Molecular Human Reproduction Vol.7, No.7 pp. 603–610, 2001
Characterization of the genomic organization, localization and expression of four PRY genes (PRY1, PRY2, PRY3 and PRY4) Katrien Stouffs1,3, Willy Lissens1, Lisbet Van Landuyt2, Herman Tournaye2, Andre´ Van Steirteghem2 and Inge Liebaers1 1Center
for Medical Genetics and 2Center for Reproductive Medicine, University Hospital, Dutch-speaking Brussels Free University (Vrije Universiteit Brussel), Laarbeeklaan 101, 1090 Brussels, Belgium
3To
whom correspondence should be addressed. E-mail:
[email protected]
PRY (PTP-BL related on the Y chromosome) has been proposed as a candidate spermatogenesis gene. We report the characterization of the genomic structure, the number of copies on the Y chromosome and the expression of the gene. By comparison of the cDNA sequence with the genomic sequence, five exons were identified. Analysis of GenBank-derived clones on the Y chromosome revealed the presence of two full-length copies in azoospermia factor region b (AZFb) (PRY1 and PRY2) and two shorter versions of the PRY gene containing exons 3, 4 and 5 in AZFc (PRY3 and PRY4). A clone containing sequences homologous to exons 3, 4 and 5 is located in area 5L (between AZFa and AZFb), a clone containing a sequence homologous to exon 5 is located in area 5M (in AZFb) and a clone containing a fragment homologous to exon 3 is located in 6F. A repeat structure of exons 1 and 2 is present on the short arm of the Y chromosome as well as on the long arm. PRY1 and PRY2, two gene copies that are located in AZFb, a region often deleted in patients with severe male infertility, were shown to be expressed in the testis. PRY may therefore play an important role in spermatogenesis. Key words: AZF/male infertility/PRY/Y chromosome/Y genes
Introduction Microdeletions on the long arm of the Y chromosome (Yq11) have been found in ~8% of patients with unexplained azoospermia or oligozoospermia. The locations on Yq of three Azoospermia Factor (AZF) regions in which microdeletions are more frequent have been described (Vogt et al., 1996), namely AZFa, AZFb and AZFc. Several genes have already been mapped into these regions. The RBMY (RNA Binding Motif) and DAZ (Deleted in Azoospermia) genes have been most studied (Ma et al., 1993; Reijo et al., 1995), they are both multigene families located in AZFb and AZFc respectively. The AZFc region is often deleted completely, giving rise to the deletion of all copies of the DAZ gene. In such cases, it has been suggested that the absence of the DAZ gene leads to infertility (Grimaldi et al., 1998; Liow et al., 1998). However, recent research questions the contribution of the DAZ gene to male infertility, since: no point mutations or small rearrangements have yet been described (Vereb et al., 1997); the introns and exons evolve at the same rate (Agulnik et al., 1998); DAZ is located on the Y chromosome of only catarrhini species © European Society of Human Reproduction and Embryology
(i.e. old world monkeys, apes and humans) (Agulnik et al., 1998); and an autosomal homologue (called DAZLA or DAZL) is present on chromosome 3 (Seboun et al., 1997; Lee et al., 1998; Dorfman et al., 1999; Nishi et al., 1999; Tsai et al., 2000). Moreover, DAZ is not the only gene in the AZFc region. In 1997, Lahn and Page identified twelve novel genes on the human Y chromosome (Lahn and Page, 1997). These genes may also play an important role in spermatogenesis, and some have already been studied in detail: CDY or ChromoDomain on the Y chromosome (Lahn and Page, 1999), VCX/Y or Variable Charge X/Y, previously known as BPY1 (Lahn and Page, 2000), DFFRY or Drosophila Fat Facets Related Y (Brown et al., 1998; Sun et al., 1999), UTY or Ubiquitous TPR Motif Y (Warren et al., 2000) and DBY or Dead Box on the Y chromosome (Sun et al., 1999). We have studied another gene identified by Lahn and Page, PTP-BL Related Y (PRY), a gene homologous to the mouse Protein Tyrosine Phosphatase–BAS Like (PTP-BL) gene. We report the presence of four possible functional copies of the PRY gene (PRY1, PRY2, PRY3 and PRY4) on the long arm of the Y chromosome. PRY1 and PRY2 were found to be expressed in the testis. 603
K.Stouffs et al.
