Characterization of Ralstonia strains infecting tomato ...

Crop Protection 112 (2018) 56–62

Contents lists available at ScienceDirect

Crop Protection journal homepage: www.elsevier.com/locate/cropro

Characterization of Ralstonia strains infecting tomato plants in South Africa V.M. Shutt

a,b

a

c

d

, G. Shin , J.E. van der Waals , T. Goszczynska , T.A. Coutinho

T

a,∗

a

Department of Biochemistry, Genetics and Microbiology, Centre for Microbial Ecology and Genomics, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Private Bag X20, 0028 Pretoria, South Africa Department of Plant Sciences, Faculty of Natural Sciences, University of Jos, P.M.B. 1084, Jos, Plateau State, Nigeria c Department of Plant and Soil Sciences, University of Pretoria, Private Bag X20, 0028 Pretoria, South Africa d ARC, Plant Protection Research, Private Bag X134, Queenswood, Pretoria, 0121, South Africa b

A R T I C LE I N FO

A B S T R A C T

Keywords: Ralstonia pseudosolanacearum Ralstonia solanacearum, tomato Bacterial wilt South Africa Phylotype

Ralstonia spp., the causal agents of bacterial wilt, cause severe yield losses of Solanaceous crops, including tomato. The disease is difficult to control due to the pathogen's ability to survive in soil and to cause latent infections. Therefore, characterizing Ralstonia strains is important in developing effective strategies for diagnoses, quarantine and selection of biocontrol agents. In this study, 50 Ralstonia strains previously isolated from wilted tomato plants in different locations in South Africa were obtained from the culture collection of the Agricultural Research Council, Pretoria, and private seed companies. A phylogenetic analysis of the endoglucanase gene sequences revealed that 49 strains were R. pseudosolanacearum and only one was R. solanacearum. R. pseudosolanacearum strains grouped into two sequevars, 18 and 31, while the single R. solanacearum strain grouped into the cold-adapted sequevar 1, also known as race 3 biovar 2. The pathogenicity results revealed that the selected strains were pathogenic on tomato seedlings. This study thus revealed that bacterial wilt of tomato is caused primarily by R. pseudosolanacearum, but R. solanacearum IIB-1 is also present in South Africa. This information is relevant in terms of the implementation of quarantine measures, notably to put into place measures that will prevent the introduction of strain IIB-1 into other provinces of South Africa.

1. Introduction Ralstonia solanacearum was formerly identified as a species complex (Gillings and Fahy, 1994) because of the heterogeneous grouping of genetically related strains (Allen et al., 2005; Prior and Fegan, 2005). Members of the R. solanacearum species complex (RSSC) are aggressive and destructive soil borne pathogens that can survive harsh environmental conditions (Álvarez et al., 2008). RSSC have a broad host range of over 240 plant species from at least 54 families and are widely spread over all continents (Prior et al., 2016). Members of the Solanaceae are highly susceptible to these pathogens. They penetrate plant roots via natural openings and wounds, thereafter moving into the xylem where they block the movement of water resulting in wilting and subsequent death of the plant. These symptoms result in severe yield losses (Meng, 2013). The taxonomy of RSSC has undergone a number of changes over the past two decades. Prior to 1992, the causal agent of bacterial wilt was known as Pseudomonas solanacearum. The race and biovar systems were used to differentiate between strains belonging to this species (Buddenhagen and Kelman, 1964; Hayward, 1964). The races were classified based on host range (Buddenhagen et al., 1962). Race 1 ∗

strains infected tobacco, Solanaceous crops and plants in other families; race 2 strains attacked Musaceous crops and Heliconia spp.; race 3 strains infected potato and tomato; race 4 strains attacked ginger and race 5 strains infected mulberry trees in China (He et al., 1983). The biovar system was based on the ability of the bacterium to utilize and oxidize a number of disaccharides (cellobiose, lactose and maltose) and hexose alcohols (dulcitol, mannitol, and sorbitol) (Hayward, 1964). Biovar 1 strains metabolize none of the sugars or alcohols; biovar 2 metabolizes disaccharides; biovar 3 metabolizes both alcohol and sugars; biovar 4 metabolizes hexose and alcohols; and biovar 5 metabolizes both alcohol and sugars, except dulcitol and sorbitol (Hayward, 1964; He et al., 1983). Later, biovar 2 strains were further divided in 2T and N2, based on their ability to utilize ribose and trehalose (Hayward, 1994). The original biovar 2 strains were then called biovar 2-A. In 1992, Yabuuchi et al. moved the causal agent of bacterial wilt from the genus Pseudomonas to the genus Burkholderia because it was non-fluorescent. However, it was later moved to the genus Ralstonia (Yabuuchi et al., 1995). In the early 2000s, RSSC was divided into four phylotypes based on the phylogenetic analysis of the 16S-23S internal transcribed spacer region, the egl, hrpB and mutS genes (Guidot et al., 2009; Allen et al.,

Corresponding author. E-mail address: [email protected] (T.A. Coutinho).

https://doi.org/10.1016/j.cropro.2018.05.013 Received 6 September 2017; Received in revised form 6 February 2018; Accepted 14 May 2018 0261-2194/ © 2018 Elsevier Ltd. All rights reserved.


