Chemokine receptor expression and in vivo ... - Wiley Online Library

ARTHRITIS & RHEUMATISM Vol. 48, No. 12, December 2003, pp 3568–3583 DOI 10.1002/art.11344 © 2003, American College of Rheumatology

Chemokine Receptor Expression and In Vivo Signaling Pathways in the Joints of Rats With Adjuvant-Induced Arthritis Shiva Shahrara,1 Mohammad A. Amin,1 James M. Woods,1 G. Kenneth Haines,1 and Alisa E. Koch2 Objective. This study was undertaken to characterize the role of CC chemokines and their receptors in rat adjuvant-induced arthritis (AIA), a model for rheumatoid arthritis (RA). Furthermore, we investigated the signaling pathways associated with CC receptors as well as the cell type distribution of the receptors. Methods. Using TaqMan real-time reverse transcription–polymerase chain reaction, Western blot analysis, and immunohistochemistry, we defined chemokine and chemokine receptor messenger RNA (mRNA) expression, CC chemokine receptor (CCR) protein activation during the disease course, CCRassociated signaling pathways, and immunopositive CCR5, phosphorylated signal transducer and activator of transcription 1 (p-STAT-1), and p-STAT-3 cells in rat AIA versus control joints. Results. We showed significant up-regulation of CCR1, CCR2, CCR5, and macrophage inflammatory protein 1␤/CCL4 mRNA in AIA on post–adjuvant injection day 18, coincident with peak inflammation. Additionally, increases in tyrosine phosphorylation of CCR1 (days 14, 18, 21, and 24), CCR2 (days 14 and 18), and CCR5 (days 14, 18, and 21) were detected in AIA rats compared with control (nonarthritic) rats. JAK-1,

STAT-1, and STAT-3 were associated with CCR1 and were highly tyrosine phosphorylated on days 14 and 18. Moreover, CCR2 was associated with JAK-2, STAT-1, and STAT-3 on day 18. The association of STAT-1 and STAT-3 with CCR5 on days 18 and 21 correlated with JAK-1 phosphorylation and binding on day 18. However, the activation of JNK was not associated with CCR5 activation in rat AIA. Immunohistochemical analysis demonstrated that the expression of CCR5, p-STAT-1, and p-STAT-3 was detected on synovial lining cells, macrophages, and endothelial cells in arthritic rat ankles on post–adjuvant injection day 18. While the majority of the CCR5 and p-STAT-1 immunostaining was on synovial lining cells and macrophages, p-STAT-3 was predominantly expressed on endothelial cells. Conclusion. CCR1, CCR2, and CCR5 mRNA expression and tyrosine phosphorylation increased with peak inflammation in the AIA model. CCR1, CCR2, and CCR5 tyrosine phosphorylation are associated with the JAK/STAT-1/STAT-3 pathway at different stages of rat AIA, as well as with macrophage and endothelial cell infiltration. However, their signaling activation overlaps with peak inflammation. Up-regulation and activation of CCRs may play a role in macrophage and endothelial cell infiltration in rat AIA joints in addition to activating the associated signaling pathways. The downstream intermediate signaling proteins associated with CC receptors may be used as potential tools to control inflammation in RA.

Supported by a postdoctoral fellowship from the Arthritis Foundation, by grants AR-49353, HL-58695, and AI-40987 from the NIH, by The Gallagher Professorship for Arthritis Research, and by funds from the Veterans Administration Research Service. 1 Shiva Shahrara, PhD, Mohammad A. Amin, MD, James M. Woods, PhD, G. Kenneth Haines, MD: Feinberg School of Medicine, Northwestern University, Chicago, Illinois; 2Alisa E. Koch, MD: Feinberg School of Medicine, Northwestern University, Chicago, Illinois, and Veterans Administration, Chicago Health Care System, Lakeside Division, Chicago, Illinois (current address: University of Michigan Medical Center, and Veterans Administration, Ann Arbor). Address correspondence and reprint requests to Alisa E. Koch, MD, University of Michigan, Division of Rheumatology, 5520 MSRB I Box 0680, 1150 West Medical Center Drive, Ann Arbor, MI 48109-0680. E-mail: [email protected]. Submitted for publication January 31, 2003; accepted in revised form August 8, 2003.

