JOURNAL OF VIROLOGY, July 2002, p. 6609–6617 0022-538X/02/$04.00⫹0 DOI: 10.1128/JVI.76.13.6609–6617.2002 Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Vol. 76, No. 13
Characterization of Producer Cell-Dependent Restriction of Murine Leukemia Virus Replication Fatima Serhan, Nathalie Jourdan, Sylvie Saleun, Philippe Moullier, and Ghislaine Duisit* Laboratoire de Thérapie Génique, INSERM ERM 0-105, CHU Hotel Dieu, 44035 Nantes Cedex 01, France Received 8 February 2002/Accepted 21 March 2002
We previously reported that the human bronchocarcinoma cell line A549 produces poorly infectious gibbon ape leukemia virus-pseudotyped Moloney murine leukemia virus (MLV). In contrast, similar amounts of virions recovered from human fibrosarcoma HT1080 cells result in 10-fold-higher transduction rates (G. Duisit, A. Salvetti, P. Moullier, and F. Cosset, Hum. Gene Ther. 10:189-200, 1999). We have now extended this initial observation to other type-C envelope (Env) pseudotypes and analyzed the mechanism involved. Structural and morphological analysis showed that viral particles recovered from A549 (A549-MLV) and HT1080 (HT1080-MLV) cells were normal and indistinguishable from each other. They expressed equivalent levels of mature Env proteins and bound similarly to the target cells. Furthermore, incoming particles reached the cytosol and directed the synthesis of linear viral DNA equally efficiently. However, almost no detectable circular DNAs could be detected in A549-MLV-infected cells, indicating that the block of infection resulted from defective nuclear translocation of the preintegration complex. Interestingly, pseudotyping of A549-MLV with vesicular stomatitis virus glycoprotein G restored the amount of circular DNA forms as well as the transduction rates to HT1080-MLV levels, suggesting that the postentry blockage could be overcome by endocytic delivery of the core particles downstream of the restriction point. Thus, in contrast to the previously described target cell-dependent Fv-1 (or Fv1-like) restriction in mammalian cells (P. Pryciak and H. E. Varmus, J. Virol. 66:5959-5966, 1992; G. Towers, M. Bock, S. Martin, Y. Takeuchi, J. P. Stoye, and O. Danos, Proc. Natl. Acad. Sci. USA 97:12295-12299, 2000), we report here a new restriction of MLV replication that relies only on the producer cell type.
and packaging. Finally, the cytoplasmic tail of lentiviral Env proteins harbors a Tyr-based signal that is responsible for the sorting and trafficking of the envelope glycoproteins (6, 16). This motif interacts with components of the clathrin adaptor complexes and participates in regulating Env cell surface expression (4). Moreover, analysis of two HIV-1 mutants suggested the involvement of an unknown cell factor in viral Env incorporation (2, 46). Other host factors may be implicated in the late stage of retrovirus assembly. Budding and final virus-cell separation are mediated by a proline-rich domain of the Gag proteins. This “L-domain,” containing a proline-rich consensus motif, is located in different positions in the Gag proteins of various retroviruses (28, 48, 53, 71, 72, 74). The domain may serve as the docking site for specific host proteins, as the sequence is a nearly perfect match to the consensus binding site of the WW domain, a widely used interaction domain in many cellular proteins (23), involved in cytoskeletal function, signal transduction, and regulatory events (62–64). Recently, several groups demonstrated a functional relationship between the L-domain and the cell ubiquitin conjugation machinery (51, 58, 61, 68, 69). Retrovirus particles actually contain a fraction of ubiquitinated Gag proteins, and that particular posttranslational modification requires the presence of the L-domain. Depletion of free ubiquitin from the cell by use of proteasome inhibitors prevents both the processing of Gag polypeptides and the release of extracellular particles. The L-domain may indeed recruit ubiquitin ligases at the sites of assembly, which in turn may activate cell factors involved in the processing of Gag polypeptides (58, 61, 68).
Retroviruses are enveloped positive-sense RNA viruses that carry at least three open reading frames: gag, pol, and env. Capsids of type-C retroviruses such as Moloney murine leukemia virus (MoMLV) and human immunodeficiency virus type 1 (HIV-1) assemble at the plasma membrane after the transport of Gag and Gag-Pol proteins through the cytoplasm as monomers or small oligomers (13). Oligomerization of these polypeptides is sufficient to direct the formation and budding of viral particles. Gag polypeptides are cleaved by the viral protease during the assembly or immediately after the release of the particle into the extracellular medium, leading to virion maturation. Some host cell factors are thought to participate in the transport of viral components to the plasma membrane and/or in their incorporation within the nascent virions. For instance, Gag proteins associate with cytoskeleton-related proteins such as actin, ezrin, moesin, and cofilin (36, 54) and with KIF-4, a microtubule-associated motor protein (65). Several cytoskeletal proteins are even incorporated within HIV-1 particles (47). The actual trafficking of Gag is poorly understood, but an active role of the cytoskeleton has been proposed (36). Similarly, cell factors seem to be involved in the transport of viral genomes through the cytoplasm. RNA-binding proteins such as Staufen (44) and hnRNP-A2 (45) are able to bind HIV-1 genomic RNA. They may participate in viral RNA selection
* Corresponding author. Mailing address: INSERM ERM 0-105, CHU Hôtel-Dieu, 30, bvd Jean Monnet, 44035 Nantes Cedex 01, France. Phone: (33) 240087490. Fax: (33) 240087491. E-mail:
[email protected]. 6609
6610
SERHAN ET AL.
Multiple blocks to HIV replication in insect (50) or rodent (5, 40) cells suggest the involvement of species-specific factors during lentivirus assembly. Importantly, the blocks to infectious-virus production are recessive, since they can be rescued by fusion with uninfected human HOS cells (5). Also, the requirement of HIV for Vif, a late viral protein that acts during assembly to promote the early steps of infection, is limited to virions produced from peripheral blood lymphocytes, macrophages, and some rare T-lymphoid cell lines; it is dispensable when particles are generated from COS, HeLa, or 293 cells (21, 70, 75). Recently, Vif was reported to counteract the dominant inhibition mediated by the tyrosine kinase Hck expressed in the restrictive producer cells (26). The importance of the cell type used to produce the retrovirus vectors is further exemplified by the production of MoMLV-derived vectors, which are produced in a wide range of rodent and nonrodent cells but at various efficiencies (14, 18). We previously showed that, in contrast to HT1080 cells, A549 cells were unable to produce high-titer gibbon ape leukemia virus (GALV)pseudotyped murine leukemia virus (MLV) vectors (18). To investigate the mechanism involved in this restriction, replication-defective retrovirus vectors were used in order to avoid asynchronous and multiple rounds of infection, which make it somewhat difficult to distinguish between different steps in the infection cycle. We first extended the initial observation to other type-C retrovirus envelopes and to a range of cell types. Then we demonstrated that amphotropic MLV particles recovered from A549 cells (A549-MLV) were able to undergo the first infection steps but were blocked between the reverse transcription (RT) and integration steps. Surprisingly, pseudotyping with the vesicular stomatitis virus G (VSVG) glycoprotein was sufficient to restore A549-MLV infectivity to levels similar to those of MLV particles recovered from HT1080 cells (HT1080-MLV), suggesting that the defect might be bypassed by delivering the core particles to a different cytosolic compartment. These results suggest that a producer cell cofactor or imprinting process present during assembly dramatically influences MLV infectivity by modulating a postentry event. MATERIALS AND METHODS Cells. A549 cells (ATCC CCL185) are derived from a human bronchocarcinoma; HT1080 cells (ATCC CCL2) are derived from a human fibrosarcoma; TE671 cells (ATCC CRL8805) are derived from a human medulloblastoma; 293 cells (ATCC CRL 1573) are derived from human kidney embryonic epithelia; HeLa cells (ATCC CCL2) are derived from an ovarian carcinoma; NIH 3T3 cells (ATCC CRL1658) are derived from a murine embryo fibroblast; and XC cells (ATCC CCL165) are from a rat epithelial sarcoma (a kind gift from F. L. Cosset). Cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Sigma) supplemented with 10% fetal calf serum (FCS). Plasmids. The pMFG-nlsLacZ plasmid harbors a retrovirus vector carrying the -galactosidase reporter gene under the control of the long terminal repeat (LTR) promoter (29). Plasmid pCMV/pA was first obtained by cloning the cytomegalovirus (CMV) early promoter and bidirectional simian virus 40 (SV40) poly(A) sequences from pCZPG (17) into plasmid pBluescript II KS(⫹) (Stratagene). The EcoRI-digested VSVG gene was recovered from pCZPG and inserted into pCMV/pA. The 4070A-Env gene was extracted from the pFBdelASAF plasmid (kindly provided by F. L. Cosset). The 2.0-kb BglII-KasI fragment was cloned into pCMV/pA (BamHI site) after addition of a BglII linker at the 3⬘ end. All retrovirus expression cassettes were finally inserted into the pShuttle plasmid (kindly provided by B. Vogelstein). This shuttle plasmid is used for rapid generation of replication-defective recombinant adenoviruses (27).