V.M. Shutt et al.

Table 1 List of primers used in this study. Gene

Primer

Sequence of primer (5′3′)

Annealing temperature °C

Reference

egl

Endo-F Endo-R Nmult:21:1F Nmult:21:2F Nmult:23:AF Nmult:22:InF Nmult:22:RR 759R 760F

ATGCATGCCGCTGGTCGCCGC GCGTTGCCCGGCACGAACACC CGTTGATGAGGCGCGCAATTT AAGTTATGGACGGTGGAAGTC ATTACSAGAGCAATCGAAAGATT ATTGCCAAGACGAGAGAAG TA TCGCTTGACCCTATAACGAGTA GTCGCCGTCAACTCACTTTCC GTCGCCGTCAGCAATGCGGAATCG

70 70 58 58 58 58 58 58 58

(Wicker et al., 2012)

16S-23S ITS region

Spel

(Fegan and Prior, 2005)

(Opina et al., 1997)

1 g; TZC, 50 mg per liter at a pH 7.0 ± 1) (Kelman, 1954). Petri dishes were incubated at 28 ± 2 °C for 24 h and colonies on this media were red to pink and mucoid. Single colonies were re-streaked onto the same media to ensure purity. Cultures were then stored in sterile 1.5 ml Nutrient broth/glycerol/yeast extract, (NGY) composed of 0.8 ml nutrient broth, 15 ml glycerol, 0.2 g yeast extract, 0.5 g glucose and 100 ml distilled water at −20 ± 2 °C.

2005; Prior and Fegan, 2005; Poussier et al., 2000). These phylotypes correlated with the geographical origin of the strains: phylotype I comprised strains from Asia, phylotype II consisted of the American strains, phylotype III strains were from Africa, while phylotype IV had strains from Indonesia (Allen et al., 2005; Prior and Fegan, 2005). Fegan and Prior (2005) separated each phylotype into sequevars, based on the nucleotide variation of the endoglucanase (egl) gene. Wicker et al. (2012) further divided the complex into eight clades using multilocus sequence analysis (MLSA): Clade 1 strains were synonymous to those of phylotype I, clade 2–5 were those of phylotype II, clade 6 had phylotype III strains, and clade 7 and 8 were those from phylotype IV. Remenant et al. (2011) suggested that the Ralstonia phylotypes should be recognized as named species because they are genetically distinct. Safni et al. (2014) used phenotypic and genotypic information, including MLSA and whole genome comparisons, to reclassify and assign species names to members of the RSCC. Three species were described, viz. R. solanacearum, R. pseudosolanacearum and R. syzygii. Prior et al. (2016) supported the revised taxonomy using genomic and proteomic evidence. Phylotype I and III strains were assigned to R. pseudosolanacearum, strains in phylotype II retained the old name R. solanacearum whereas strains in phylotype IV were named R. syzygii and included three subspecies, viz. subsp. syzygii, subsp. indonesiensis and subsp. celebesensis (Safni et al., 2014). Despite the proposed reclassification of the complex, the phylotype system is still being employed today because it reveals evolutionary relationships and reflects the proposed species classification. Bacterial wilt of solanaceous crops is prevalent in a number of African countries including Burundi, Cameroon, Egypt, Libya, Nigeria, Zambia and South Africa (CABI, 2017). In South Africa, bacterial wilt is known to infect tomatoes in the subtropical lowlands of Mpumalanga, KwaZulu-Natal and the Western Cape provinces (Malherbe and Marais, 2015). The pathogen also infects a number of other important agricultural crops and plantation trees in South Africa, including tobacco (Doidge, 1919), peanuts, peppers, potatoes (Gorter, 1977) and Eucalyptus (Coutinho et al., 2000). The aims of this study were to use molecular techniques to identify and characterize Ralstonia strains isolated from tomato plants displaying bacterial wilt symptoms. The diseased plants were collected from different provinces of South Africa over the past 16 years. The virulence of selected strains was tested under greenhouse conditions.

