with this idea, we observed that accumulation level of the ABI4–∆P::GFP protein is very similar in the absence or presence of the proteasome inhibitor MG132, supporting that this sequence is responsible for the degradation by the proteasome of ABI4. Finally, a dual regulation of the nuclear localization and protein turnover is a powerful mechanism for a rapid control in response to particular signals. Various forms of evidence support the role of ABI4 as a node of regulation for multiple signals, including stress and carbon availability. Accordingly, both ABA and sugar levels have been shown to regulate the transcription of ABI4 (Arroyo et al., 2003). In this work, we also showed that, in the protoplast system, glucose, but not ABA, modulates the stability of this transcription factor, similarly to observations in transgenic plants (Finkelstein et al., 2011), demonstrating the independent roles that these signals have in ABI4 regulation. This regulation contrasts with the regulation of other related factors such as ABI3 and ABI5, whose stability is directly modulated by ABA (Zhang et al., 2005; Stone et al., 2006; Vierstra, 2009). Hence, several levels of control may allow a fine-tuning of ABI4 expression and/ or protein accumulation in response to plant requirements. These results provide additional support that the protoplast system is suitable for analyzing the mechanism involved in ABI4 regulation.

METHODS Alignment of Putative ABI4 Ortholog Proteins The full-length protein sequences of the putative ABI4 ortholog proteins (Supplemental Table 1) were obtained from plant genome resources found in phytozome v8.0 (www. phytozome.org/), the National Center for Biotechnology Information (NCBI), or from the following resources: T. cacao (www.cacaogenomedb.org), Lotus japonicus (www.kazusa. or.jp/), Solanum tuberosum (http://solgenomics.net/), and Fragaria vesca (www.rosaceae.org/). The sequence of Utricularia gibba ABI4 was provided by Dr Luis Herrera Estrella (personal communication; Supplemental Table 1). Alignment was performed using the ClustalW program included in the Mega 5.0 package (Tamura et al., 2011). Multiple alignment was performed using a Blosum protein weight matrix with a gap penalty of 10 and gap extension penalty of 2. To obtain the best alignment, manual edition was performed at divergent regions that include the amino- (covering the PEST sequence) and the carboxy-termini (the acidic domain after the LRP motif) of the protein.

Prediction of the PEST Sequences Search for potential PEST sequences was performed using the PESTfind program (version 6.3.1), available online in The


European Molecular Biology Open Software Suite (http:// mobyle.pasteur.fr/cgi-bin/portal.py?#forms::epestfind) (Rice et al., 2000). We used the input parameters in all cases, producing scores values ranging from –55.0 to +55.0 for each of the putative ABI4 ortholog proteins (Supplemental Table 2). By definition, a score above zero denotes a possible PEST sequence.

Isolation of the Theobroma cacao ABI4 Gene and Complementation Total DNA from T. cacao was isolated as previously reported (Haymes et al., 2004). The DNA was treated with RNase (ROCHE, Indianapolis, USA) and used for PCR reaction. A 987-bp fragment was amplified from total DNA using the TcABI4–F (5′-CACCATGGACCAGGACCAGGA-3′) and TcSacI-R (5′-GGCGAGCTCTCAGAAATCAAAAAAG-3′) oligonucleotides and cloned into the pENTR/D–TOPO vector (Invitrogen, California, USA). The identity of this fragment was confirmed by sequence. The TcABI4 full open reading frame was subcloned into the pJD301 vector (Leon et al., 1991) using the NcoI and SacI restriction sites replacing the luciferase gene, to generate the p35S::TcABI4 effector plasmid. For complementation, the TcABI4 gene was recombined into the pK2GW7 vector (Karimi et al., 2002). This construct was transformed into homozygous abi4-1 plants through the floral dip method (Clough and Bent, 1998). Independent lines were identified based on their kanamycin resistance (50 μg ml–1). The presence of the transgene was corroborated by PCR. To break dormancy, seeds were vernalized for 4 d. Seedlings were grown under sterile conditions in 1×GM; Murashige and Skoog basal salts with Gamborg vitamins (Phyto Technology Laboratories, Shawnee Mission, KS) media supplemented with 1% (w/v) sucrose, 0.05% (w/v) MES, with 0.8% (w/v) phytoagar supplemented with 1 or 3 μM of ABA (Sigma-Aldrich, Steinheim, Germany). Complementation analysis of the TcABI4 gene was carried out in three independent lines in 1X GM supplemented with 3 μM of ABA (Sigma-Aldrich, Steinheim, Germany); 150 mM of NaCl (J.T. Kaker, Pennsylvania, USA), and 353 mM (7%) of glucose (Research Organics, Cleveland, Ohio). Seedlings were grown under 16:8 h light:dark cycle (100 μmol m–2 s–1) at 22ºC for the indicated days prior to evaluating ABA, glucose, or NaCl sensitivity.