J. VIROL. Production of recombinant adenoviruses. Adgag-pol has been described previously (18). Other adenoviruses from which E1 and E3 were deleted were generated by using the AdEasy system described by He et al. (27). Recombinant adenoviruses were titered by using a replication center assay. The protocol, originally described for the titration of adenovirus-associated vectors (55), was modified to allow the quantification of infectious adenovirus particles. Briefly, 293 cells were seeded at 8 ⫻ 104 cells/well in 48-well plates. The next day, they were infected with serially diluted vectors. Cells were trypsinized 36 h later and filtered through a Zetaprobe membrane (Bio-Rad). Filters were then soaked in 0.5 M NaOH–1.5 M NaCl for 5 min, neutralized in 1 M Tris-HCl (pH 7.0)–2⫻ SSC (1⫻ SSC is 0.15 M NaCl plus 0.015 M sodium citrate), and finally incubated with a fluorescein-labeled nucleic probe hybridizing to the DNA-binding-protein (DBP) gene. Infectious adenovirus particles were quantified by counting the number of spots (corresponding to individual viral replication events on infected 293 cells). Production of recombinant retroviruses and infectivity assays. Recombinant retroviruses were obtained as described previously (18). Briefly, A549 and HT1080 cells were seeded at 5 ⫻ 106 cells in 10-cm-diameter plates. The next day, they were infected with recombinant adenoviruses at various multiplicities of infection (MOIs), as indicated in the text, for 2 h in DMEM supplemented with 2% FCS. Cells were then washed once with phosphate-buffered saline (PBS) and left in DMEM–10% FCS. Twenty-four hours later, the culture medium was replaced by DMEM–2% FCS. Twelve hours later, supernatants were recovered, filtered through a 0.45-m-pore-size filter, and used for titration and transduction assays. Viral titrations were carried out on TE671 indicator cells as described previously (18). Before each transduction assay, the amounts of A549-MLV and HT1080-MLV present in the respective culture media were compared by Western blotting. Both serially diluted supernatants were loaded onto a sodium dodecyl sulfate (SDS)–10% polyacrylamide gel and transferred to a nitrocellulose membrane after electrophoresis. Virions were detected by using an antiserum raised against Rauscher leukemia virus p30 capsid protein (Quality Biotech, Camden, N.J.). Relative amounts of total particles were estimated by autoradiography in which the film was not overexposed. One day prior to retrovirus infection, TE671 cells were seeded at 3 ⫻ 105 cells/well in 6-well plates. They were then incubated for 1 h at 4°C with normalized culture supernatants in a final volume of 800 l of DMEM plus 10% FCS and Polybrene (8 g/ml). To ensure that transduction was solely the result of retrovirus infection rather than being mediated by AdlacZ contamination, adenovirus-neutralizing serum was included in the retrovirus supernatants. Cells were then washed and maintained in culture for 2 days before being stained with 1 mg of 5-bromo-4-chloro-3indoyl--D-galactopyranoside (X-Gal) (Promega)/ml for 6 h at 37°C. Analysis of viral Gag and Env contents. Retrovirus supernatants were loaded onto a 15-to-60% sucrose gradient. After overnight ultracentrifugation at 100,000 ⫻ g, fractions were collected and subjected to Western blotting for analysis of the viral contents. Briefly, 25 l of each fraction was separated by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred onto a nitrocellulose membrane. Capsid immunoblotting was performed by using the anti p30 antibody described above. Detection of the envelope glycoprotein was performed by using mouse monoclonal antibody 83A25 (kindly provided by O. Schwartz). Peroxidase-linked anti-goat and anti-mouse antibodies were used for ECL immunodetection (Amersham). Entry assays. TE671 cells were plated at 3 ⫻ 105 cells/well in 6-well plates 1 day prior to retrovirus infections. They were then incubated with the p30normalized retroviral supernatants for 1 h at 4°C and successively washed once in 10% DMEM and twice in PBS, both ice-cold. They were then harvested either directly or after an additional 1-h incubation at 37°C. Trypsin digestion for 5 min at 37°C was used to recover the infected cells while removing external cell-bound virions, whereas 2 mM EDTA was used for cell recovery preserving the external cell-bound retrovirus particles. Cells were pelleted by low-speed centrifugation and resuspended in 25 l of lysis buffer (0.05% SDS, 1% Triton X-100, 0.5% sodium deoxycholate). Cell lysates were then subjected to immunoblotting by using the anti-p30 antibody (Quality Biotech) as described above. Cell fractionation. A total of 107 TE671 target cells were exposed to p30normalized amounts of retrovirus for 1 h at 4°C; then they were washed once in ice-cold DMEM–10% FCS and twice in ice-cold PBS, after which they were harvested either directly or after 30 min at 37°C by incubation for 10 min at 4°C in DMEM–10% FCS–20 mM HEPES–15 U of pronase/ml. After low-speed centrifugation, cell pellets were resuspended in 1 ml of hypotonic buffer (10 mM Tris-HCl [pH 8.0], 10 mM KCl, 1 mM EDTA) and Dounce homogenized. Nuclei, membranes, and mitochondria were pelleted at 13,000 ⫻ g for 15 min at 4°C. Supernatants were further centrifuged at 60,000 ⫻ g for 1 h at 4°C. Pellets containing the vesicular fractions were resuspended in lysis buffer (0.5% Triton
VOL. 76, 2002
PRODUCER CELL-DEPENDENT DEFECTIVE RETROVIRUS
FIG. 1. Adenovirus-mediated retrovirus production. A549 and HT1080 cells were infected with Adgag-pol (MOI, 20), AdLacZ (MOI, 100), and either Ad4070A-Env (MOI, 20) or AdVSVG (MOI, 100). Culture supernatants recovered 48 h later were used to infect TE671 indicator cells with retrovirus. Transduction was determined by X-Gal staining 2 days later.