Rheumatoid arthritis (RA) is an inflammatory disorder characterized by infiltration of monocytes, T cells, and polymorphonuclear cells into the synovial joints. The CC chemokines monocyte chemoattractant protein 1 (MCP-1)/CCL2, macrophage inflammatory protein 1 ␣ (MIP-1 ␣ )/CCL3, MIP-1 ␤ /CCL4, and 3568

CCR EXPRESSION AND SIGNALING PATHWAYS IN RAT AIA

RANTES/CCL5 in part account for the presence of monocytes and T cells in RA synovial fluid (SF) and synovial tissue (ST) (1–3). RANTES, MIP-1␣, MCP-1, and MIP-1␤ are chemotactic for monocytes and T cells. RA synovial fibroblasts produce RANTES, MIP-1␣, MCP-1, and MIP-1␤ upon stimulation by tumor necrosis factor ␣ (TNF␣), interleukin-1␣ (IL-1␣), or IL-1␤ (4). Chemokines are chemotactic cytokines that induce their effects by binding to an array of G protein–coupled receptors (GPCRs) (5,6). It is known that CC chemokine receptors (CCRs) differ mainly in their NH2terminal portions, which might explain the different specificity of the CC chemokines for particular receptor interactions. An additional factor which may enhance the specificity of CC chemokines for target cells is the cellular distribution of the receptors. Moreover, most CCRs bind to multiple CC chemokines with different affinities (3,7–9). Findings from our laboratory indicate that CCR1, the receptor for RANTES/MIP-1␣, is expressed on monocytes in normal and RA peripheral blood (PB) and on a minority of SF monocytes. This may imply that CCR1 is important in the initial recruitment of monocytes from the circulation to sites of inflammation (10). CCR2, the receptor for MCP-1, is mainly expressed on monocytes in normal and RA PB. Moreover, the percentage of T cells expressing CCR2 is elevated in RA PB compared with normal PB. Memory T cells have higher CCR2 expression than naive T cells in RA PB. Investigators in our group and others have reported that CCR5, the receptor for RANTES, MIP-1␣, and MIP-1␤, is expressed on a greater percentage of monocytes and memory T cells in RA SF compared with RA or normal PB (3,8,10). Researchers in our laboratory have also demonstrated CCR5 immunostaining on a majority of RA ST macrophages, fibroblasts, vascular smooth muscle cells, and perivascular lymphocytes. Results of studies using RA synovial fluid, peripheral blood, and synovial tissues, as well as the results of the present study, strongly suggest that specific CCRs play a critical role in RA and its animal models. Rat adjuvant-induced arthritis (AIA) is a commonly used model of RA, autoimmune disease, and inflammation. An advantage of using this model is the ability to assess the role of several pathogenic factors, including chemokines and their receptors, at various phases of the disease, which is generally not feasible in humans. In this study, we have quantified the ␤-chemokines and CCRs in rat AIA. Since CCR1, CCR2, and CCR5 messenger RNA (mRNA) expression levels were up-regulated with peak inflammation in the AIA model, we examined whether these CCRs were