2.2. DNA extraction from bacterial cultures and Ralstonia specific PCR Genomic DNA was extracted from the 50 bacterial strains using ZR Fungal/Bacterial DNA Kit (Zymo Research) according to manufacturer's protocol. DNA was eluted with 100 μl elution buffer and stored at −20 °C. The DNA was quantified and the quality checked using a NanoDrop 1000. The Ralstonia strains had previously been identified by the ARC/PPR based on phenotypic characteristics. In this study Ralstonia specific primers (Table 1) were used in a PCR to amplify the speI region (Opina et al., 1997). The PCR reaction consisted of 12.5 μl of 2X KAPA Taq ReadyMix (1.5 mM MgCl2 at 1X) (KAPA Biosystems), 0.5 mM of each primer, 50 ng template DNA, made up to a total volume of 25 μl with PCR grade water. PCR amplification was conducted in an Applied Biosystems ABI 9903 Veriti 384 Well Thermal Cycler and the conditions were: 96 °C for 10 min in 30 cycles of 96 °C for 15 s, 59 °C for 30 s and 72 °C for 30 s, final extension at 72 °C for 10 min and held at 4 °C. An aliquot (2 μl) of each PCR product was stained with 1 μl of Gel red dye (Biotium, Hayward, California, USA) and separated on a 1% agarose gel. The band sizes of the PCR products were confirmed using a 100 bp DNA ladder (Life Technologies) and were visualized under a Gel Doc™ EZ Gel Documentation System (Bio-Rad). 2.3. Phylotype identification Phylotype assignment of the strains was done in a Pmx-PCR described by Fegan and Prior (2005). All PCR reactions consisted of 12.5 μl of 2X KAPA Taq ReadyMix (1.5 mM MgCl2 at 1X) (KAPA Biosystems), 0.5 mM of each primer, 50 ng template DNA and PCR grade water to a total volume of 25 μl. The primers used are listed in Table 1. PCR amplification was conducted in an Applied Biosystems ABI 9903 Veriti 384 Well Thermal Cycler and the conditions were: 96 °C for 10 min in 30 cycles of 96 °C for 15 s, 70 °C for 30 s and 72 °C for 30 s, final at 72 °C for 10 min and held at 4 °C. An aliquot (2 μl) of each PmxPCR product was separated with 2% agarose gel stained with 1 μl of Gel red dye (Biotium, Hayward, California, USA), using a 100bp DNA ladder (Life Technologies) for band size determination and visualized using a Gel Doc™ EZ Gel Documentation System (Bio-Rad).

2. Materials and methods 2.1. Bacterial isolation, growth media and conditions Fifty Ralstonia strains were obtained from the culture collection of the Bacteriology Unit at the Plant Protection Research Institute (PPRI), Agricultural Research Council (ARC), Roodeplaat, Pretoria and private seed companies in South Africa. They had been isolated from wilted tomato plants from different provinces of South Africa over the past 16 years. All the strains were streaked onto triphenyltetrazolium chloride (TZC) media (agar, 18 g; peptone, 10 g; glucose, 2.5 g; casamino acid,

2.4. Sequevar identification The egl gene of each of the isolates was sequenced to identify the sequevar or sequence type. A PCR amplification was performed in a final volume of 25 μl, consisting of 12.5 μl of 2X KAPA Taq ReadyMix 57


V.M. Shutt et al.

commercially available potting soil in a greenhouse set at 28 °C ± 2 °C and watered once daily. The greenhouse was located at the ARC, Roodeplaat, Pretoria. Three fourteen day-old seedlings were inoculated with each strain and the experimental layout was a completely randomized design. The inoculum was prepared from 24 h old cultures suspended in sterile water. The concentration of the inoculum was measured using a spectrophotometer and adjusted to 1.0 × 108 cfu/ml. Sterile hypodermic needles and syringes were used to inject 2 μl of the inoculum or sterile distilled water (control) into each plant stem (Williamson et al., 2002). Re-isolation of bacteria was done from the leading edge at the site of inoculation on the plant stems from both symptomatic and asymptomatic plants at four weeks post inoculation (Kado and Heskett, 1970). This was done by surface sterilizing a 10 mm piece of the plant stem with 70% ethanol and allowing it to dry in a laminar flow for about 10 min. The air dried samples were each placed in Bioreba bags, 1 ml sterile distilled water was added, the plant material crushed and 1 ml of the resulting suspension was serially diluted to 106 to 108.1 μl of each dilution was then plated on TZC media and incubated at 28 °C ± 2 °C for 24 h. Once their identity was confirmed as described above, the strains that were red to pink and mucoid on TZC media were used to repeat the pathogenicity trial to validate the first results.

(1.5 mM MgCl2 at 1X) (KAPA Biosystems), 0.5 mM of each primer (Endo-F and Endo-R) reported by Wicker et al. (2012) (Table 1), 50 ng template DNA and PCR grade water. PCR amplification was conducted in an Applied Biosystems ABI 9903 Veriti 384 Well Thermal Cycler and the conditions were: 96 °C for 10 min in 30 cycles of 96 °C for 15 s, 70 °C for 30 s and 72 °C for 30 s, final extension at 72 °C for 10 min and held at 4 °C. A 1% agarose gel was run using 2 μl of the PCR products, GelRed (Biotium, Hayward, California, USA) 2 μl and a 100 bp DNA ladder for band size determination (Life technologies) and viewed using a Gel Doc™ EZ Gel Documentation System (Bio-Rad). PCR products were purified with Exosap (Thermo Fisher Scientific Inc. Waltham, MA, USA). The purified product was used for a sequencing PCR and DNA sequencing was done using ABI Prism® Big Dye™ Terminator 3.0 Ready Reaction Cycle sequencing Kit (Applied Biosystems, Foster City, CA, USA) at the University of Pretoria sequencing facility. Sequences were assembled using CLC Main workbench v.7.7.1 (CLC Bio, Aarhus, Denmark; now Qiagen). 2.5. Sequevar analysis The sequences of the strains used in this study (51) were compared with the reference sequences obtained from Dr. Philippe Prior, CIRAD. The sequences were aligned using an online tool MAFFT version 7 (Katoh and Standley, 2013) and trimmed in BioEdit Sequence Alignment Editor v7.0.9.0 (Hall, 1999). MEGA7 was used to view and edit the alignments (Tamura et al., 2013). A jModel test (v3.1) was used to determine the evolutionary model of the gene sequence alignment (Posada, 2008) and PhyML 3.0190 software was used to construct Maximum Likelihood trees with bootstrap analysis of 1000 replicates (Guindon et al., 2010). Sequences were deposited in GenBank and accession numbers are shown in Table 2.