X-100, 150 mM NaCl, and 20 mM HEPES), whereas Triton X-100 (final concentration, 0.5%) was added to the supernatants. Total proteins from each sample were precipitated overnight at ⫺20°C in the presence of 9 volumes of acetone. Protein pellets were recovered after centrifugation at 13,000 ⫻ g for 15 min and then resuspended in 50 l of Laemmli buffer. Twenty-five microliters of each sample was subjected to immunoblotting by using both the anti-p30 antisera (Quality Biotech) and a monoclonal antibody directed against Lamp-1 protein (obtained from the Developmental Studies Hybridoma Bank, developed under the auspices of the National Institute of Child Health and Human Development and maintained by the Department of Biological Sciences, University of Iowa, Iowa City). Detection of RT intermediates. TE671 cells seeded in 6-well plates (5 ⫻ 105 cells/well) were incubated with p30-normalized retroviral supernatants for 2 h and subsequently washed. Control cells were preincubated with 50 M azidothymidine (AZT) for 2 h. The next day, they were recovered by trypsinization and washed twice in PBS. A fraction of the cells was seeded back in 96-well plates for 24 h before X-Gal staining. The remaining fraction was used for total-DNA extraction with a QIAmp DNA kit (Qiagen), and 700 ng of each sample was subjected to 40 cycles of PCR. The following primers were used for amplification of the different RT intermediates (the numbering of nucleotide positions corresponds to that of the MoMLV sequence [GenBank accession number J02255]): for LTR/gag DNA, sense primer 5⬘-GGCTCAGGGCCAAGAACAGATGG (nucleotides 7985 to 8007) and antisense primer 5⬘-TTTTGGACTCAGGTCG GGCCAC (nucleotides 393 to 414); for 2LTR DNA, sense primer 5⬘-CCCGT GTATCCAATAAACCCTCTT (nucleotides 28 to 59) and antisense primer 5⬘GACTCAGTCAATCGGAGGACTGGC (nucleotides 3 to 26); for cytochrome b control DNA, sense primer 5⬘-CCCCTCAGAATGATATTTGTCCTCA and antisense primer 5⬘-CCATCCAACATCTCAGCATGATGAAA. Amplified PCR products were detected by agarose gel electrophoresis with ethidium bromide staining or Southern blotting.
RESULTS A549 cells produce poorly infectious retroviruses. A549 and HT1080 cells were simultaneously infected with three replication-defective adenoviruses (Adgag-pol, Ad4070A-Env, and AdlacZ) encoding, respectively, the MoMLV Gag-Pol polypeptide, 4070A-MLV Env glycoproteins, and the recombinant retrovirus vector genome encoding the LacZ protein (Fig. 1). Culture supernatants containing the retroviruses were recovered 48 h later. Virus production was evaluated by West-
6611
FIG. 2. Transduction and retrovirus titers. A549-MLV (solid bars) and HT1080-MLV (open bars) were used to infect the target TE671 cells. (A) Transduction rates were determined by using p30-normalized supernatants. (B) Titers were determined by end point dilutions. Transduced cells were visualized by X-Gal staining 2 days later. (Transduction and titration results presented here are averages from five independent productions for each virus.)
ern blotting using an antibody directed against p30 capsid protein (see Fig. 4, lanes 1). Similar amounts of total particles were released from the two cell lines, likely due to the equivalent activity of the CMV promoter driving the gag-pol cassette (data not shown). Nevertheless, all transduction assays included a p30 capsid normalization assay (see Materials and Methods) to ensure that the same amounts of total particles were incubated with the target cells. LacZ transduction rates were examined by X-Gal staining 48 h later. Figure 2A shows that A549-MLV transduced less than 15% of TE671 cells, whereas HT1080-MLV transduced up to 65% of the same target cells. This discrepancy was confirmed by end point titration of both supernatants, since we found that the HT1080MLV supernatant had a 10-fold-higher titer (Fig. 2B). We previously showed that MLV production was maximal 48 to 72 h following infection with the adenovirus chimeric vectors (18). However, there is a possibility of adenovirus vector-mediated cytotoxicity, predominantly in A549 producer cells, which would provide an artifactual mechanism for the difference in infectivity between A549-MLV and HT1080MLV. To evaluate this hypothesis, culture supernatants were harvested and replaced by fresh medium every 12 h for 4 days post-adenovirus infection. The successive titers, presented in Table 1, showed that release of infectious MLV particles from A549 and HT1080 producer cells had similar kinetics. This confirmed that studying the 48-h supernatants was appropriate and that the adenovirus had no detectable impact on MLV infectivity. Additionally, no cumulative adenovirus MOI below 250 was ever found associated with a detectable cytopathic effect on either cell line.
6612
SERHAN ET AL.
J. VIROL.
TABLE 1. Time course productions of amphotropic A549- and HT1080-MLV vectorsa Titer (105 LFU/ml)b
Time of retroviral supernatant recovery (h)
A549-MLV
HT1080-MLV
12 24 36 48 72 96
ND 0.14 5.2 ⫾ 0.3 5.7 ⫾ 0.3 1.4 ⫾ 0.2 0.2
ND 0.8 33 ⫾ 4.7 39 ⫾ 6.0 32 ⫾ 2.7 1 ⫾ 0.1
a A549 and HT1080 cells were infected with AdGag-Pol, Ad4070A-Env, and AdLacZ (at MOIs of 20, 20, and 100, respectively). Culture supernatants were harvested every 12 h postinfection and replaced by fresh medium. Cells were maintained in culture for 4 days. b Titrations of the LacZ retroviral vectors are averages ⫾ standard deviations from two independent productions for each virus. LFU, LacZ-forming units; ND, not determined.
Taken together, these results showed that A549 cells produced a large amount of poorly infectious 4070A-pseudotyped virions. This observation was consistent with our studies focused on GALV (18) and 10A1-MLV glycoproteins (unpublished data), and further extended the low infectivity of virions released from A549 cells to the envelopes of other type-C retroviruses. The A549-MLV defect is extended to other target cell types. To exclude the possibility that this initial observation was restricted to the TE671 target cell line, A549-MLV and HT1080MLV supernatants were used to infect a panel of human (A549, HT1080, and HeLa) and murine (NIH 3T3 and XC) cells. The results showed (Fig. 3) that A549-MLV were consistently less infectious despite the fact that the overall transduction rates varied greatly among the cell lines evaluated. This outcome suggested that the A549-MLV defect was due to the virion rather than the target cell.
FIG. 3. A549-MLV- and HT1080-MLV-mediated transduction of various cell lines. p30-normalized A549-MLV (solid bars) and HT1080-MLV (open bars) were used to infect human (TE671, HeLa, A549, and HT1080) and murine (NIH 3T3 and XC) cell lines. Transduction rates were determined by X-Gal staining 2 days later.
FIG. 4. Structural analysis of retroviruses. (A) A549-MLV; (B) HT1080-MLV. Supernatants (lanes 1) were sucrose gradient fractionated (lanes 2 to 7) and analyzed by Western blotting using an anti-Env (upper panels) or an anti-capsid (lower panels) antibody. Lanes 2 to 6 have a density ranging from 1.14 to1.18 g/ml. Lanes 7 correspond to the last fraction, with a density of 1.05 g/ml. (Densities were estimated by autoradiography in which the film was not overexposed.)