3569

activated by phosphorylation on tyrosine residues. Identifying the key intermediate proteins in the signal transduction cascade associated with inflammatory cytokines (IL-1, TNF, and IL-6) or CCRs is important and may have therapeutic potential in inflammatory diseases such as RA. It is known that IL-6 signals through the JAK/ signal transducer and activator of transcription (STAT) pathway (11). CCRs dimerize upon chemokine binding and associate with the downstream pathways. In this report, we present evidence for the association of CCRs with JAK/STAT-1/STAT-3 pathways in AIA rat joints; furthermore, we demonstrate cell type expression of these proteins. MATERIALS AND METHODS Induction of rat AIA. Female Lewis rats weighing 100 gm were injected subcutaneously with 300 ␮l (5 mg/ml) lyophilized Mycobacterium butyricum (Difco, Detroit, MI) in sterile mineral oil at the base of the tail. Control rats were injected with an equivalent volume of sterile mineral oil. The day of adjuvant injection is considered day 0. Clinical measurements. Clinical parameters measured included body weight, articular index (AI) score, ankle circumference, and paw volume. AI scores were recorded for each hind joint by the same observer, who was blinded to the treatment received by the animal. Scoring was performed using a 0–4 scale, where 0 ⫽ no swelling or erythema; 1 ⫽ slight swelling and/or erythema; 2 ⫽ low-to-moderate edema; 3 ⫽ pronounced edema with limited joint usage; and 4 ⫽ excess edema with joint rigidity. Ankle circumferences were determined by measurement of two perpendicular diameters, including the laterolateral diameter and the anteroposterior diameter, with a caliper (Lange Caliper; Cambridge Scientific, Cambridge, MA). Circumference was determined using the following formula: circumference ⫽ 2␲ ⫻ 冑a2 ⫹ b2/2, where a and b represent the diameters. Body weight was recorded and AI scoring and ankle circumference evaluations were performed on days 0, 7, 14, 16, 18, 21, 24, and 29. Hind ankle volume was determined using a paw volume plethysmometer (Kent Scientific, Litchfield, CT) on days 0, 9, 16, and 22. Rats were killed on days 0, 7, 14, 18, 21, 24, and 29, and their blood was retained for laboratory tests. RNA purification. Total RNA was prepared from rat ankles by an acid–phenol method according to the procedure described by Chomczynski and Sacchi (12). The final RNA pellet was dissolved in 100 ␮l of water and the concentration was measured spectrophotometrically. Twenty micrograms of RNA was digested with 5 units of DNase in 1⫻ reverse transcription (RT) buffer (Gibco Life Technologies, Grand Island, NY) containing 8 units of RNase inhibitor (Gibco Life Technologies) for 30 minutes at 37°C. Ten percent 2M sodium acetate (pH 4.0) was added, and the solution was extracted with 1 volume each of water-saturated phenol and chloroform (Fisher Scientific, Fair Lawn, NJ). The RNA was precipitated with ethanol, washed with 75% ethanol, and air-dried. The pellet was dissolved to the concentration of 1 ␮g/␮l. RT of RNA. RT of RNA was performed from 5 ␮g of RNA in a total volume of 20 ␮l. The RNA was reverse

3570

SHAHRARA ET AL

Table 1. Chemokine and chemokine receptor (CCR) primer and probe sequences*

CCR1 CCR2 CCR4 CCR5 MIP-1␣ MIP-1␤

Forward primer

TaqMan probe

Reverse primer

AAGTACCTTCGGCAGCTGTTTC AACTGTGTGGTTGACATGCACTT GAACCCAATCATCTGGCTGTCT GGCAATGCAGGTGACAGAGA TACCTTCGGCAGCTGTTTCA TGCTTGTGGCCGCCTT

AGGCATGTGGCTATACCGCTGGCAA CCAGGCCATGCAGGTGACAGAGACTC CGGGATTTTTTTCGAGAGAGGGTCTTGA CTTGGGATGACACACTGCTGCCTCAA AGGCATGTGGCTATACCGCTGGCAA TGCGATTCAGTGCTGTCAGCACCA

ACAGAGAAGAAGGGCAGCCAT ACGCAGCAGTGTGTCATTCC TGTCTTGGAGGCCAGCTTG CCCAACAAAGGCATAGATGACA ACAGAGAAGAAGGGCAGCCA AAGTGGGAGGGTCAGAGCCT

* MIP-1␣ ⫽ macrophage inflammatory protein 1␣.