Plasmid Constructions To generate constructs containing the AP2-associated motif, we amplified a fragment of 511 bp from the ABI4 transcription start site to the end of the AP2 domain using the ABI4–Fw-Ti (5′-CACCGCACCGCCCTAATCGACC-3′) and the ABI4Rv–AP2 (5′-GGAGGAAGGAGAGAAGGGGT-3′) oligonucleotides. A fragment lacking AP2-associated motif (277 bp) was generated by PCR using the ABI4–Fw-Ti and the ABI4–RV-PEST (5′-TTGAGCGGAGGAAGTTGATGA-3′) oligonucleotides. Both fragments were cloned into the pENTR/D/TOPO and then transferred into the pEarlyGate103 destination vector (Earley

433

et al., 2006), by LR recombination according to the manufacturer’s instructions (Invitrogen, CA, USA) to generate the fusion proteins with the GFP protein marker. Deletion of the AP2-associated motif was accomplished through a PCR-based strategy. Two PCR products were amplified and then mixed in equimolar concentrations to obtain the full-length ABI4 deleted in the AP2-associated motif. The first PCR 145-bp product was amplified with the ABI4F– ATG (5′-CACCATGGACCCTTTAGCTTCC-3′) and the DelAP2asR ( 5 ′ - T C G A A C G C C A C G G TA A G C G G A G G A A G T T G AT G A GTCGGTGGT-3′) oligonucleotides. The second amplification was obtained with the DelAP2asF (5′-TCAACTTCCT C C G C T TA C C G T G G C G T T C G A C A A A G A A G C T G G - 3 ′ ) and the ABI4–RBamHI (5′-CATCTCCAACCATATAACCCGG-3′) oligonucleotides. Both PCR products were mixed and a final product of 842 bp was amplified using the ABI4F–ATG and ABI4–RBamHI oligonucleotides. The PCR product lacking the AP2-associated motif was digested with NcoI and SacI restriction enzymes and then subcloned into the pENTR–ABI4, replacing the wild-type sequence, generating the pENTR– ABI4–∆APaM (AP2-associated motif). Deletion of the AP2associated motif was corroborated by sequence. Finally, the pENTR–ABI4–∆APaM was transferred into the pEarlyGate103 destination vector (Earley et al., 2006). To generate the p35S::ABI4–∆APaM effector plasmid, an NcoI and SacI fragment from the pENTR–ABI4–∆APaM containing the deletion in the AP2-associated motif was used to replace the wild-type sequence in the p35S::ABI4 plasmid (Bossi et al., 2009). Mutation of the LRP motif was obtained using a similar strategy. Two mutagenic oligonucleotides: LRPmut-F (5′-CTCCACTCAAACCGCAGCAGCTGCCGCCGCTGCCGCCGCC GCCGCCACCGTAGGAGGAGG-3′) and LRPmut-R (5′-CGGTGG CGGCGGCGGCGGCAGCGGCGGCAGCTGCTGCGGTT TGAGTGGAGGAAGAGGAGG-3′) that includes a PvuII restriction site (underlined) were used to generate two different PCR products combining the ABI4NcoI-F (5′-GGGCCATGGACCCTTTAGCTTC-3′) primer with the LRPmut-R oligonucleotide and the other with the LRPmut-F and the ABI4R3nstp (5′-ATAGAATTCCCCCAAGATGGG-3′) primer. These two PCR products were used as template for a second amplification using the ABI4NcoI-F and ABI4R3nstp oligonucleotides. The final PCR product containing the mutation in the LRP motif was digested with NcoI and SacI enzymes and was used to replace the wild-type sequence in the p35S::ABI4 plasmid (Bossi et al., 2009) to generate the p35S::ABI4–mLRP vector. The mutation of the LRP motif was confirmed by sequence. The fusion protein between the ABI4–mLRP and GFP was generated by amplifying the full ABI4–mLRP open reading frame with the ABI4Fatg (5′-CACCATGGACCCTTTAGCTTCC-3′) and ABI4R3nstp as 5′ and 3′ oligonucleotides. The PCR product was cloned into the pENTR/D–TOPO vector (Invitrogen, California, USA) and recombined into the pEarlyGate-103 vector (Earley et al., 2006). For deletion of the PEST motif, the 19 amino acids predicted as a PEST sequence (HNNPQSDSTTDSSTSSAQR)