VSVG envelope rescues the A549-MLV defect. We then evaluated the infectivity of A549-MLV pseudotyped with VSVG glycoprotein, an envelope completely unrelated to those of type-C retroviruses. To obtain AdVSVG, the cDNA was cloned downstream of the early CMV promoter in the same configuration as that in the adenovirus encoding the amphotropic 4070A-Env. VSVG- and 4070A-pseudotyped retroviruses produced on HT1080 cells yielded equivalent transduction rates on TE671 cells, ranging from 70 to 90% (Fig. 2A). Interestingly, VSVGpseudotyped virions recovered from A549 cells resulted in efficient gene transfer, with transduction rates matching those obtained with HT1080-MLV. Accordingly, end point dilutions of VSVG-pseudotyped A549-MLV and VSVG-pseudotyped HT1080-MLV yielded equivalent titers (Fig. 2B). Hence, VSVG glycoprotein substitution was sufficient to fully rescue A549-MLV infectivity, indicating that the defect was restricted to the retrovirus envelopes. Normal Env incorporation in A549-MLV. We asked whether 4070A-Env was efficiently incorporated in A549-MLV. HT1080 and A549 cells were infected with Adgag-pol, Ad4070A-Env, and AdlacZ. Forty-eight hours later, retroviruses were purified onto a 15-to-60% sucrose gradient. Capsid and Env amounts were evaluated by Western blotting before (crude supernatants) (Fig. 4, lanes 1) and after (collected fractions) (Fig. 4, lanes 2 to 7) purification. After SDS-PAGE, samples were transferred onto a nitrocellulose membrane and then were cut into two parts at the 46-kDa marker level. The lower and upper blots were incubated with antibodies directed against the capsid and the 4070A-gp70 Env subunit (SU), respectively. HT1080-MLV and A549-MLV exhibited similar gp70/gp30 ratios in both crude supernatants and purified fractions (Fig. 4), indicating efficient incorporation of Env in both retroviruses. To exclude the possibility that the low A549-MLV infectivity was due to Env shedding and subsequent interference, low-density fractions were analyzed as well. No soluble SU could be detected (Fig. 4, lanes 7), confirming that 4070A-
VOL. 76, 2002
PRODUCER CELL-DEPENDENT DEFECTIVE RETROVIRUS
6613
FIG. 5. Viral cell entry analysis. (A) Equivalent amounts of A549-MLV (lane 1) and HT1080-MLV (lane 2) particles displayed after p30-normalization, before cell binding assay. (B) Virions were incubated with the target cells at 4°C for 1 h. (C) Infected cells were shifted from 4 to 37°C for 1 h to allow viral entry. Cells were recovered by trypsinization (lanes 1, 3, and 5) or ice-cold PBS–EDTA (lanes 2, 4, and 6) before lysis and Western blotting using an anti-p30 antibody.
Env detected in the A549-MLV supernatant (Fig. 4A, lane 1) was actually associated with the mature particles. We also formally excluded the possibility that a non-Env structural defect was responsible for the A549-MLV phenotype, based on the following findings obtained on both A549MLV and HT1080-MLV (data not shown): (i) mature particle densities ranged from 1.14 to 1.17 g/ml; (ii) Pr65Gag precursor was never detected in particle-containing fractions, indicating a complete maturation of the precursor; (iii) maximum RT activity as well as LacZ-transducing ability matched with the p30 peak; (iv) morphological analyses by electron microscopy revealed spherical structures with electron-dense cores for both retroviruses. Efficient binding and internalization of amphotropic A549MLV. TE671 cells were exposed to equivalent p30-normalized amounts of amphotropic A549-MLV and HT1080-MLV for 1 h at 4°C (Fig. 5A). This temperature allowed cell binding but neither fusion at the cell membrane nor virus endocytosis. Cells were then either kept at 4°C (for detection of particles bound to the cell surface) or placed at 37°C for 1 h to allow cellular entry (for detection of virions bound onto the cell surface or internalized). Importantly, for each condition, half of the samples were trypsinized before lysis to remove particles that were bound to the cell surface but unable to enter (i.e., for detection of internalized viruses only). Cells were finally recovered and analyzed by Western blotting for the presence of the capsid protein. Figure 5B shows the results obtained at 4°C. First, when Ad4070A-Env was omitted, the resulting virions were unable to interact with the target cells (Fig. 5B, lanes 1 and 2), indicating that the binding assessment discussed below strictly depends on the presence of Env. Second, A549-MLV were able to interact with the target cells similarly to HT1080-MLV (Fig. 5B, lanes 4 and 6). Unexpectedly, residual virions could still be detected after trypsin digestion (Fig. 5B, lanes 3 and 5). One explanation is that enzymatic removal of retrovirus bound onto the cell surface was incomplete. Alternatively, a small fraction of virions may have entered the cells during trypsin treatment, which has to be done at 37°C for 5 min before lysis. Figure 5C shows the results obtained after 1 h at 37°C. First, equal amounts of A549-MLV were recovered with and without
trypsin treatment (Fig. 5C, lanes 3 and 4). Second, an identical pattern was obtained with HT1080-MLV (Fig. 5C, lanes 5 and 6). This indicated that none of the A549-MLV or HT1080MLV recovered from the TE671 target cells originate from externally bound retroviruses. Altogether, these results implied that both types of particles bound at 4°C in an Env-dependent fashion and that they entered TE671 target cells equally efficiently, once the cells were shifted to 37°C. Normal cytosolic delivery of A549-MLV. The infectivity of a retrovirus is imputable to the cytosolic particles (39). Thus, if A549-MLV were internalized efficiently as demonstrated above, limited cytosolic delivery could possibly explain the overall reduced infectivity. To explore the fate of incoming core particles, VSVG- and 4070A-pseudotyped A549-MLV and HT1080-MLV were allowed to bind to TE671 target cells at 4°C and then to enter upon a temperature shift to 37°C for 30 min. Infected cells were subsequently separated into cytosolic and vesicular fractions. Control experiments included the use of an anti Lamp-1 antibody, a vesicle-specific epitope. The lack of Lamp-1 in the cytosolic samples allows the establishment of a reliable internal control after each cell fractionation. Tracking of the virions in the two fractions was made possible by immunoblotting for the p30 capsid protein. Figure 6A shows the results obtained with VSVGpseudotyped A549-MLV and HT1080-MLV. For both retroviruses, residual vesicular uptake was detectable at 4°C and was proportional to the Lamp-1 signal (Fig. 6A, lanes 2 and 6). Upon the 37°C shift for 30 min, p30 capsid protein from VSVG-pseudotyped A549-MLV and HT1080-MLV was found associated with both the cytosolic and vesicular compartments (Fig. 6A, lanes 3, 4, 7, and 8). Importantly, core particles were able to gain the cytosol as efficiently (Fig. 6A; compare lanes 3 and 7). This result indicated that the VSVG pseudotypes were efficiently delivered to the cytosol independently of the producer cell line. This is consistent with the fact that VSVG restored the transduction ability of A549-MLV to levels similar to those for HT1080-MLV, as reported in Fig. 2. Figure 6B shows the results obtained with the amphotropicpseudotyped A549-MLV and HT1080-MLV. Again, as found with the VSVG pseudotypes, residual vesicular uptake of both retroviruses was detectable at 4°C but was also proportional to
6614
SERHAN ET AL.