transcribed by Superscript II (Gibco Life Technologies) RT according to the manufacturer’s specifications. After 10 minutes at 25°C, the enzyme was incubated at 42°C for 50 minutes and thereafter inactivated at 70°C for 15 minutes. The solution was diluted to 40 ␮l. All samples were reverse transcribed simultaneously. Standard dilution preparation for real-time RT– polymerase chain reaction (PCR). All PCR was performed using an ABI Prism 7700 Sequence Detection System (PE Applied Biosystems, Foster City, CA). For each PCR run, a master mixture was prepared on ice with 1⫻ Platinum PCR buffer (Gibco Life Technologies), 1.5 mM MgCl2, 0.2 mM of each dNTP, 0.2 ␮M each primer, and 2.5 units Platinum Taq DNA polymerase (Gibco Life Technologies). Three microliters of the diluted complementary DNA (cDNA) was added to 22 ␮l of the PCR mixture. The thermal cycling conditions comprised 40 cycles of a denaturation step at 95°C for 30 seconds, annealing at 60°C for 1 minute, and an extension step at 72°C for 1 minute. PCR products were extracted from agarose gels and purified. The concentrations of the purified fragments were measured spectrophotometrically. Serial dilutions (typically ranging from 101 to 1010 molecules) were then prepared (13). TaqMan real-time PCR. The PCR primer and the TaqMan fluorogenic probe were designed using the Primer Express program, version 1.01 (PE Applied Biosystems). The primer and probe sequences were chosen from the GenBank database according to their European Molecular Biology Laboratory (EMBL) accession numbers (CCR1, EMBL AF119381; CCR2, EMBL U77349; CCR4, EMBL 4232781; CCR5, EMBL Y12009; MIP-1␣, EMBL NM013025; MIP-1␤, EMBL U06434). The TaqMan probe carries a 5⬘ FAM reporter dye and a 3⬘ TAMRA quencher dye (Mega Bases, Chicago, IL). The quantity of cDNA of the gene of interest was directly related to the fluorescence detection of FAM after 40 cycles. The amount of cDNA was calculated using a comparative threshold method and the standard curve method according to Perkin Elmer ABI Prism 7700 User Bulletin no. 2, 1997, and Favy et al (14). The calibration curves showed a strong linear correlation (R2 ⫽ 0.96–0.99). In both methods, the estimated amount of the gene of interest was normalized to the amount of GAPDH to compensate for variations in quantity as well as for differences in RT efficiency. Briefly, 3 ␮l of the cDNA was in a reaction of 22 ␮l that contained final concentrations of 1⫻ Platinum PCR buffer (Gibco Life Technologies), 3.5 mM MgCl2, 200 ␮M dNTP, 500 nM of each primer (Mega Bases), 200 nM FAM–TAMRA probe (Mega Bases), 100 nM Blue 636 (BD 636), and 0.05 units Platinum Taq DNA polymerase (Gibco Life Technologies). The thermal cycling conditions included 94°C for 5 minutes, followed by 40 cycles of amplification at 94°C for 30 seconds