2.7. Disease scoring Disease symptom expression was monitored and recorded weekly. Disease severity was scored using the rating scale described by He et al. (1983). Severity scores used were: 1 = no symptoms, 2 = two leaves wilted, 3 = three leaves wilted, 4 = four or more leaves wilted and 5 = whole plant wilted. The formula below was used to calculate the percentage wilt as no other symptoms were observed.

Disease index (%) = [Σ (ni × vi) ÷ (V × N )] × 100 2.6. Pathogenicity trials

ni = number of plants with the particular disease rating; vi = disease rating; V = the highest disease rating and N = the number of plants observed. The experiments were discontinued after four weeks. Results were subjected to a statistical test for non-parametric data to validate inferences. Data from both pot trials one and two were normally distributed and were thus pooled.

Eight representatives of R. pseudosolanacearum, four from sequevar 31, two from sequevar 18, and the one strain of R. solanacearum were used. GMI 1000 was used as the positive control and sterile distilled water as the negative control in the pathogenicity trial. Seeds of the tomato cultivar Red Khaki were grown in pots (15 cm) containing Table 2 List of strains used in this study and GenBank accession numbers.

3. Results

Strain No.

Accession No.

Strain No.

Accession No.

3.1. Phylotype identification

B7 B28 B29 B71 B73 B74 B87 B89 B95 B99 B156 B157 B158 B159 BD222 BD232 BD260 BD261 BD265 BD266 BD268 BD682 BD683 BD754 BD756

KY709213 KY709214 KY709215 KY709216 KY709217 KY709218 KY709219 KY709220 KY709221 KY709222 KY709223 KY709224 KY709225 KY709226 KY709227 KY709228 KY709229 KY709230 KY709231 KY709232 KY709233 KY709235 KY709236 KY709237 KY709238

BD757 B760 BD1063 BD1064 BD1065 BD1070 BD1071 BD1072 BD1327 BD1329 BD1330 BD1331 BD1332 B1442 BD1443 BD1444 BD1445 BD1447 BD1448 BD1449 BD1451 BD1452 BD1552 BD1554 BD1555

KY709239 KY709240 KY709241 KY709242 KY709243 KY709244 KY709245 KY709246 KY709235 KY709236 KY709237 KY709238 KY709239 KY709240 KY709241 KY709255 KY709256 KY709257 KY709258 KY709259 KY709260 KY709261 KY709262 KY709264 KY709265

Results from both multiplex PCR and phylogenetic analysis of the egl gene regions revealed that all 50 strains belonged to the genus Ralstonia (Fig. 1, Table 3). The majority of the strains (i.e. 49) belonged to phylotype I (R. pseudosolanacearum), the African phylotype, except one strain, BD 261, which belonged to phylotype II (R. solanacearum), the American phylotype (Table 2). None of the isolates belonged to either phylotypes III or IV. 3.2. Sequevar identification The phylogenetic analyses of partial egl gene sequences revealed that the Ralstonia strains from South Africa grouped with known sequevars (Fig. 1, Table 3). Of the phylotype I strains (R. pseudosolanacearum), 13 grouped into sequevar 18, which contained the tomato strain GMI 1000. Thirty-four strains grouped into sequevar 31 with a Pelargonium strain, JT516. One strain was in phylotype II (R. solanacearum) and grouped with CIP 117 and IPO 1609 (strains from Solanum tuberosum) and CMR 34 (a Solanum lycopersicum strain), corresponding to the cold adapted race 3 biovar 2 strain. Two strains, BD 1555 and BD 1444 grouped together and separately from the others in phylotype I with a bootstrap support value of 72%. The population has remained 58


V.M. Shutt et al.

Fig. 1. Maximum likelihood tree based on partial endonuclease (egl) gene from R. solanacearum (red) and R. pseudosolanacearum (blue) associated with bacterial wilt of tomato in South Africa. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

59


V.M. Shutt et al.

Table 3 Phylotypes and sequevars identified for the Ralstonia strains used in this study, their year and location of isolation in South Africa. Strain Number

Phylotype

Sequevar

Year of Isolation

Location

B7 B28 B29 B71 B73 B74 B87 B89 B95 B99 B156 B157 B158 B159 BD222 BD232 BD260 BD261 BD265 BD266 BD268 BD682 BD683 BD754 BD756 BD757 B760 BD1063 BD1064 BD1065 BD1070 BD1071 BD1072 BD1327 BD1329 BD1330 BD1331 BD1332 B1442 BD1443 BD1444 BD1445 BD1447 BD1448 BD1449 BD1451 BD1452 BD1552 BD1554 BD1555

I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I

31 31 31 18 31 18 31 31 18 18 31 31 31 31 18 18 31 1 18 18 31 31 31 18 31 31 18 18 18 18 31 31 31 31 31 31 31 31 31 31 Possibly new 31 31 31 31 31 31 31 31 Possibly new