J. VIROL.
FIG. 6. Entry pathway analysis. VSVG-pseudotyped (A) and amphotropic (B) A549-MLV and HT1080-MLV were incubated with TE671 cells for 1 h at 4°C (lanes 1, 2, 5, and 6), then shifted to 37°C for 30 min (lanes 3, 4, 7, and 8). Cytosolic (lanes 1, 3, 5, and 7) and vesicular (lanes 2, 4, 6, and 8) fractions were immunoblotted with the anti-p30 antibody (lower panels) and an anti-Lamp-1 antibody (upper panels).
the Lamp-1 signal (Fig. 6B, lanes 2 and 6). This observation suggested that the p30 capsid protein that we detected at 4°C in the entry assay (Fig. 5A, lanes 3 and 5) was likely the result of a true entry upon trypsin treatment at 37°C, rather than the result of partial enzymatic modification. However, the important finding is that upon the 37°C shift for 30 min, the cytosolic/ vesicular p30 ratios were identical for the two types of virions, indicating that incoming A549-MLV were efficiently delivered to the cytosol (Fig. 6B, lanes 3, 4, 7, and 8). A549-MLV exhibit a preintegration block. Downstream postentry events were finally investigated. RT and the resulting DNA products were analyzed after infection of TE671 cells with A549-MLV and HT1080-MLV in the presence or absence of AZT, a potent reverse transcriptase inhibitor. Twenty-four hours later, cells were recovered by trypsinization. A fraction was seeded back for determination of transduction rates, while the other fraction was used for total-DNA extraction. The presence of reverse-transcribed intermediates was analyzed by PCR according to the procedure described by Schmidtmayerova et al. (57): LTR/gag primers hybridizing within the R/U5 region allowed the detection of full-length DNA, whereas 2LTR primers were designed to detect the circularized DNA forms. As shown in Fig. 7A and B, addition of AZT during the retrovirus infections resulted in the absence of detectable DNA amplification products (lanes 3, 5, 7, and 9), demonstrating that PCR products detected in the absence of AZT were related to incoming reverse-transcribed genomes. Newly synthesized DNAs could be detected in TE671 cells infected with VSVG pseudotypes, regardless of the producer cell line (A549 or HT1080), as well as with amphotropic HT1080-MLV (Fig. 7A, lanes 2, 4, and 8, respectively). Importantly, amphotropic A549-MLV was also able to fully support complete RT (Fig. 7A, lane 6). Circular DNA (2LTR) forms could be readily detected in TE671 cells infected with both VSVG pseudotypes, regardless of the producer cell line (A549 or HT1080), and in the amphotropic HT1080-MLV (Fig. 7B, lanes 2, 4, and 8, respectively). The “full-length/circular” form ratios were similar among the VSVG pseudotypes and the amphotropic HT1080-MLV (Fig. 7A and B, lanes 2, 4, and 8). The weaker signals found for
the latter rather reflected a lower-titer supernatant, as evidenced by the reduced tranduction rate (50%) (Fig. 7D). However, the critical finding (Fig. 7B, lane 6) was that the level of circular DNA forms was dramatically diminished in amphotropic A549-MLV-infected cells, concomitant with the low
FIG. 7. Analysis of DNA forms. VSVG-pseudotyped MLV were produced on HT1080 cells (lanes 2 and 3) or A549 cells (lanes 4 and 5). 4070A-pseudotyped MLV were produced on HT1080 cells (lanes 6 and 7) or A549 cells (lanes 8 and 9). TE671 cells were infected with the respective supernatants in the absence (lanes 2, 4, 6, and 8) or presence (lanes 3, 5, 7, and 9) of the inhibitor AZT. Twenty hours later, total DNAs were extracted and subjected to PCR amplification using either LTR/gag primers (A), 2LTR primers (B), or cytB primers (C). Total DNAs from mock-infected TE671 cells (lane 1) and the control (water) (lane 10) were included. Amplified products were detected on an agarose gel by ethidium bromide staining (A and C) or after Southern blotting (B). Before lysis, a fraction of the infected cells was seeded in 96-well plates and cultured for 24 h more. Transduction rates were determined by X-Gal staining (D).
VOL. 76, 2002
PRODUCER CELL-DEPENDENT DEFECTIVE RETROVIRUS
transduction rate (5%) (Fig. 7D). Since DNA circles result from an autointegration event that takes place in the nucleus only, they are usually considered a valuable index for nuclear translocation of preintegration complexes (PIC) (57). Furthermore, identical results were obtained with NIH 3T3 cells (data not shown). Taken together, these results indicated that a block occurred after the completion of the RT, implying that amphotropic but not VSVG-pseudotyped A549-MLV were defective for nuclear transport of PICs. DISCUSSION This study extended our previous observation that GALVpseudotyped A549-MLV is poorly infectious (18). Here we showed that 4070A-Env preserved the defective phenotype, as did 10A1-Env (data not shown). Structural and morphological analysis indicated that A549-MLV and HT1080-MLV were indistinguishable. Furthermore, the two retroviruses exhibited similar behaviors during early infection steps, including target cell binding, uptake, and cytosolic delivery. Amphotropic A549-MLV and HT1080-MLV displayed normal RT processing. However, a dramatic reduction in 2LTR DNA forms could be detected in A549-MLV infected TE671 cells, suggesting that the mechanism responsible for the low-transduction-rate phenotype was a block at the nuclear translocation step. Interestingly, incorporation of VSVG glycoprotein onto the virus surface was sufficient to fully rescue the infectivity of A549MLV. To confirm that rescue by VSVG pseudotyping did not rely on enhanced virus stability compared to that of amphotropic A549-MLV, virions recovered from A549 and HT1080 producer cells were first incubated at 37°C for 1 to 8 h and then titered. All productions were found stable (data not shown), indicating that rescue of A549-MLV infectivity depended on a VSVG-mediated entry pathway. The latter observation is reminiscent of the HIV-1 conditional requirement for the lentiviral Nef protein. This accessory protein is required for optimal infectivity of HIV virions harboring the gp120 or MLV Env glycoprotein but appears to be dispensable for production of fully infectious VSVG- or Ebola virus glycoprotein-pseudotyped HIV virions (1, 9, 37). HIV particles from which Nef has been deleted are approximately 10-fold less infectious than wild-type HIV virions (12, 42), yet they exhibit similar structural characteristics (i.e., capsid, reverse transcriptase, RNA, and Env contents) (59). It has recently been found that Nef enhances the cytosolic virus delivery occurring via fusion at the plasma membrane (56). Consistently, HIV-1 from which Nef has been deleted can be rescued when gp120 Env is replaced by VSVG or Ebola virus glycoprotein; both of these glycoproteins are activated after an endocytosis uptake. For obvious reasons, it was tempting to compare the HIV conditional requirement for Nef with the VSVG-mediated rescue of A549-MLV and, furthermore, to speculate on the possible existence of a producer cell Nef-like factor missing in A549 cells. However, unlike that of the HIV Nef deletion mutants, amphotropic A549-MLV entry was efficient and indistinguishable from HT1080-MLV entry. Similarly, the reduced infectivity of amphotropic A549-MLV may not be related to the restricted replication of HIV-1 Vif deletion mutants (3) or to the Fv-1 (11, 52) or Fv1-like antiviral activity recently described for mammalian cells (66). Both of
6615