434


were removed through a PCR-based methodology. Initially, an 890-bp PCR fragment was amplified using the ABI4∆PEST-F primer that includes the PEST deletion (5′-AACCATCTGGAAGATAATAACCAAACCCTAACCCGCAAAC GCAAAGGCAAA-3′) and, as the 3′ primer, the ABI4NcoIStp-R (5′-CCCACCATGGGATCAATAAAAT-3′) oligonucleotide. This amplified fragment includes 57-bp deletion of the PEST motif, but lacks the first 10 amino acids of the ABI4 protein. These amino acids were reconstituted in a second PCR amplification using as 5′ oligonucleotide the ABI4ATGNcoI-F primer that includes the missing ABI4 amino acids (5′-GGGCCATGGACCCTTTAGCTTC CCAACATCAACACAACCATCTGGAAGAT-3′) and the ABI4NcoIStp-R oligonucleotide as the 3′ primer. The fulllength ABI4 product deleted from the PEST sequence was cloned into the pCR2.1–TOPO vector (Invitrogen, Carlsbad, CA, USA) generating the pCR–ABI4–∆P plasmid and confirmed by sequence. The p35S::ABI4–∆P effector plasmid used in the transactivation assays was generated by replacing a 620-bp NcoI/SacI fragment containing the deletion of the PEST sequence into the p35S::ABI4 plasmid (Bossi et al., 2009). For generation of the ABI4::GFP fusion proteins, the fulllength ABI4 or ABI4–∆P sequences were amplified with ABI4Fatg and ABI4R3nstp oligonucleotides and then cloned into the pENTR/D/TOPO vector (GATEWAY; Invitrogen, Carlsbad, CA, USA). Both constructs were recombined into the pEarlyGate-103 (Earley et al., 2006) generating the p35S::ABI4–GFP or the p35S::ABI4∆P–GFP constructs.

Transient Expression Assays The reporter construct used for the transactivation assays was the pABI4–CE1::LUC previously described (Bossi et al., 2009). The effector plasmids used included the p35S::ABI4 (Bossi et al., 2009), the p35S::TcABI4, the p35S::ABI4–∆P, p35S::ABI4ΔApaM, and the p35S::ABI4mLRP. Transient assays were performed using Arabidopsis mesophyll protoplasts from 3-week-old Col-0 plants following the protocol described by Yoo and co-workers (2007). Protoplasts were transformed with 10 μg of the reporter plasmid and 20 μg of the effector plasmids. In those samples where no effector was included, 20 μg of empty vector was used to normalize total DNA concentration. Luciferase activity was measured as recommended (Promega, Madison, WI, USA) using a Monolight 2010 luminometer (Analytical Luminescence Laboratories San Diego, CA, USA). To normalize transfection efficiency, the p35S::GUS plasmid was co-transfected in each experiment (Leon et al., 1991). Expression analysis was performed 15 h after transformation and reported as luciferase-specific activity corrected by GUS-specific activity.