2016 2016 2016 2016 2016 2016 2016 2016 2016 2016 2016 2016 2016 2016 2000 2000 2002 2002 2002 2002 2002 2005 2005 2007 2007 2007 2016 2013 2013 2013 2013 2013 2013 2014 2014 2014 2014 2014 2016 2015 2015 2015 2015 2015 2015 2015 2015 2016 2016 2016

Gauteng Gauteng Gauteng Gauteng Gauteng Gauteng Gauteng Gauteng Gauteng Gauteng Gauteng Gauteng Gauteng Gauteng Limpopo Limpopo Gauteng Limpopo Mpumalanga Mpumalanga Mpumalanga Gauteng Gauteng Unknown Unknown Unknown Gauteng Gauteng Gauteng Gauteng Gauteng Gauteng Gauteng North West North West North West North West North West North West North West North West North West North West North West North West North West North West Gauteng Gauteng Gauteng

Table 4 Pathogenicity test results on tomato seedlings. Strain

Phylotype ID

Sequevar ID

% Disease index

BD 1064 BD 1072 BD 261 BD 156 BD 158 BD 268 BD 1444 BD 1554 BD 1555 GMI1000 Control

I I II I I I I I I I –

18 31 1 18 31 31 31 31 31 18 –

84.5a 27.5b 57cef 48ce 40.5bcef 37.33bcefg 29.33b 51.83c 51ce 86.83a 0

a

Percentage indices with the same letter (a-g) are not significantly different (P < 0.05) as analysed by ANOVA. a Data are pooled from two experiments.

4. Discussion The use of the phylotype scheme developed by Fegan and Prior (2005) is a useful tool for the identification and characterization of Ralstonia spp. In this study, the technique proved to be a reliable, sensitive and cost effective method for characterizing Ralstonia strains. The strains from wilted tomato plants in different provinces of South Africa, collected over 16 years, were mainly R. pseudosolanacearum (phylotype I) with only one strain identified as R. solanacearum (phylotype II). The strains had previously been biochemically characterized. The phenotypic tests that were used included Gram staining (Schaad, 1980), Kovac's oxidase test, Levan test, sucrose fermentation test (Schaad, 1980), lipase activity on Tween 80 agar (Sierra, 1957), and oxidation and/or fermentation of glucose (Hayward, 1964). This study is the first to use molecular tools to characterize Ralstonia species infecting tomato plants in South Africa. The phylotyping technique has been used by different researchers to characterize Ralstonia spp. in many other countries. Most recently Abdurahman et al. (2017) and Santiago et al. (2017) used this method to characterize Ralstonia isolates from Ethiopia and Brazil, respectively. The use of phylotyping to differentiate Ralstonia strains into sequevars is useful for developing informed quarantine strategies and implementing phytosanitary measures (Umesha and Avinash, 2015). The occurrence of R. solanacearum sequevar IIB-1 is of concern. This sequevar has caused serious economic losses in Europe and North America (Clarke et al., 2015). Crops in South Africa, particularly tomatoes and potatoes growing in cooler regions, are at risk from this particular strain of R. solanacearum. The egl gene is used to group Ralstonia strains into four phylotypes and 23 sequevars (Fegan and Prior, 2005). This gene encodes for an enzyme endoglucanase that hydrolyzes b-1,4- D-glycosidic bonds in plant cellulose, contributing to virulence of the pathogen (Saile et al., 1997; Fegan and Prior, 2005). Sequevars can be used to show genetic variation amongst isolates within a phylotype that differ by more than 1% in the partial egl sequence and have more than two representatives within a phylogenetic cluster (Fegan and Prior, 2005; Wicker et al., 2012). The strains BD 1555 and BD 1444 in phylotype I clustered separately from other sequevar groups with a bootstrap value of 72%. These two strains, however, also differed from each other by 2.6% in the partial egl sequence. Therefore, these two strains may represent new sequevars but more than one strain per sequence variant is required before a new sequevar can be designated. It is suspected that the R. solanacearum strain identified in this study was accidently introduced into South Africa by export of tomato or other plant material into the country. A good example where this has occurred previously is in the detection of Ralstonia strains from geranium seedlings grown in Central America and Africa and brought into Europe and the USA (Norman et al., 2009). Ralstonia spp. have a broad host range and a wide geographical distribution. In South Africa, many

stable over the past 16 years, with Sequevar 31 dominating in most provinces, except Limpopo.