the latter restrictions are cell type dependent and can lead to a postentry block in nonpermissive cells (24, 38, 60). However, in these cases, the infectivity of the defective virions cannot be rescued by VSVG (3, 66), suggesting that the blocks are independent of the entry pathway. Several groups have recently reported a postentry defect during the restricted replication of lymphotropic HIV-1 (57), HIV-2 (41), or SIVmac239 strains (32) in nonpermissive primary macrophages. The block was located at a post-RT step in the infection cycle and could be rescued by VSVG pseudotyping (41). Importantly, the absence of proviral integration was also observed in actively dividing cells, suggesting that the defect does not rely on nuclear import of the PICs through the nuclear pores but occurs somewhere else (41). In view of our results with A549-MLV, it is tempting to extend this feature to type-C retroviruses. Although PICs from oncoretroviruses and primate lentiviruses do not exhibit the same protein composition and cellular fate (19, 20), they interact with identical host cell factors, namely, BAF (25, 34) and HMG I(Y) (35), and trigger the cytoplasmic redistribution of PML and INI1 proteins (67). Thus, it will be of interest to determine whether a common mechanism is responsible for the translocation of the PICs through the cytoplasm. Events surrounding this transport are for the most part unknown. Recent studies have suggested that nuclear targeting is dependent on an intact cytoskeleton (7, 33), while the respective roles of the actin microfilaments, microtubules, and intermediate filaments remain to be specified. It is still unclear whether the retroviral Env glycoproteins are directly responsible for the abortive PIC translocation. In the case of defective lymphotropic HIV, it has been suggested that noninfectious particles entering the cells by fusion at the plasma membrane might be blocked in an abortive subcellular compartment (41, 57). Expression of VSVG on the viral surface may overcome the postentry obstacle by releasing HIV virions from the endosomes downstream of this putative restrictive point (41). Similarly, we first hypothesized that although PICs were produced following amphotropic A549MLV entry, they were held in an inappropriate compartment in the cell and may not have had access to the nucleus, even when the nuclear membrane was dissipated during cell division. However, a strictly pH-independent entry is presently discussed for certain retroviruses, including amphotropic MLV (30, 43) and HIV (43), and therefore the previous hypothesis requires caution. In contrast, ecotropic MLV appears to enter murine NIH 3T3 and rat XC cells via two distinct pathways— endocytosis and fusion at the plasma membrane, respectively (33). Thus, to point out the impact of the entry pathway, it might be interesting to determine whether pseudotyping A549MLV with the ecotropic Env protein could rescue the transduction of NIH 3T3 but not XC cells. Alternatively, the postentry defect might depend on the core particles themselves. An alteration of PIC stability seems unlikely, since we were able to detect high levels of linear viral DNAs up to 24 h postinfection. Our data rather suggest a misrouting of the incoming PICs. Interestingly, several viruses with mutations in the Gag sequence display similar phenotypes and therefore may provide clues for identification of the A549MLV molecular defect. First, MLV p12-Gag and EIAV p9Gag proteins seem to be involved in the early events of the
6616
SERHAN ET AL.
viral cycle (10, 74). Their functions during entry are still unclear and do not involve either the respective PPXY and YXXL late domains or the Gag ubiquitination status. Mutations within the N- or C-terminal domains of the MLV p12 protein resulted in a post-RT but preintegration blockage, whereas these mutants exhibited normal viral contents (74). Hence, it will be helpful to determine whether these defective mutants can be rescued by VSVG pseudotyping. Second, in addition to its functional role in virus assembly, the matrix (MA) protein appears to play distinct roles during HIV-1 and MLV entry, relating to the uncoating of the core particles, initiation of RT, and PIC transport (15, 22, 31, 49, 73). Although MA is not associated with MLV PICs, this protein may possibly impact an event downstream of the uncoating, such as the connection with cytoskeleton components. Since MA phosphorylation status is a key regulator of HIV-1 PIC nuclear import (8, 22), careful analysis of the MA posttranslational modifications in A549 cells is obviously required. In summary, we have reported here a producer cell typedependent restriction of MLV infection that results from impaired nuclear translocation of the PICs. Molecular analysis of the A549-MLV core particles will be necessary to identify the producer cell cofactor or imprinting process present, perhaps during assembly, which in turn dramatically influences MLV infectivity by modulating this postentry event. ACKNOWLEDGMENTS We thank Didier Trono and Olivier Danos for carefully reading the manuscript and for helpful discussions. We also thank the Vector Core at the University Hospital of Nantes, supported by the Association Française contre les Myopathies (AFM), for the Ad-MLV vectors. This work was supported by the Association Vaincre la Mucoviscidose (VLM), the Fondation pour la Thérapie Génique en Pays de Loire, and the Association Nantaise de Thérapie Génique (ANTG). REFERENCES 1. Aiken, C. 1997. Pseudotyping human immunodeficiency virus type 1 (HIV-1) by the glycoprotein of vesicular stomatitis virus targets HIV-1 entry to an endocytic pathway and suppresses both the requirement for Nef and the sensitivity to cyclosporin A. J. Virol. 71:5871–5877. 2. Akari, H., T. Fukumori, and A. Adachi. 2000. Cell-dependent requirement of human immunodeficiency virus type 1 gp41 cytoplasmic tail for Env incorporation into virions. J. Virol. 74:4891–4893. 3. Akari, H., T. Uchiyama, T. Fukumori, S. Iida, A. H. Koyama, and A. Adachi. 1999. Pseudotyping human immunodeficiency virus type 1 by vesicular stomatitis virus G protein does not reduce the cell-dependent requirement of vif for optimal infectivity: functional difference between Vif and Nef. J. Gen. Virol. 80:2945–2949. 4. Berlioz-Torrent, C., B. L. Shacklett, L. Erdtmann, L. Delamarre, I. Bouchaert, P. Sonigo, M. C. Dokhelar, and R. Benarous. 1999. Interactions of the cytoplasmic domains of human and simian retroviral transmembrane proteins with components of the clathrin adaptor complexes modulate intracellular and cell surface expression of envelope glycoproteins. J. Virol. 73:1350–1361. 5. Bieniasz, P. D., and B. R. Cullen. 2000. Multiple blocks to human immunodeficiency virus type 1 replication in rodent cells. J. Virol. 74:9868–9877. 6. Boge, M., S. Wyss, J. S. Bonifacino, and M. Thali. 1998. A membraneproximal tyrosine-based signal mediates internalization of the HIV-1 envelope glycoprotein via interaction with the AP-2 clathrin adaptor. J. Biol. Chem. 273:15773–15778. 7. Bukrinskaya, A., B. Brichacek, A. Mann, and M. Stevenson. 1998. Establishment of a functional human immunodeficiency virus type 1 (HIV-1) reverse transcription complex involves the cytoskeleton. J. Exp. Med. 188: 2113–2125. 8. Camaur, D., P. Gallay, S. Swingler, and D. Trono. 1997. Human immunodeficiency virus matrix tyrosine phosphorylation: characterization of the kinase and its substrate requirements. J. Virol. 71:6834–6841. 9. Chazal, N., G. Singer, C. Aiken, M. L. Hammarskjold, and D. Rekosh. 2001. Human immunodeficiency virus type 1 particles pseudotyped with envelope proteins that fuse at low pH no longer require Nef for optimal infectivity. J. Virol. 75:4014–4018.