GFP Subcellular Localization Confocal images were obtained using a Carl Zeiss LSM510 META laser scanning microscope (www.zeiss.com/), equipped for excitation with an argon (Ar2) 488-nm laser.

Protein Accumulation Measurements and Degradation Assays ABI4 protein levels were followed using fusion proteins with the GFP reporter gene. Total protein extracts were obtained from the protoplast samples 15 h after transformation in SDS sample buffer (0.125 M Tris-Cl, pH 6.8, 20% (v/v) glycerol, 4% (w/v) SDS, and 2% (v/v) β-mercaptoethanol). The protein concentration was determined with Bradford reagent (Bio-Rad, Hercules, CA), and then separated in a 12% SDS–PAGE gel. The proteins were transferred onto nitrocellulose (Hybond C; Amersham-Pharmacia Biotech, Buckinghamshire, UK) by electroblotting for 1 h at 200 mA in 25 mM Tris, 0.2 M glycine, and 20% (w/v) methanol. To verify equal loading, the membrane was stained with Ponceau (Mallinckrodt Chemical, Raleigh, NC, USA). Immunodetection was performed using a 1:10 000 dilution of mouse anti-GFP antibody (Zymed, Invitrogen Carlsbad, CA, USA) followed by chemiluminescence detection (Thermo Scientific, Rockford, IL, USA) using a secondary anti-mouse Horse Radish Peroxidase antibody (Invitrogen, Carlsbad, CA, USA). ABA (1 μM) or glucose (150 mM) was added after the transformation of protoplasts and incubated for 15 h similarly to other analyses. To access the half-life of the ABI4 protein, 12 h after transformation, protoplasts were incubated with 50 μM of cycloheximide (Sigma-Aldrich, Steinheim, Germany). Samples were taken at 2, 4, and 6 h after cycloheximide treatment. For the experiments with the proteasome inhibitor MG132 (10 μM; Sigma-Aldrich, Steinheim, Germany), the cycloheximide and the inhibitor were added to the protoplast 12 h after transformation and incubated for 4 h prior to analysis.

SUPPLEMENTARY DATA Supplementary Data are available at Molecular Plant Online.

FUNDING This work was supported by Consejo Nacional de Ciencia y Tecnología (CONACyT) 127546 and Dirección General de Asuntos para el personal académico-UNAM (PAPIIT-DGAPA IN208211-3) grants. AHB was supported by a master fellowship from CONACyT.

Acknowledgments We would like to thank Maricela Ramos Vega for her technical support and Dr Monica Santos for kindly providing T. cacao material and for her helpful comments. Drs Mari Salmi and Keneth Luhersen for editing and comments on the manuscript. No conflict of interest declared.

References Acevedo-Hernandez, G.J., Leon, P., and Herrera-Estrella, L.R. (2005). Sugar and ABA responsiveness of a minimal RBCS


light-responsive unit is mediated by direct binding of ABI4. Plant J. 43, 506–519. Agarwal, P., Agarwal, P.K., Nair, S., Sopory, S.K., and Reddy, M.K. (2007). Stress-inducible DREB2A transcription factor from Pennisetum glaucum is a phosphoprotein and its phosphorylation negatively regulates its DNA-binding activity. Mol. Genet. Genomics. 277, 189–198. Allen, M.D., Yamasaki, K., Ohme-Takagi, M., Tateno, M., and Suzuki, M. (1998). A novel mode of DNA recognition by a beta-sheet revealed by the solution structure of the GCCbox binding domain in complex with DNA. EMBO J. 17, 5484–5496. Antoni, R., Rodriguez, L., Gonzalez-Guzman, M., Pizzio, G.A., and Rodriguez, P.L. (2011). News on ABA transport, protein degradation, and ABFs/WRKYs in ABA signaling. Curr. Opin. Plant Biol. 14, 547–553. Arenas-Huertero, F., Arroyo, A., Zhou, L., Sheen, J., and Leon, P. (2000). Analysis of Arabidopsis glucose insensitive mutants, gin5 and gin6, reveals a central role of the plant hormone ABA in the regulation of plant vegetative development by sugar. Genes Dev. 14, 2085–2096. Arroyo, A., Bossi, F., Finkelstein, R.R., and Leon, P. (2003). Three genes that affect sugar sensing (abscisic acid insensitive 4, abscisic acid insensitive 5, and constitutive triple response 1) are differentially regulated by glucose in Arabidopsis. Plant Physiol. 133, 231–242. Baena-Gonzalez, E., Rolland, F., Thevelein, J.M., and Sheen, J. (2007). A central integrator of transcription networks in plant stress and energy signalling. Nature. 448, 938–942. Bossi, F., Cordoba, E., Dupre, P., Mendoza, M.S., Roman, C.S., and Leon, P. (2009). The Arabidopsis ABA-INSENSITIVE (ABI) 4 factor acts as a central transcription activator of the expression of its own gene, and for the induction of ABI5 and SBE2.2 genes during sugar signaling. Plant J. 59, 359–374.