Figure 1. Legend on facing page.
604
Characterization of PRY genes
Materials and methods Characterization of intron/exon structure To determine the presence of introns, primers were designed starting from the cDNA sequence of the PRY gene (GenBank, accession number AF000988). First, a Genome Walker kit (Clontech, Westburg, Leusden, The Netherlands) was used to amplify fragments of the gene in a nested polymerase chain reaction (PCR), with, on one side, two gene-specific primers derived from the cDNA sequence, and, on the other side, two adaptor primers (AP1 and AP2). These fragments
Table I. Primers used for genome walking Exon
F/R
Primer 1
Primer 2
1 2 3* 3 4 4 5 5
F R R F R F R F
PRYP24 PRYP33 PRYP26 PRYP1a PRYP15 PRYP14 PRYP2b PRYP1b
PRYP25 PRYP34 PRYP23 PRYP10 PRYP16 PRYP13 PRYP3 PRYP4
The primers used in second (nested) PCR reactions (Primer 2), were also used for sequencing. *Primers PRYP26 and PRYP23 are actually located in intron 3. F/R: forward or reverse primer. Primer sequences are given in Table II.
Table II. Sequence of primers Primer
Sequence
PRYP1a PRYP1b PRYP2b PRYP3 PRYP4 PRYP6 PRYP7 PRYP10 PRYP13 PRYP14 PRYP15 PRYP16 PRYP17 PRYP18 PRYP20* PRYP23* PRYP24 PRYP25 PRYP26* PRYP28 PRYP29 PRYP31 PRYP33 PRYP34 PRYP37
GACATGAATAAAATGGGCCTC GCTACCAAAGTGTGGTTTGC GTTGTTGGAGGTTGTGATGTC ATCGTGGTTCCACTCAACGC ACTTTCCCTGAACAGAGGTC GCAAACCACACTTTGGTAGC ATGGCATTGAGACATCTGGC CAATCCCAAGAAGAACCACTC GGCCAGAAGGAAGAAGGATC ACTTTCCCTGAACAGAGGTC AGATCCTTCTTCCTTCTGGC CCTCTGTTCAGGGAAAGTTC GATTTTCCAAGGCTACCACC TGAACGTGGCCACAGATGTC CAGAGATTAGGAACAACAGC GCCCARATGATGACAGTAC AGAAGAGGAGCACACCACAC CAGACATCTTGCAGTGTTTC ACATATTCCATGTCCTAGTC TATCTGCACAGTCCGAGGTC TGAGAGAGCTTCTGAGAGAC AGGAAAGTAGAAAGCCAAGC AGTCCTTAGAGGTGGGTGTC AAGAAGGTTGGGCTCTTGAC GAAAAATGAGTTATTAAAGC
All primers are given in a 5⬘ to 3⬘ direction. *Primers located in introns rather than exons.