J. VIROL. 10. Chen, C., F. Li, and R. C. Montelaro. 2001. Functional roles of equine infectious anemia virus Gag p9 in viral budding and infection. J. Virol. 75:9762–9770. 11. Chinsky, J., R. Soeiro, and J. Kopchick. 1984. Fv-1 host cell restriction of Friend leukemia virus: microinjection of unintegrated viral DNA. J. Virol. 50:271–274. 12. Chowers, M. Y., C. A. Spina, T. J. Kwoh, N. J. Fitch, D. D. Richman, and J. C. Guatelli. 1994. Optimal infectivity in vitro of human immunodeficiency virus type 1 requires an intact nef gene. J. Virol. 68:2906–2914. 13. Coffin, J. M. 1996. Retroviridae: the viruses and their replication, p. 1767– 1847. In B.N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven, Philadelphia, Pa. 14. Cosset, F. L., Y. Takeuchi, J. L. Battini, R. A. Weiss, and M. K. L. Collins. 1995. High-titer packaging cells producing recombinant retroviruses resistant to human serum. J. Virol. 69:7430–7436. 15. Crawford, S., and S. P. Goff. 1984. Mutations in Gag proteins P12 and P15 of Moloney murine leukemia virus block early stages of infection. J. Virol. 49:909–917. 16. Deschambeault, J., J. P. Lalonde, G. Cervantes-Acosta, R. Lodge, E. A. Cohen, and G. Lemay. 1999. Polarized human immunodeficiency virus budding in lymphocytes involves a tyrosine-based signal and favors cell-to-cell viral transmission. J. Virol. 73:5010–5017. 17. Duisit, G., S. Saleun, S. Douthe, J. Barsoum, G. Chadeuf, and P. Moullier. 1999. Baculovirus vector requires electrostatic interactions including heparan sulfate for efficient gene transfer in mammalian cells. J. Gene Med. 1:1–10. 18. Duisit, G., A. Salvetti, P. Moullier, and F. Cosset. 1999. Functional characterization of adenoviral/retroviral chimeric vectors and their use for efficient screening of retroviral producer cell lines. Hum. Gene Ther. 10:189–200. 19. Fassati, A., and S. P. Goff. 2001. Characterization of intracellular reverse transcription complexes of human immunodeficiency virus type 1. J. Virol. 75:3626–3635. 20. Fassati, A., and S. P. Goff. 1999. Characterization of intracellular reverse transcription complexes of Moloney murine leukemia virus. J. Virol. 73: 8919–8925. 21. Gabuzda, D., K. Lawrence, E. Langhoff, E. Terwilliger, T. Dorfman, W. Haseltine, and J. Sodroski. 1992. Role of vif in replication of human immunodeficiency virus type 1 in CD4⫹ T lymphocytes. J. Virol. 66:6489–6495. 22. Gallay, P., S. Swingler, C. Aiken, and D. Trono. 1995. HIV-1 infection of nondividing cells: C-terminal tyrosine phosphorylation of the viral matrix protein is a key regulator. Cell 80:379–388. 23. Garnier, L., J. W. Wills, M. F. Verderame, and M. Sudol. 1996. WW domains and retrovirus budding. Nature 381:744–745. 24. Goncalves, J., Y. Korin, J. Zack, and D. Gabuzda. 1996. Role of Vif in human immunodeficiency virus type 1 reverse transcription. J. Virol. 70: 8701–8709. 25. Harris, D., and A. Engelman. 2000. Both the structure and DNA binding function of the barrier-to-autointegration factor contribute to reconstitution of HIV type 1 integration in vitro. J. Biol. Chem. 275:39671–39677. 26. Hassaine, G., M. Courcoul, G. Bessou, Y. Barthalay, C. Picard, D. Olive, Y. Collette, R. Vigne, and E. Decroly. 2001. The tyrosine kinase Hck is an inhibitor of HIV-1 replication counteracted by the viral vif protein. J. Biol. Chem. 276:16885–16893. 27. He, T. C., S. Zhou, L. T. da Costa, J. Yu, K. W. Kinzler, and B. Vogelstein. 1998. A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. USA 95:2509–2514. 28. Huang, M., J. M. Orenstein, M. A. Martin, and E. O. Freed. 1995. p6Gag is required for particle production from full-length human immunodeficiency virus type 1 molecular clones expressing protease. J. Virol. 69:6810–6818. 29. Hurford, R. K., Jr., G. Dranoff, R. C. Mulligan, and R. I. Tepper. 1995. Gene therapy of metastatic cancer by in vivo retroviral gene targeting. Nat. Genet. 10:430–435. 30. Katen, L. J., M. M. Januszeski, W. F. Anderson, K. J. Hasenkrug, and L. H. Evans. 2001. Infectious entry by amphotropic as well as ecotropic murine leukemia viruses occurs through an endocytic pathway. J. Virol. 75:5018– 5026. 31. Kiernan, R., A. Ono, G. Englund, and E. Freed. 1998. Role of matrix in an early postentry step in the human immunodeficiency virus type 1 life cycle. J. Virol. 72:4116–4126. 32. Kim, S. S., X. J. You, M. E. Harmon, J. Overbaugh, and H. Fan. 2001. Use of helper-free replication-defective simian immunodeficiency virus-based vectors to study macrophage and T tropism: evidence for distinct levels of restriction in primary macrophages and a T-cell line. J. Virol. 75:2288–2300. 33. Kizhatil, K., and L. M. Albritton. 1997. Requirements for different components of the host cell cytoskeleton distinguish ecotropic murine leukemia virus entry via endocytosis from entry via surface fusion. J. Virol. 71:7145– 7156. 34. Lee, M. S., and R. Craigie. 1998. A previously unidentified host protein protects retroviral DNA from autointegration. Proc. Natl. Acad. Sci. USA 95:1528–1533. 35. Li, L., C. M. Farnet, W. F. Anderson, and F. D. Bushman. 1998. Modulation
VOL. 76, 2002
36. 37. 38. 39. 40. 41. 42.
43. 44.
45.
46. 47.
48.
49. 50. 51. 52. 53. 54. 55.
PRODUCER CELL-DEPENDENT DEFECTIVE RETROVIRUS
of activity of Moloney murine leukemia virus preintegration complexes by host factors in vitro. J. Virol. 72:2125–2131. Liu, B., R. Dai, C. J. Tian, L. Dawson, R. Gorelick, and X. F. Yu. 1999. Interaction of the human immunodeficiency virus type 1 nucleocapsid with actin. J. Virol. 73:2901–2908. Luo, T., J. L. Douglas, R. L. Livingston, and J. V. Garcia. 1998. Infectivity enhancement by HIV-1 Nef is dependent on the pathway of virus entry: implications for HIV-based gene transfer systems. Virology 241:224–233. Madani, N., and D. Kabat. 2000. Cellular and viral specificities of human immunodeficiency virus type 1 Vif protein. J. Virol. 74:5982–5987. Marechal, V., F. Clavel, J. M. Heard, and O. Schwartz. 1998. Cytosolic Gag p24 as an index of productive entry of human immunodeficiency virus type 1. J. Virol. 72:2208–2212. Mariani, R., G. Rutter, M. E. Harris, T. J. Hope, H. G. Krausslich, and N. R. Landau. 2000. A block to human immunodeficiency virus type 1 assembly in murine cells. J. Virol. 74:3859–3870. McKnight, A., D. J. Griffiths, M. Dittmar, P. Clapham, and E. Thomas. 2001. Characterization of a late entry event in the replication cycle of human immunodeficiency virus type 2. J. Virol. 75:6914–6922. Miller, M. D., M. T. Warmerdam, I. Gaston, W. C. Greene, and M. B. Feinberg. 1994. The human immunodeficiency virus-1 nef gene product: a positive factor for viral infection and replication in primary lymphocytes and macrophages. J. Exp. Med. 179:101–113. Mothes, W., A. L. Boerger, S. Narayan, J. M. Cunningham, and J. A. Young. 