435

Finkelstein, R., Lynch, T., Reeves, W., Petitfils, M., and Mostachetti, M. (2011). Accumulation of the transcription factor ABAinsensitive (ABI)4 is tightly regulated post-transcriptionally. J. Exp. Bot. 62, 3971–3979. Finkelstein, R.R., Gampala, S.S., and Rock, C.D. (2002). Abscisic acid signaling in seeds and seedlings. Plant Cell. 14 Suppl, S15–S45. Finkelstein, R.R., Wang, M.L., Lynch, T.J., Rao, S., and Goodman, H.M. (1998). The Arabidopsis abscisic acid response locus ABI4 encodes an APETALA 2 domain protein. Plant Cell. 10, 1043–1054. Giraud, E., Van Aken, O., Ho, L.H., and Whelan, J. (2009). The transcription factor ABI4 is a regulator of mitochondrial retrograde expression of ALTERNATIVE OXIDASE1a. Plant Physiol. 150, 1286–1296. Haymes, K.M., Ibrahim, I.A., Mischke, S., Scott, D.L., and Saunders, J.A. (2004). Rapid isolation of DNA from chocolate and date palm tree crops. J. Agric. Food Chem. 52, 5456–5462. Hu, Y.F., Li, Y.P., Zhang, J., Liu, H., Tian, M., and Huang, Y. (2012). Binding of ABI4 to a CACCG motif mediates the ABA-induced expression of the ZmSSI gene in maize (Zea mays L.) endosperm. J. Exp. Bot. 63, 5979–5989. Huijser, C., Kortstee, A., Pego, J., Weisbeek, P., Wisman, E., and Smeekens, S. (2000). The Arabidopsis SUCROSE UNCOUPLED-6 gene is identical to ABSCISIC ACID INSENSITIVE-4: involvement of abscisic acid in sugar responses. Plant J. 23, 577–585. Jans, D.A., Moll, T., Nasmyth, K., and Jans, P. (1995). Cyclindependent kinase site-regulated signal-dependent nuclear localization of the SW15 yeast transcription factor in mammalian cells. J. Biol. Chem. 270, 17064–17067. Kaliff, M., Staal, J., Myrenas, M., and Dixelius, C. (2007). ABA is required for Leptosphaeria maculans resistance via ABI1- and ABI4dependent signaling. Mol. Plant–Microbe Interact. 20, 335–345.

Brameier, M., Krings, A., and MacCallum, R.M. (2007). NucPred: predicting nuclear localization of proteins. Bioinformatics. 23, 1159–1160.

Kang, S.G., Price, J., Lin, P.C., Hong, J.C., and Jang, J.C. (2010). The Arabidopsis bZIP1 transcription factor is involved in sugar signaling, protein networking, and DNA binding. Mol. Plant. 3, 361–373.

Cho, J.I., Ryoo, N., Eom, J.S., Lee, D.W., Kim, H.B., Jeong, S.W., Lee, Y.H., Kwon, Y.K., Cho, M.H., and Bhoo, S.H. (2009). Role of the rice hexokinases OsHXK5 and OsHXK6 as glucose sensors. Plant Physiol. 149, 745–759.