were sequenced according to standard procedures (USB, Amersham Pharmacia Biotech Inc.). The primers used for genome walking and sequencing are listed in Tables I and II. BLAST search A BLAST search at http://www3.ncbi.nlm.nih.gov/BLAST/ was used to identify clones containing fragments identical with or homologous to our PRY gene sequence. Clones are localized on the Y chromosome with Entrez Genome Map View at: http://www.ncbi.nlm.nih.gov/ entrez/query.fcgi?db⫽Genome cDNA analysis We isolated PRY cDNA from a human testis cDNA library (Clontech) by performing PCR with primer pairs PRYP25-PRYP3, PRYP1aPRYP18, PRYP25-PRYP37 and PRYP1a-PRYP37 (Table II). Two fragments were separated by agarose gel electrophoresis, purified using the QIAEXII Gel Extraction kit (Qiagen, Westburg, Leusden, The Netherlands), reamplified and sequenced. Patients DNA samples from 14 patients in whom six different types of microdeletions in the Yq11 region were found (Figure 1), were used to map the different copies of the PRY gene. The histology of the testicular biopsies of these 14 patients is given in Table III. The deletions were characterized using 46 sequence-tagged sites (STS), spanning the three AZF regions as well as regions in between (Van Landuyt et al., 2000). For PCR and sequencing, normal fertile male and female controls were used where appropriate. Polymerase chain reaction PCR reactions were performed in a 100 µl mix containing 500 ng of DNA, 1⫻PCR Buffer II (Perkin Elmer, Willisley, MA, USA), 2 mmol/l of MgCl2, 0.2 mmol/l of each dNTP (Amersham Pharmacia Biotech
Table III. Testicular phenotypes of the patients with partial deletions of Yq (see Figure 1) Patients
Histology
Presence of PRY genes
1a–1c 1d 1e 1f 1g–1h 1i 2 3 4
Incomplete maturation arrest at spermatid stage Maturation arrest at spermatid stage Maturation arrest at spermatocyte stage Complete SCO syndrome Not biopsied (severe oligozoospermia) Not biopsied Not biopsied (severe oligozoospermia) Maturation arrest at spermatocyte stage L: complete SCO syndrome R: incomplete SCO syndrome Maturation arrest at spermatocyte stage L: complete SCO syndrome R: incomplete SCO syndrome
PRY1/PRY2 PRY1/PRY2 PRY1/PRY2 PRY1/PRY2 PRY1/PRY2 PRY1/PRY2 PRY1/PRY2 PRY3/PRY4 none
5 6
PRY3/PRY4 none
Patients 1a–1i are patients with the same AZFc deletion pattern (indicated as pattern 1 in Figure 1). The PRY genes that are retained are indicated. SCO ⫽ Sertoli cell-only.
Figure 1. Overview of the location of clones on the Y chromosomes and deletion patterns of patients with Yq microdeletions. Nine patients had the deletion pattern numbered 1. Sequence-tagged sites (STS) used to analyse the deletions in a multiplex PCR are indicated on the left side of the deletion patterns. Line B indicates the position of the genes as deduced from patients with partial deletions of the Y chromosome. Line C indicates the locations of the clones from GenBank. Line A shows the most probable position of the genes on the Y chromosome (combination of B and C). The names of the clones as well as their contents are mentioned. The genes containing the same sequence as the cDNA sequence are shown in bold.
605
K.Stouffs et al.
Table IV. Results of polymerase chain reaction amplification of fragments of the PRY gene in the six patient deletion patterns (1–6) 1
2
3
4
5
6
Exon1/exon2 PRYP28/PRYP33
⫹
⫹
⫹
⫹
⫹
⫹
Exon2 PRYP29/PRYP33
⫹
⫹
⫹
⫹
⫹
⫹
Exon3 PRYP1a/PRYP31 PRYP1a/PRYP26*
⫹ ⫹
⫹ ⫹
⫹ ⫹
– –
⫹ ⫹
– –
Exon5 PRYP17/PRYP3 PRYP7/PRYP6 PRYP1b/PRYP2b
⫹ ⫹ ⫹
⫹ ⫹ ⫹
⫹ ⫹ ⫹
– ⫹ –
⫹ ⫹ ⫹
– ⫹ –
PRYP28 is located in exon 1 and PRYP33 in exon2. PRYP26* is actually located in intron 3.
Inc., Roosendaal, The Netherlands), 1 µmol/l of each primer and 1.25 units of Taq polymerase. Thermocycling conditions consisted of an initial denaturation of 5 min at 94°C, 35 cycles of 1 min at 94°C, 1 min at 60°C and 2 min at 72°C and a final extension of 7 min at 72°C. The primers used for the PCR reactions are listed in Tables II and IV. Northern blot analysis Human Multiple Tissue Northern Blots (MTN Blot I and II; Clontech) were performed according to the instructions of the manufacturer. The probe was digoxigenin (DIG) labelled by PCR amplification with primers PRYP17 and PRYP3 (located on exon 5). The detection was performed with anti-DIG and a chemiluminescent reaction using CDP-Star (Roche, Brussels, Belgium).