3.3. Pathogenicity trials The results revealed that all eight strains tested were pathogenic to tomato seedlings. GMI 1000 and BD 1064 (R. pseudosolanacearum) caused the first visible symptoms in the tomato seedlings and were the most virulent while isolate BD 1072 was the least virulent (Table 4). BD 261 (R. solanacearum) was also pathogenic and significantly different from the other strains (P < 0.05) (Table 4). By the fourth week, all the inoculated plants showed different percentages of wilting or were dead (Table 4). Plants inoculated with sterile distilled water remained healthy throughout the period of the experiment. The highest percentage disease index was recorded for isolate GMI 1000 (86.8%) followed by BD 1064 (84.5%) while the lowest disease index ratings scores were recorded for BD1072 with 27.5% and BD 1444 with 29.3%. 60


V.M. Shutt et al.

potential hosts of Ralstonia spp. are cultivated and moved between different provinces, and from neighboring countries. In addition, Ralstonia spp. can exist as latent infection and importation of planting material from disease endemic regions can result in new outbreaks (Janse et al., 1998). The use of the correct diagnostic method that is rapid, specific and has the ability to detect very low concentrations should be employed to avoid movement of these pathogens. The following methods have proven effective in diagnosis of Ralstonia spp. in the past: visible threads of bacterial streaming from infected vascular bundles (Allen et al., 2001), culture-based diagnostics (Elsas et al., 2001), immunodiagnostic assays, nitrocellulose membrane (NCM)ELISA kits (Bekele et al., 2011), and diagnostic PCR (Elphinstone et al., 1996). It is therefore imperative that South African quarantine departments should employ accurate diagnostic methods to prevent these pathogens from entering our borders. Ralstonia spp. are designated quarantine pathogens in Europe and the USA, and it is additionally listed as an agent of bioterrorism in the U.S.A., thus subjected to an embargo on importation into this country (Young et al., 2008). When the bacterium becomes well established in soil and irrigation systems, eradication becomes very difficult. Even though Ralstonia spp. have a quarantine status in South Africa, there is still a need to improve stringency of these regulations as strict phytosanitary measures would improve both cross-border and inter-province movement. This might lead to eventual eradication of these pathogens from the country. For instance, Austria and Northern Ireland have employed strict quarantine and phytosanitary measures together with cultivation of resistant varieties and have completely eradicate R. solanacearum (Suffert and Ward, 2014). As part of quarantine procedures, it is recommended that DNA rather than cultures should be transported between laboratories both within countries and across borders (Tran et al., 2016). In this study, all representative isolates used were pathogenic to tomato seedlings to varying degrees. Various findings have reported Ralstonia strains as differing in their virulence (Li et al., 2016; Rodrigues et al., 2012). Morais et al. (2015) reported that information on the pathogenicity and molecular variability of Ralstonia strains will improve our knowledge on the epidemiology and ecology of these pathogens. This is particularly true with respect to latency, survival and aggressiveness of each strain. In our study, we showed that the population is stable in South Africa as only two sequevars were present in all provinces (except one probably due to the low number of strains used) and have remained present over 16 years. Additional sampling, especially in Limpopo where R. solanacearum IIB-1 was isolated, would be necessary to confirm this observation. In conclusion, given the sequevar variation of Ralstonia spp., it would be interesting to further investigate the genetic structure and the impact of the two species found in South Africa. This will lead to an improved understanding of the biology, epidemiology and ecology of these pathogens. The correct identification of these species will lead to the development of better tools for diagnosis, improved quarantine strategies, selection of the most appropriate biocontrol agents and breeding of resistant cultivars to control bacterial wilt.