Karimi, M., Inze, D., andDepicker, A. (2002). GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci. 7, 193–195.

Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743. Cui, H., Hao, Y., and Kong, D. (2012). SCARECROW has a SHORTROOT-independent role in modulating the sugar response. Plant Physiol. 158, 1769–1778. Dietz, K.J., Vogel, M.O., and Viehhauser, A. (2010). AP2/EREBP transcription factors are part of gene regulatory networks and integrate metabolic, hormonal and environmental signals in stress acclimation and retrograde signalling. Protoplasma. 245, 3–14. Dingwall, C., and Laskey, R.A. (1998). Nuclear import: a tale of two sites. Curr. Biol. 8, R922–R924. Earley, K.W., Haag, J.R., Pontes, O., Opper, K., Juehne, T., Song, K., and Pikaard, C.S. (2006). Gateway-compatible vectors for plant functional genomics and proteomics. Plant J. 45, 616–629.

Kerchev, P.I., Pellny, T.K., Vivancos, P.D., Kiddle, G., Hedden, P., Driscoll, S., Vanacker, H., Verrier, P., Hancock, R.D., and Foyer, C.H. (2011). The transcription factor ABI4 is required for the ascorbic acid-dependent regulation of growth and regulation of jasmonate-dependent defense signaling pathways in Arabidopsis. Plant Cell. 23, 3319–3334. Koussevitzky, S., Nott, A., Mockler, T.C., Hong, F., SachettoMartins, G., Surpin, M., Lim, J., Mittler, R., and Chory, J. (2007). Signals from chloroplasts converge to regulate nuclear gene expression. Science. 316, 715–719. Laby, R.J., Kincaid, M.S., Kim, D., and Gibson, S.I. (2000). The Arabidopsis sugar-insensitive mutants sis4 and sis5 are defective in abscisic acid synthesis and response. Plant J. 23, 587–596. Lange, A., Mills, R.E., Lange, C.J., Stewart, M., Devine, S.E., and Corbett, A.H. (2007). Classical nuclear localization signals: definition, function, and interaction with importin alpha. J. Biol. Chem. 282, 5101–5105.

436


Leon, P., Planckaert, F., and Walbot, V. (1991). Transient gene expression in protoplasts of Phaseolus vulgaris isolated from a cell suspension culture. Plant Physiol. 95, 968–972. Liu, Z.Q., Yan, L., Wu, Z., Mei, C., Lu, K., Yu, Y.T., Liang, S., Zhang, X.F., Wang, X.F., and Zhang, D.P. (2012). Cooperation of three WRKY-domain transcription factors WRKY18, WRKY40, and WRKY60 in repressing two ABA-responsive genes ABI4 and ABI5 in Arabidopsis. J. Exp. Bot. 63, 6371–6392. Mizoi, J., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2012). AP2/ ERF family transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta. 1819, 86–96. Niu, X., Helentjaris, T., and Bate, N.J. (2002). Maize ABI4 binds coupling element1 in abscisic acid and sugar response genes. Plant Cell. 14, 2565–2575. Okamuro, J.K., Caster, B., Villarroel, R., Van Montagu, M., and Jofuku, K.D. (1997). The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis. Proc. Natl Acad. Sci. U S A. 94, 7076–7081. Oswald, O., Martin, T., Dominy, P.J., and Graham, I.A. (2001). Plastid redox state and sugars: interactive regulators of nuclearencoded photosynthetic gene expression. Proc. Natl Acad. Sci. U S A. 98, 2047–2052. Pence, V.C. (1991). Abscisic acid in developing zygotic embryos of Theobroma cacao. Plant Physiol. 95, 1291–1293. Penfield, S., Li, Y., Gilday, A.D., Graham, S., and Graham, I.A. (2006). Arabidopsis ABA INSENSITIVE4 regulates lipid mobilization in the embryo and reveals repression of seed germination by the endosperm. Plant Cell. 18, 1887–1899. Poon, I.K., and Jans, D.A. (2005). Regulation of nuclear transport: central role in development and transformation? Traffic. 6, 173–186. Quesada, V., Ponce, M., and Micol, J. (2000). Genetic analysis of salt-tolerant mutants in Arabidopsis thaliana. Genetics. 154, 421–436. Rechsteiner, M., and Rogers, S.W. (1996). PEST sequences and regulation by proteolysis. Trends Biochem. Sci. 21, 267–271. Reeves, W.M., Lynch, T.J., Mobin, R., and Finkelstein, R.R. (2011). Direct targets of the transcription factors ABA-Insensitive(ABI)4 and ABI5 reveal synergistic action by ABI4 and several bZIP ABA response factors. Plant Mol. Biol. 75, 347–363. Rice, P., Longden, I., and Bleasby, A. (2000). EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 16, 276–277. Riechmann, J.L., and Meyerowitz, E.M. (1998). The AP2/EREBP family of plant transcription factors. Biol. Chem. 379, 633–646. Rogers, S., Wells, R., and Rechsteiner, M. (1986). Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science. 234, 364–368. Rook, F., Corke, F., Baier, M., Holman, R., May, A.G., and Bevan, M.W. (2006). Impaired sucrose induction1 encodes a conserved plant-specific protein that couples carbohydrate availability to gene expression and plant growth. Plant J. 46, 1045–1058.