Results To define the genomic structure of the PRY gene, we used a genome walking kit for which sets of primers (Table I) were developed from the published cDNA sequence (Lahn and Page, 1997). By comparison of the characterized sequence with the published cDNA sequence, the localization of introns could be determined. Four introns were mapped, at cDNA positions 88/89, 175/176, 299/300 and 416/417 [numbering defined by Lahn and Page (1997), GenBank accession number AF000988]. The lengths of introns 1 and 3 are 101 bp and 2.5 kb respectively as determined by sequencing for intron 1 and by PCR amplification with primer pair PRYP10/PRYP20 for intron 3. The length of the other introns could not be determined, probably because they are too long to amplify by PCR. Parts of introns 2, 3 and 4 were sequenced. By sequencing the exons, eleven differences with the cDNA sequence described in GenBank were noticed. Seven of these differences were single base substitutions, while three other differences were deletions of a single base pair and one was an insertion of a single base pair. Moreover, at positions 1070 and 1140, both an A and a G were observed. Substitutions were found at positions 254 (C→T), 261 (C→T), 268 (A→G), 357 (C→T), 727 (C→G), 1100 (T→C) and 1177 (A→C); an A was deleted at positions 176, 214 and 216 and a G was inserted between positions 617 and 618 [numbering defined by Lahn and Page (1997) but redefined in Figure 3, as explained below]. 606
The sequence of the exons and parts of the introns as determined in the previous section was used to perform a BLAST search. Fifteen clones could be identified that contain sequences identical with or highly homologous to the sequence we had entered: RP11-573O23 (GenBank accession number AC010154), RP11-492C2 (AC006335), NH0373F14 (AC007967), RP11-418M8 (AC009491), RP11-453C1 (AC010891), RP11-182H20 (AC017019), RP11-357E16 (AC007742), RP11-268K13 (AC024183), RP11-143C1 (AC007379), RP11-66M18 (AC007359), RP11-427G18 (AC008175), RP11-477B5 (AC007320), RP11-245K4 (AC007965) and RP11-506M9 (AC016752), RP11-251M8 (AC010682) (Figure 1). Two of these clones (RP11-66M18 and RP11-427G18) contain the whole PRY gene with all exons and parts of the introns as defined by using the Genome Walker kit, and a repeat structure of sequences homologous to exon 1 and exon 2 (Figure 2). In clone RP11-66M18, a G is present at position 1140, while in RP11-427G18 an A is present. In both clones, an A was found at position 1070. In clone RP11-506M9 and RP11-245K4 only exons 3, 4 and 5 were found, also with the same sequence of introns and exons as we found in this study. In these clones a G is present at position 1070 and at position 1140. Clones RP11-357E16 and RP11-268K13 contain sequences that are homologous to exons 3, 4 and 5 (89% identity to the sequence defined in this study). These two clones overlap and the sequences homologous to exons 3, 4 and 5 are located in this region. Clone RP11-143C1 contains a sequence homologous to exon 5 (86% identity), clone RP11-251M8 contains a fragment homologous to exon 3 (84% identity) and clones RP11-573O23, RP11-492C2, NH0373F14, RP11-418M8, RP11-453C1 and RP11-182H2O all contain a repeat structure of fragments homologous to exons 1 and 2 (83–100% identity). We were not able to find a genomic clone in GenBank with a sequence identical to the cDNA sequence described by Lahn and Page (1997). We have redefined the open reading frame of our sequence that is different from the one described by Lahn and Page (1997), since two deletions and an insertion occurred after the putative start codon. We defined the possible translation initiation codon in exon 3 and named this ⫹1 (Figure 3). The predicted protein is 148 amino acids long, of which the first 129 amino acids are identical to the protein originally described. Introns 1 and 2 are located before the start codon, at positions –53/–52 and –140/–139 according to the new numbering. The remaining two introns are located at positions 69/70 and 185/ 186. Clones RP11-66M18 and RP11-427G18, containing exons 1, 2, 3, 4 and 5 and clones RP11-245K4 and RP11-506M9, containing exons 3, 4 and 5, all have exactly the same open reading frame. We will refer to these copies as PRY1, PRY2, PRY3 and PRY4 respectively. We have isolated cDNA sequences from a testis specific cDNA library by PCR amplification with primer pair PRYP25 and PRYP3, located in exon 1 and exon 5 respectively and with primer pair PRYP1a and PRYP18, located in exon 3 and exon 5 respectively. The former primer pair is expected to amplify the full-length copies of PRY1 and PRY2, if expressed, while the latter primer pair would be able to also amplify the copies with exons 3, 4 and 5 in clone RP11-254K4 (PRY3)
Characterization of PRY genes
Figure 2. Structure of the two clones RP11-66M18 (PRY1) and RP11-427G18 (PRY2) containing the five exons of the PRY gene and a repeat structure of sequences homologous to exon 1 and 2. Dark boxes contain the sequences that are identical to the cDNA sequence.