2000. Retroviral entry mediated by receptor priming and low pH triggering of an envelope glycoprotein. Cell 103:679–689. Mouland, A. J., J. Mercier, M. Luo, L. Bernier, L. DesGroseillers, and E. A. Cohen. 2000. The double-stranded RNA-binding protein Staufen is incorporated in human immunodeficiency virus type 1: evidence for a role in genomic RNA encapsidation. J. Virol. 74:5441–5451. Mouland, A. J., H. Xu, H. Cui, W. Krueger, T. P. Munro, M. Prasol, J. Mercier, D. Rekosh, R. Smith, E. Barbarese, E. A. Cohen, and J. H. Carson. 2001. RNA trafficking signals in human immunodeficiency virus type 1. Mol. Cell. Biol. 21:2133–2143. Murakami, T., and E. O. Freed. 2000. The long cytoplasmic tail of gp41 is required in a cell type-dependent manner for HIV-1 envelope glycoprotein incorporation into virions. Proc. Natl. Acad. Sci. USA 97:343–348. Ott, D. E., L. V. Coren, B. P. Kane, L. K. Busch, D. G. Johnson, R. C. Sowder, E. N. Chertova, L. O. Arthur, and L. E. Henderson. 1996. Cytoskeletal proteins inside human immunodeficiency virus type 1 virions. J. Virol. 70: 7734–7743. Parent, L. J., R. P. Bennett, R. C. Craven, T. D. Nelle, N. K. Krishna, J. B. Bowzard, C. B. Wilson, B. A. Puffer, R. C. Montelaro, and J. W. Wills. 1995. Positionally independent and exchangeable late budding functions of the Rous sarcoma virus and human immunodeficiency virus Gag proteins. J. Virol. 69:5455–5460. Parent, L. J., C. B. Wilson, M. D. Resh, and J. W. Wills. 1996. Evidence for a second function of the MA sequence in the Rous sarcoma virus Gag protein. J. Virol. 70:1016–1026. Parker, S. D., and E. Hunter. 2000. A cell-line-specific defect in the intracellular transport and release of assembled retroviral capsids. J. Virol. 74: 784–795. Patnaik, A., V. Chau, and J. W. Wills. 2000. Ubiquitin is part of the retrovirus budding machinery. Proc. Natl. Acad. Sci. USA 97:13069–13074. Pryciak, P., and H. E. Varmus. 1992. Fv-1 restriction and its effects on murine leukemia virus integration in vivo and in vitro. J. Virol. 66:5959–5966. Puffer, B. A., L. J. Parent, J. W. Wills, and R. C. Montelaro. 1997. Equine infectious anemia virus utilizes a YXXL motif within the late assembly domain of the Gag p9 protein. J. Virol. 71:6541–6546. Rey, O., J. Canon, and P. Krogstad. 1996. HIV-1 Gag protein associates with F-actin present in microfilaments. Virology 220:530–534. Salvetti, A., S. Orève, G. Chadeuf, D. Favre, Y. Cherel, P. Champion-Arnaud, J. David-Ameline, and P. Moullier. 1998. Factors influencing recombinant adeno-associated virus production. Hum. Gene Ther. 9:695–706.
6617
56. Schaeffer, E., R. Geleziunas, and W. C. Greene. 2001. Human immunodeficiency virus type 1 Nef functions at the level of virus entry by enhancing cytoplasmic delivery of virions. J. Virol. 75:2993–3000. 57. Schmidtmayerova, H., M. Alfano, G. Nuovo, and M. Bukrinsky. 1998. Human immunodeficiency virus type 1 T-lymphotropic strains enter macrophages via a CD4- and CXCR4-mediated pathway: replication is restricted at a postentry level. J. Virol. 72:4633–4642. 58. Schubert, U., D. E. Ott, E. N. Chertova, R. Welke, U. Tessmer, M. F. Princiotta, J. R. Bennink, H. G. Krausslich, and J. W. Yewdell. 2000. Proteasome inhibition interferes with gag polyprotein processing, release, and maturation of HIV-1 and HIV-2. Proc. Natl. Acad. Sci. USA 97:13057– 13062. 59. Schwartz, O., V. Marechal, O. Danos, and J. M. Heard. 1995. Human immunodeficiency virus type 1 Nef increases the efficiency of reverse transcription in the infected cell. J. Virol. 69:4053–4059. 60. Simon, J. H., and M. H. Malim. 1996. The human immunodeficiency virus type 1 Vif protein modulates the postpenetration stability of viral nucleoprotein complexes. J. Virol. 70:5297–5305. 61. Strack, B., A. Calistri, M. A. Accola, G. Palu, and H. G. Gottlinger. 2000. A role for ubiquitin ligase recruitment in retrovirus release. Proc. Natl. Acad. Sci. USA 97:13063–13068. 62. Sudol, M. 1996. Structure and function of the WW domain. Prog. Biophys. Mol. Biol. 65:113–132. 63. Sudol, M., P. Bork, A. Einbond, K. Kastury, T. Druck, M. Negrini, K. Huebner, and D. Lehman. 1995. Characterization of the mammalian YAP (Yes-associated protein) gene and its role in defining a novel protein module, the WW domain. J. Biol. Chem. 270:14733–14741. 64. Sudol, M., H. Chen, C. Bougeret, A. Einbond, and P. Bork. 1995. Characterization of a novel protein-binding module—the WW domain. FEBS Lett. 369:67–71. 65. Tang, Y., U. Winkler, E. O. Freed, T. A. Torrey, W. Kim, H. Li, S. P. Goff, and H. C. Morse. 1999. Cellular motor protein KIF-4 associates with retroviral Gag. J. Virol. 73:10508–10513. 66. Towers, G., M. Bock, S. Martin, Y. Takeuchi, J. P. Stoye, and O. Danos. 2000. A conserved mechanism of retrovirus restriction in mammals. Proc. Natl. Acad. Sci. USA 97:12295–12299. 67. Turelli, P., V. Doucas, E. Craig, B. Mangeat, N. Klages, R. Evans, G. Kalpana, and D. Trono. 2001. Cytoplasmic recruitment of INI1 and PML on incoming HIV preintegration complexes: interference with early steps of viral replication. Mol. Cell 7:1245–1254. 68. VerPlank, L., F. Bouamr, T. J. LaGrassa, B. Agresta, A. Kikonyogo, J. Leis, and C. A. Carter. 2001. Tsg101, a homologue of ubiquitin-conjugating (E2) enzymes, binds the L domain in HIV type 1 Pr55(Gag). Proc. Natl. Acad. Sci. USA 98:7724–7729. 69. Vogt, V. M. 2000. Ubiquitin in retrovirus assembly: actor or bystander? Proc. Natl. Acad. Sci. USA 97:12945–12947. 70. von Schwedler, U., J. Song, C. Aiken, and D. Trono. 1993. Vif is crucial for human immunodeficiency virus type 1 proviral DNA synthesis in infected cells. J. Virol. 67:4945–4955. 71. Xiang, Y., C. E. Cameron, J. W. Wills, and J. Leis. 1996. Fine mapping and characterization of the Rous sarcoma virus Pr76gag late assembly domain. J. Virol. 70:5695–5700. 72. Yasuda, J., and E. Hunter. 1998. A proline-rich motif (PPPY) in the Gag polyprotein of Mason-Pfizer monkey virus plays a maturation-independent role in virion release. J Virol. 72:4095–4103. 73. Yu, X., Q. C. Yu, T. H. Lee, and M. Essex. 1992. The C terminus of human immunodeficiency virus type 1 matrix protein is involved in early steps of the virus life cycle. J. Virol. 66:5667–5670. 74. Yuan, B., X. Li, and S. P. Goff. 1999. Mutations altering the Moloney murine leukemia virus p12 gag protein affect virion production and early events of the virus life cycle. EMBO J. 18:4700–4710. 75. Zufferey, R., D. Nagy, R. J. Mandel, L. Naldini, and D. Trono. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat. Biotechnol. 15:871–875.