Sakuma, Y., Liu, Q., Dubouzet, J.G., Abe, H., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2002). DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem. Biophys. Res. Commun. 290, 998–1009. Sakuma, Y., Liu, Q., Dubouzet, J.G., Abe, H., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2006). Functional analysis of an Arabidopsis transcription factor, DREB2A, involved in droughtresponsive gene expression. Plant Cell. 18, 1292–1309. Shigyo, M., Hasebe, M., and Ito, M. (2006). Molecular evolution of the AP2 subfamily. Gene. 366, 256–265. Shkolnik-Inbar, D., and Bar-Zvi, D. (2010). ABI4 mediates abscisic acid and cytokinin inhibition of lateral root formation by reducing polar auxin transport in Arabidopsis. Plant Cell. 22, 3560–3573. Shkolnik-Inbar, D., Adler, G., and Bar-Zvi, D. (2013). ABI4 downregulates expression of the sodium transporter HKT1;1 in Arabidopsis roots and affects salt tolerance. Plant J. 73, 993–1005. Signora, L., De Smet, I., Foyer, C.H., and Zhang, H. (2001). ABA plays a central role in mediating the regulatory effects of nitrate on root branching in Arabidopsis. Plant J. 28, 655–662. Soderman, E.M., Brocard, I.M., Lynch, T.J., and Finkelstein, R.R. (2000). Regulation and function of the Arabidopsis ABAinsensitive4 gene in seed and abscisic acid response signaling networks. Plant Physiol. 124, 1752–1765. Stone, S.L., Williams, L.A., Farmer, L.M., Vierstra, R.D., and Callis, J. (2006). KEEP ON GOING, a RING E3 ligase essential for Arabidopsis growth and development, is involved in abscisic acid signaling. Plant Cell. 18, 3415–3428. Sun, X., Feng, P., Xu, X., Guo, H., Ma, J., Chi, W., Lin, R., Lu, C., and Zhang, L. (2011). A chloroplast envelope-bound PHD transcription factor mediates chloroplast signals to the nucleus. Nat. Commun. 2, 477. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Vierstra, R.D. (2009). The ubiquitin-26S proteasome system at the nexus of plant biology. Nat. Rev. Mol. Cell Biol. 10, 385–397. Wind, J.J., Peviani, A., Snel, B., Hanson, J., and Smeekens, S.C. (2013). ABI4: versatile activator and repressor. Trends Plant Sci. 18, 125–132. Yang, Y., Yu, X., Song, L., and An, C. (2011). ABI4 activates DGAT1 expression in Arabidopsis seedlings during nitrogen deficiency. Plant Physiol. 156, 873–883. Yoo, S.D., Cho, Y.H., and Sheen, J. (2007). Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat. Protoc. 2, 1565–1572. Zhang, X., Garreton, V., and Chua, N.H. (2005). The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation. Genes Dev. 19, 1532–1543.