Figure 3. Sequence and location of the introns of the PRY1 and PRY2 genes. PRY3 and PRY4 contain exons 3, 4 and 5. The new putative initiation codon is shown as a grey box; the start codon defined by Lahn and Page (1997) is underlined with a waved line. Nucleotides in bold indicate the bases that were found to be different from the published cDNA sequence; arrows indicate the location of deleted bases; [G] indicates an inserted G and A/G indicates that during sequencing both an A and a G were observed.
and RP11-506M9 (PRY4). With both primer pairs, two fragments were obtained in equal amounts and were ~120 bp different in length. The smallest fragment has the same
sequence as the sequence we identified before, while the second fragment has an insert of 115 bp at the location of intron 4. To be sure we had not picked up a new gene, we 607
K.Stouffs et al.
used the sequence of the insert to perform a new BLAST search. The insert could be located in intron 4, in PRY1 and PRY2. In PRY3 and PRY4, containing exons 3, 4 and 5, one substitution is present in the sequence in intron 4 found with the BLAST search. However, sequencing results showed only the sequence of the insert observed in PRY1 and PRY2. The sequence has consensus splice sites at the 3⬘ and 5⬘ end. This result could indicate that PRY1 and/or PRY2 are alternatively spliced. Analysis of the predicted amino acid sequence of the cDNA with the insert indicated that this cDNA sequence is probably not functional since a stop codon arises early in the inserted fragment (in all three reading frames). Again, we were not able to isolate a cDNA with a sequence identical to the one defined by Lahn and Page (1997). In the next step, we determined whether all four PRY genes are expressed, by analysing the bases at position 841 and 911. PRY1 and PRY2, with exons 1, 2, 3, 4 and 5 have an A at position 841, while PRY3 and PRY4 have a G at this position. cDNA was amplified with primer pair PRYP1a and PRYP37, located in exon 3 and exon 5 respectively and with PRYP25 and PRYP37, located in exon 1 and exon 5. The former primer pair is able to amplify all possible functional copies of PRY, while the latter is only able to amplify PRY1 and PRY2, if expressed. Sequencing was performed with primer PRYP7, located in exon 5. For both primer pairs, only an A was found at position 841. This indicates that only PRY1 and/or PRY2 are expressed in testis. PRY1 has a G at position 911, where PRY2 has a A, which makes it possible to distinguish PRY1 and PRY2. At position 911, both an A and a G were observed. This shows that probably both PRY1 and PRY2 are expressed. With the ‘Homo Sapiens Map View’ (Entrez), the different clones could be localized on the Y chromosome (Figure 1). The clones containing a complete PRY gene, namely RP1166M18 (PRY1) and RP11-427G18 (PRY2), are located in region 6B, while clones RP11-245K4 (PRY3) and RP11-506M9 (PRY4), containing a copy of the gene with exons 3, 4 and 5, are located in region 6F. The location, number and contents of the clones could be confirmed by analysing patients with partial deletions of the Y chromosome. In the DNA from these patients and from positive controls, i.e. men with proven fertility, several fragments of the exons were amplified by PCR (Tables II and IV). DNA from women was used as a negative control. The analysis of the nine patients with a deletion of the AZFc region (indicated as 1a–1i in Table III) always gave the same results. Therefore, we referred to it as patient 1. Exon 5 could be completely amplified from the DNA of patients 1, 2, 3 and 5 (Table IV) who retain a copy with the same sequence as defined by using the Genome Walker Kit and sequencing of the cDNA (PRY1, PRY2, PRY3 and PRY4, Figure 1). In the DNA of patients 4 and 6, only a fragment of exon 5 could be amplified by using primer pair PRYP6 and PRYP7 (Table IV). These results confirm the presence of a sequence homologous to exon 5 in clone RP11-143C1. Exon 3 could only be amplified from the DNA of those patients who retain a copy with the sequence completely identical to exon 3: in PRY3 and PRY4 for patients 3 and 5 and in PRY1 and PRY2 for patients 1 and 2. For exons 1 and 2, we observed amplification 608
in all six patients, as was expected considering the multicopy nature of exon 1 and 2. Parts of exon 3, amplified with primers PRYP1a/PRYP26, and exon 5, amplified with PRYP17/PRYP3, were sequenced for patients 1, 2, 3 and 5. Eight of the eleven differences with the published cDNA sequence are located in these fragments. Sequencing results showed exactly the same sequence for these four patients and positive controls as the cDNA sequence we defined previously, except for position 841 where an A was observed for patients 1 and 2, a G for patients 3 and 5 and both A and G for the positive control. This result is consistent with the localization of the clones/genes in which these differences were found. Transcription of the PRY genes was analysed by Northern blot analysis of RNA from different human tissues (Clontech). Only in testis was a relatively weak signal detected (data not shown), as already described (Lahn and Page, 1997).