American Phytopathological Society, St. Paul, MN, USA, pp. 11–13. Allen, C., Prior, P., Hayward, A., 2005. Bacterial Wilt Disease and the Ralstonia Solanacearum Species Complex. American Phytopathological Society, St. Paul, MN, USA. Álvarez, B., López, M.M., Biosca, E.G., 2008. Survival strategies and pathogenicity of Ralstonia solanacearum phylotype II subjected to prolonged starvation in environmental water microcosms. Microbiology 154, 3590–3598. Bekele, B., Abate, E., Asefa, A., Dickinson, M., 2011. Incidence of potato viruses and bacterial wilt disease in the west Amhara sub-region of Ethiopia. J. Plant Pathol. 93, 149–157. Buddenhagen, I., Kelman, A., 1964. Biological and physiological aspects of bacterial wilt caused by Pseudomonas solanacearum. Annu. Rev. Phytopathol. 2, 203–230. Buddenhagen, I., Sequeira, L., Kelman, A., 1962. Designation of races in Pseudomonas solanacearum. Phytopathology 52, 726. CABI, 2017. Datasheet on Ralstonia Solanacearum. https://www.cabi.org/isc/datasheet/ 45009#E929E841-EB6A-4C43-A4C6-651B7A4D6CE8CABI/EPPO1999. Clarke, C.R., Studholme, D.J., Hayes, B., Runde, B., Weisberg, A., Cai, R., Wroblewski, T., Daunay, M.-C., Wicker, E., Castillo, J.A., Vinatzer, B.A., 2015. Genome-enabled phylogeographic investigation of the quarantine pathogen Ralstonia solanacearum Race 3 Biovar 2 and screening for sources of resistance against its core effectors. Phytopathology 105, 597–607. Coutinho, T.A., Roux, J., Riedel, K.H., Terblanche, J., Wingfield, M.J., 2000. First report of bacterial wilt caused by Ralstonia solanacearum on eucalypts in South Africa. For. Pathol. 30, 205–210. Doidge, E.M., 1919. The role of bacteria in plant diseases. South Afr. J. Sci. 15, 407–412. Elphinstone, J., Hennessy, J., Wilson, J., Stead, D., 1996. Sensitivity of different methods for the detection of Ralstonia solanacearum in potato tuber extracts. EPPO Bull. 26, 663–678. Elsas, J.D.V., Kastelein, P., de Vries, P.M., van Overbeek, L.S., 2001. Effects of ecological factors on the survival and physiology of Ralstonia solanacearum bv. 2 in irrigation water. Can. J. Microbiol. 47, 842–854. Fegan, M., Prior, P., 2005. How complex is the Ralstonia solanacearum species complex? In: Allen, C., Prior, P., Hayward, A. (Eds.), Bacterial Wilt Disease and the Ralstonia Solanacearum Species Complex. American Phytopathological Society, St. Paul, MN, USA, pp. 449–461. Gillings, M., Fahy, P., 1994. Genomic fingerprinting: towards a unified view of the Pseudomonas solanacearum species complex. In: Hayward, A.C., Hartman, G.L. (Eds.), Bacterial Wilt: the Disease and its Causative Agent, Pseudomonas Solanacearum. CAB International, Wallingford, UK, pp. 95–112. Gorter, G.J.M.A., 1977. Index of plant pathogens and the diseases they cause in cultivated plants in South Africa. Plant Prot. Res. Inst. Sci. Bull. 392, 1–177. Guidot, A., Elbaz, M., Carrère, S., Siri, M., Pianzzola, M., Prior, P., Boucher, C., 2009. Specific genes from the potato brown rot strains of Ralstonia solanacearum and their potential use for strain detection. Phytopathology 99, 1105–1112. Guindon, S., Dufayard, J.-F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor analysis program. In: Nucleic Acids Symposium Series, vol. 41. pp. 95–98. Hayward, A., 1964. Characteristics of Pseudomonas solanacearum. J. Appl. Bacteriol. 27, 265–277. Hayward, A., 1994. The hosts of Pseudomonas solanacearum. In: Hayward, A.C., Hartman, G.L. (Eds.), Bacterial Wilt: the Disease and its Causative Agent, Pseudomonas Solanacearum. CAB International, Wallingford, UK, pp. 9–24. He, L., Sequeira, L., Kelman, A., 1983. Characteristics of strains of Pseudomonas solanacearum from China. Plant Dis. 67, 1357–1361. Janse, J., Araluppan, F., Schans, J., Wenneker, M., Westerhuis, W., 1998. Experiences with bacterial brown rot Ralstonia solanacearum biovar 2, race 3 in The Netherlands. In: Prior, P., Allen, C., Elphinstone, J. (Eds.), Bacterial Wilt Disease - Molecular and Ecological Aspects. Springer-Verlag, Berlin, Germany, pp. 146–154. Kado, C., Heskett, M., 1970. Selective media for isolation of Agrobacterium, Corynebacterium, Erwinia, Pseudomonas and Xanthomonas. Phytopathology 60, 969–976. Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772–780. Kelman, A., 1954. The relationship of pathogenicity of Pseudomonas solanacearum to colony appearance in a tetrazolium medium. Phytopathology 44, 693–695. Li, Y., Feng, J., Liu, H., Wang, L., Hsiang, T., Li, X., Huang, J., 2016. Genetic diversity and pathogenicity of Ralstonia solanacearum causing tobacco bacterial wilt in China. Plant Dis. 100, 1288–1296. Malherbe, S., Marais, D., 2015. Economics, yield and ecology: a case study from the South African tomato industry. Outlook Agric. 44, 37–47. Meng, F., 2013. The virulence factors of the bacterial wilt pathogen Ralstonia solanacearum. J. Plant Pathol. Microbiol. 4, 3. Morais, T.P., Lopes, C.A., Tebaldi, N.D., Luz, J.M.Q., 2015. Occurrence and diversity of Ralstonia solanacearum populations in Brazil. Biosci. J. 31, 1722–1737. Norman, D.J., Zapata, M., Gabriel, D.W., Duan, Y., Yuen, J.M., Mangravita-Novo, A., Donahoo, R.S., 2009. Genetic diversity and host range variation of Ralstonia solanacearum strains entering North America. Phytopathology 99, 1070–1077. Opina, N., Tavner, F., Hollway, G., Wang, J., Li, T., Maghirang, R., Fegan, M., Hayward, A., Krishnapillai, V., Hong, W., 1997. A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum). Asia Pac. J. Mol. Biol. Biotechnol. 5, 19–30. Posada, D., 2008. ModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25, 1253–1256. Poussier, S., Prior, P., Luisetti, J., Hayward, C., Fegan, M., 2000. Partial sequencing of the

5. Declaration The authors declare no conflict of interest. No humans or animals were involved in the execution of this research. All authors have consented to the submission of this manuscript to Crop Protection. References Abdurahman, A., Griffin, D., Elphinstone, J., Struik, P., Schulz, S., Schulte-Geldermann, E., Sharma, K., 2017. Molecular characterization of Ralstonia solanacearum strains from Ethiopia and tracing potential source of bacterial wilt disease outbreak in seed potatoes. Plant Pathol. 66, 826–834. Allen, C., Kelman, A., French, E., 2001. Brown rot of potatoes. In: Stevenson, W.R., Loria, R., Franc, G.D., Weingartner, D.P. (Eds.), Compendium of Potato Diseases, second ed.