Discussion In 1997, Lahn and Page first isolated the PRY gene. They mapped three copies of the gene: one on the short arm of the Y chromosome in area 4A, and two on the long arm of the Y chromosome: one in area 6C (or AZFb) and one in 6E (or AZFc). It must be noted that several authors define different localizations of the subregions of the 43-interval map (Vollrath et al., 1992), with some localizing 6C in AZFb and others localizing 6C in AZFc. In the present study, a sequence was isolated by genome walking and sequencing. In this sequence, eleven differences with the cDNA sequence characterized by Lahn and Page (1997) were observed in the exons. We also noticed both an A and a G at positions 841 and 911, indicating that we had amplified at least two different copies. We examined the possibility that we had isolated another gene (or other genes) or another copy (or other copies) of a multigene family. Therefore, we performed a BLAST search on GenBank sequences with the sequence defined in this study. No clone could be identified with a sequence identical to the one originally described by Lahn and Page (1997). In contrast, two clones were found with the same sequence as detected in this report: clone RP11-66M18 where a G was detected at position 911 and an A at position 841 and clone RP11-427G18 with an A at position 911 and an A at position 841. Two other clones (RP11-506M9 and RP11-245K4) contain a shorter version of the gene, with only exons 3, 4 and 5 and with a G at position 841 and at position 911, but with otherwise exactly the same sequence. The differences with the cDNA sequence published by Lahn and Page (1997) were observed (i) in GenBank, (ii) by sequencing the fragments obtained by genome walking, (iii) by sequencing cDNA isolated from a testis specific cDNA library, (iv) by sequencing DNA material from men with proven fertility, (v) by sequencing DNA from patients with partial deletions in Yq11, and (vi) in exon trapping experiments (Wong et al., 1999). Wong et al. have isolated and sequenced two exons coming from the PRY gene, namely exon 3 and 4. Four clones (RP11-66M18, RP11-427G18, RP11-245K4 and RP11-506M9) were identified with copies
Characterization of PRY genes
of the PRY gene that might be functional. We designated these as PRY1, PRY2, PRY3 and PRY4 respectively. PRY3 and PRY4 lack exons 1 and 2, though these exons are located upstream of the start codon. Via Entrez Map View, the clones/genes could be localized on the Y chromosome (Figure 1, line C). The localization could be confirmed by PCR amplification and Southern blot analysis (data not shown) of DNA from patients with Yq microdeletions (Figure 1, line B). The combination of both locations shows the most probable positions of the clones on the Y chromosome (Figure 1, line A). PRY1 and PRY2, containing five exons of the PRY gene are then located in region 6B (AZFb). PRY3 and PRY4, containing only exons 3, 4 and 5 are located in 6F (AZFc). The latter is in accordance with the previously described location (Wong et al., 1999), as two exons were found at the positions of STS sY202-sY157 by performing exon trapping experiments of the AZFc region. Wong et al. (1999) also described the presence of PRY mRNA in tissues other than testis. The primers used for this experiment were designed from exon 3 and 4 (previously isolated by exon trapping). When primers derived from exon 3 were used, amplification of mRNA was seen in the testis, brain and skeletal muscle, whereas