61


V.M. Shutt et al.

organisms and some observations on the influence of the contact between cells and fatty substrates. Antonie Leeuwenhoek 23, 15–22. Suffert, M., Ward, M., 2014. Emerging pests of potato in Europe: early warning, risk analyses and regulation. Potato Res. 57, 263–271. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tran, T.M., Jacobs, J.M., Huerta, A., Milling, A., Weibel, J., Allen, C., 2016. Sensitive, secure detection of race 3 biovar 2 and native US strains of Ralstonia solanacearum. Plant Dis. 100, 630–639. Umesha, S., Avinash, P., 2015. Multiplex PCR for simultaneous identification of Ralstonia solanacearum and Xanthomonas perforans. Biotech 5, 245–252. Wicker, E., Lefeuvre, P., De Cambiaire, J.-C., Lemaire, C., Poussier, S., Prior, P., 2012. Contrasting recombination patterns and demographic histories of the plant pathogen Ralstonia solanacearum inferred from MLSA. ISME J. 6, 961–974. Williamson, L., Nakaho, K., Hudelson, B., Allen, C., 2002. Ralstonia solanacearum race 3, biovar 2 strains isolated from geranium are pathogenic on potato. Plant Dis. 86, 987–991. Yabuuchi, E., Kosako, Y., Oyaizu, H., Yano, I., Hotta, H., Hashimoto, Y., Ezaki, T., Arakawa, M., 1992. Proposal of Burkholderia gen. nov. and transfer of seven species of the genus Pseudomonas homology group II to the new genus, with the type species Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov. Microbiol. Immunol. 36, 1251–1275. Yabuuchi, E., Kosako, Y., Yano, I., Hotta, H., Nishiuchi, Y., 1995. Transfer of two Burkholderia and an Alcaligenes species to Ralstonia gen. Nov. Microbiol. Immunol. 39, 897–904. Young, J.M., Allen, C., Coutinho, T., Denny, T., Elphinstone, J., Fegan, M., Gillings, M., Gottwald, T.R., Graham, J.H., Iacobellis, N.S., Janse, J.D., Jacques, M.-A., Lopez, M.M., Morris, C., Parkinson, N., Prior, P., Pruvost, O., Rodrigues Neto, J., Scortichini, M., Takikawa, Y., Upper, C.D., 2008. Plant pathogenic bacteria as bioterror weapons – a real threat? Phytopathology 98, 1060–1065.

hrpB and endoglucanase genes confirms and expands the known diversity within the Ralstonia solanacearum species complex. Syst. Appl. Microbiol. 23, 479–486. Prior, P., Fegan, M., 2005. Recent developments in the phylogeny and classification of Ralstonia solanacearum. Acta Hortic. (Wagening.) 695, 127–136. Prior, P., Ailloud, F., Dalsing, B.L., Remenant, B., Sanchez, B., Allen, C., 2016. Genomic and proteomic evidence supporting the division of the plant pathogen Ralstonia solanacearum into three species. BMC Genom. 17, 90. Remenant, B., de Cambiaire, J.-C., Cellier, G., Jacobs, J.M., Mangenot, S., Barbe, V., Lajus, A., Vallenet, D., Medigue, C., Fegan, M., 2011. Ralstonia syzygii, the blood disease bacterium and some Asian R. solanacearum strains form a single genomic species despite divergent lifestyles. PLoS One 6, e24356. Rodrigues, L., Destéfano, S., da Silva, M., Costa, G., Maringoni, A.C., 2012. Characterization of Ralstonia solanacearum strains from Brazil using molecular methods and pathogenicity tests. J. Plant Pathol. 94, 505–516. Safni, I., Cleenwerck, I., De Vos, P., Fegan, M., Sly, L., Kappler, U., 2014. Polyphasic taxonomic revision of the Ralstonia solanacearum species complex: proposal to emend the descriptions of Ralstonia solanacearum and Ralstonia syzygii and reclassify current R. syzygii strains as Ralstonia syzygii subsp. syzygii subsp. nov., R. solanacearum phylotype IV strains as Ralstonia syzygii subsp. indonesiensis subsp. nov., banana blood disease bacterium strains as Ralstonia syzygii subsp. celebesensis subsp. nov. and R. solanacearum phylotype I and III strains as Ralstonia pseudosolanacearum sp. nov. Int. J. Syst. Evol. Microbiol. 64, 3087–3103. Saile, E., McGarvey, J.A., Schell, M.A., Denny, T.P., 1997. Role of extracellular polysaccharide and endoglucanase in root invasion and colonization of tomato plants by Ralstonia solanacearum. Phytopathology 87, 1264–1271. Santiago, T.R., Lopes, C.A., Caetano-Anollés, G., Mizubuti, E.S.G., 2017. Phylotype and sequevar variability of Ralstonia solanacearum in Brazil, an ancient centre of diversity of the pathogen. Plant Pathol. 66, 383–392. Schaad, N.W., 1980. Laboratory guide for identification of plant pathogenic bacteria. Am. Phytopathol. Soc. 1–72 (St. Paul, MN, U.S.A). Sierra, G., 1957. A simple method for the detection of lipolytic activity of micro-

62