amplification of exon 4 was only observed in testis. By Northern blot analysis, performed in our laboratory, only hybridization to cDNA in testis was observed, as originally described by Lahn and Page (1997). We determined which genes are transcribed in testis by sequencing the 3⬘ end of cDNA isolated from a testis specific cDNA library. Sequencing results showed an A at position 841 and both an A and a G at position 911. This indicates that probably only PRY1 and PRY2 are transcribed in testis. However, further in-vivo experiments on testis biopsies are necessary to confirm these results. PCR analysis of PRY cDNA isolated from a testis specific cDNA library also showed the presence of two fragments. One fragment has an insert of 115 bp which is probably due to alternative splicing of PRY1 and/or PRY2. Most likely, the cDNA sequence with the insert is not functional as it introduces a premature stop codon. The testicular histology of the 14 patients with a Yq deletion and the presence of PRY genes on their Y chromosomes are described in Table III. In the ten AZFc-deleted patients, who retain the PRY copies in AZFb (PRY1 and PRY2), a phenotypic diversity was found. Testicular histology varies from complete Sertoli cell-only syndrome (SCOS) to maturation arrest at the spermatocyte or spermatid stage. Moreover, in three patients with an AZFc deletion, spermatozoa were present in their ejaculates (patients 1g, 1h and 2). In the patients with incomplete maturation arrest, few spermatozoa could be retrieved from their testicular tissue. On the other hand, in all four patients with an AZFb deletion and thus missing the transcribed genes PRY1 and PRY2, no spermatozoa could be found when testis biopsies were analysed. Similar observations about the presence of mature germ cells in patients with AZFc deletions and the absence of them in patients missing the AZFb region are described in several papers (Mulhall et al., 1997; Brandell et al., 1998; Silber et al., 1998). Patients 3 and 5, who retain PRY3 and PRY4, but lack the two copies in AZFb that are transcribed in testis tissue (PRY1 and PRY2),
both showed a complete maturation arrest at the spermatocyte stage. Patients 4 and 6, who carry the largest deletions and are therefore missing the PRY copies in both AZFb and AZFc, have a more severe spermatogenic phenotype. They both showed complete SCOS in their left testicle and incomplete SCOS in their right testicle with only a few germ cells that are arrested at the spermatocyte level. It must be taken into consideration that other genes are also missing in the deleted regions, and these might also contribute to infertility. Testis material from patients with microdeletions in Yq was not available for the study of PRY mRNA. This would have been useful to map the coding genes. The presence of more than one identical gene copy is also an obstacle in mutation analysis. Observations of point mutations or small rearrangements in the PRY gene in men with fertility problems would provide direct evidence for its function in male infertility.
Acknowledgements We thank the laboratory, clinical and paramedical staff of the centers for Medical Genetics and Reproductive Medicine for assistance and Frank Winter of the Language Education Center for reviewing the language of the manuscript. The work was supported by grants from the Fund for Scientific Research (FWO-Vlaanderen) and from the Research Council and a Concerted Action from the Vrije Universiteit Brussel (VUB).
References Agulnik, A.I., Zharkikh, A., Boettger-Tong, H. et al. (1998) Evolution of the DAZ gene family suggests that Y-linked DAZ plays little, or a limited, role in spermatogenesis but underlines a recent African origin for human populations. Hum. Mol. Genet., 7, 1371–1377. Brandell, R.A., Mielnik, A., Liotta, D. et al. (1998) AZFb deletions predict the absence of spermatozoa with testicular sperm extraction: preliminary report of a prognostic genetic test. Hum. Reprod., 13, 2812–2815. Brown, G.M., Furlong, R.A., Sargent, C.A. et al. (1998) Characterisation of the coding sequence and fine mapping of the human DRRFY gene and comparative expression analysis and mapping to the Sxrb interval of the mouse Y chromosome of the Dffry gene. Hum. Mol. Genet., 7, 97–107. Dorfman, D.M., Genest, D.R. and Reijo Pera, R.A. (1999) Human DAZL1 encodes a candidate fertility factor in women that localizes to the prenatal and postnatal germ cells. Hum. Reprod., 14, 2531–2536. Grimaldi, R., Scarponi, C., Rossi, P. et al. (1998) Analysis of Yq microdeletions in infertile males by PCR and DNA hybridisation techniques. Mol. Hum. Reprod., 4, 1116–1121. Lahn, B.T. and Page, D.C. (1997) Functional coherence of the Y chromosome. Science, 278, 675–680. Lahn, B.T. and Page, D.C. (1999) Retroposition of autosomal mRNA yielded testis-specific gene family on human Y chromosome. Nature Genet., 21, 429–433. Lahn, B.T. and Page, D.C. (2000) A human sex-chromosomal gene family expressed in male germ cells and encoding variably charged proteins. Hum. Mol. Genet., 9, 311–319. Lee, J.H., Lee, D.R., Yoon, S.J. et al. (1998) Expression of DAZ (deleted in azoospermia), DAZL1 (DAZ-like) and protamine-2 in testis and its application for diagnosis of spermatogenesis in non-obstructive azoospermia. Mol. Hum. Reprod., 4, 827–834. Liow, S.L., Ghadessy, F.J., Ng, S.C. et al. (1998) Y chromosome microdeletions in azoospermic or near-azoospermic subjects, are located in the AZFc (DAZ) subregion. Mol. Hum. Reprod., 4, 763–768. Ma, K., Inglis, J.D., Sharkey, A. et al. (1993) A Y chromosome gene family with RNA-binding protein homology: candidates for the azoospermia factor AZF controlling human spermatogenesis. Cell, 75, 1287–1295. Mulhall, J.P., Reijo, R., Alagappan, R. et al. (1997) Azoospermic men with deletions of the DAZ gene cluster are capable of completing spermatogenesis: fertilization, normal embryonic development and
609
K.Stouffs et al. pregnancy occur when retrieved testicular spermatozoa are used for intracytoplasmic sperm injection. Hum. Reprod., 12, 503–508. Nishi, S., Hoshi, N., Kasahara, M. et al. (1999) Existence of human DAZLA protein in the cytoplasm of human oocytes. Mol. Hum. Reprod., 5, 495–497. Reijo, R., Lee, T.-Y., Salo, P. et al. (1995) Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNAbinding protein gene. Nature Genet., 10, 383–393. Seboun, E., Barbaux, S., Bourgeron, T. et al. (1997) Gene sequence, localization, and evolutionary conservation of DAZLA, a candidate male sterility gene. Genomics, 41, 227–235. Silber, S.J., Alagappan, R., Brown, L.G. et al. (1998) Y chromosome deletions in azoospermic and severely oligozoospermic men undergoing intracytoplasmic sperm injection after testicular sperm extraction. Hum. Reprod., 13, 3332–3337. Sun, C., Skaletsky, B., Birren, B. et al. (1999) An azoospermic man with a de novo point mutation in the Y-chromosomal gene USP9Y. Nature Genet., 23, 429–432. Tsai, M.Y., Chang, S.Y., Lo, H.Y. et al. (2000) The expression of DAZL1 in the ovary of the human female fetus. Fertil. Steril., 73, 627–630.
610
Van Landuyt, L., Lissens, W., Stouffs, K. et al. (2000) Validation of a simple Yq deletion screening programme in an ICSI candidate population. Mol. Hum. Reprod., 6, 291–297. Vereb, M., Agulnik, A.I., Houston, J.T. et al. (1997) Absence of DAZ gene mutations in cases of non-obstructive azoospermia. Mol. Hum. Reprod., 3, 55–59. Vogt, P.H., Edelmann, A., Kirsch, S. et al. (1996) Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum. Mol. Genet., 5, 933–943. Vollrath, D., Foote, S., Hilton, A. et al. (1992) The human Y chromosome: a 43-interval map based on naturally occurring deletions. Science, 258, 52–59. Warren, E.H., Gavin, M.A., Chandler, P. et al. (2000) The human UTY gene encodes a novel HLA-B8-restricted H-Y antigen. J. Immunol., 165, 2807–2814. Wong, J., Blanco P. and Affara, N.A. (1999) An exon map of the AZFc male infertility region of the human Y chromosome. Mamm. Genome, 10, 57–61. Received on February 20, 2001; accepted on May 16, 2001