and at 60°C for 1 minute for denaturing and annealing– extension, respectively. All samples were amplified in triplicate. The sequences for the designed chemokine and chemokine receptor primers and probes are shown in Table 1. Protein extraction. Ankles were homogenized in a 50-ml conical centrifuge tube containing 3 ml of Complete Mini-protease inhibitor cocktail (Roche Molecular Biochemicals, Indianapolis, IN) homogenization buffer. Ankle homogenization was completed on ice using a motorized homogenizer, followed by 30 seconds of sonication. Homogenates were centrifuged at 2,000g for 10 minutes, filtered through a 0.45-␮m pore–size Millipore filter (Millipore, Bedford, MA), and stored at ⫺80°C until use. The concentration of protein in each tissue lysate was determined by using a bicinchoninic acid assay (Pierce, Rockford, IL) and bovine serum albumin as the standard. Immunoprecipitation. Immunoprecipitation was performed according to the instructions provided by Roche Molecular Biochemicals. Briefly, protein G–agarose (Roche Molecular Biochemicals) was washed twice with 1 ml of lysis buffer. The cell lysates were added to the washed protein G–agarose or protein A–agarose for 1 hour at 4°C. After centrifugation, the supernatant was incubated with the recommended concentration (5 ␮l) of the specific antibody and 50 ␮l of protein G–agarose overnight at 4°C. The specific antibodies were antiphosphotyrosine (Cell Signaling Technology, Beverly, MA), anti-CCR1 (SC-7934; Santa Cruz Biotechnology, Santa Cruz, CA), anti-CCR2 (SC-7935; Santa Cruz Biotechnology), and anti-CCR5 (BD PharMingen, San Diego, CA). The antiCCR5 was obtained through the National Institutes of Health (NIH) acquired immunodeficiency syndrome (AIDS) Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases (NIAID), NIH, Bethesda, MD. The suspension was washed twice with lysis buffer. Thereafter, the pellet was resuspended in 2⫻ Laemmli sample buffer and boiled for 3 minutes. The supernatant was used in Western blot analysis. Western blot analysis. Equal amounts of each sample were subjected to 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes using a semidry transblotting apparatus (Bio-Rad, Hercules, CA). Nitrocellulose membranes were blocked with 5% nonfat milk in Tris buffered saline–Tween 20 (TBST) buffer (20 mM Tris, 137 mM NaCl, pH 7.6, with 0.1% Tween 20) for 60 minutes at room temperature. Blots were incubated for 60 minutes with antiactin (Sigma, St. Louis, MO) at 1:2,000 or with anti-CCR1, anti-CCR2, and anti-CCR5 antibodies (Santa Cruz Biotechnology), anti–p-JAK-1 antibody (BioSource International, Camarillo, CA), and anti–p-JAK-2, anti– p-STAT-1, anti–p-STAT-3, and anti–p-JNK antibodies (Cell


3571

Figure 1. CCR1, CCR2, and CCR4 mRNA expression in rat adjuvant-induced arthritis (AIA). All mRNA expression levels were quantified by real-time reverse transcription–polymerase chain reaction and normalized to the levels of GAPDH. Up-regulation of A, CCR1 mRNA expression and B, CCR2 mRNA expression coincides with peak inflammation, assessed as joint circumference. C, Regulation of CCR4 mRNA expression. Clinical assessment was based on measurement of body weight. Values are the mean and SEM (n ⫽ number of ankles).

Signaling Technology) at 1:1,000 in TBST containing 5% nonfat milk. Blots were washed 3 times and then incubated in horseradish peroxidase–conjugated antibody (1:5,000 dilution in TBST containing 5% nonfat milk) for 1 hour at room temperature. All blots were developed using enhanced chemiluminescence reagents (Amersham, Arlington Heights, IL) according to the manufacturer’s instructions. Blots were scanned and analyzed for the measurement of the band intensities with UN-SCAN-IT version 5.1 software (Silk Scientific, Orem, UT). Band intensity corresponded to the sum of all pixel values in the segment selected minus the background pixel value in that segment. Antibodies and immunohistochemistry. STs were cut into 4-␮m sections and fixed in cold acetone for 20 minutes. Endogenous peroxidase was quenched by treatment with 3% H2O2 for 5 minutes. STs were next pretreated with either 3% horse serum or 3% goat serum for 1 hour at 37oC before application of primary antibody. Indirect immunoperoxidase

staining was performed at 37oC for 1 hour. The polyclonal antibodies goat anti-rat CCR5 (1:50 dilution; Santa Cruz Biotechnology), rabbit anti-rat p-STAT-1 (1:100 dilution; Cell Signaling Technology), and rabbit anti-rat p-STAT-3 (1:100 dilution; Cell Signaling Technology) were incubated overnight at 4°C. Macrophage identity was confirmed by reactivity of cells with the monoclonal antibody mouse anti-rat CD11b/c (BD PharMingen). Isotype-specific IgG (goat or rabbit) was used as negative control. Staining was performed using Vector Elite ABC Kits (Vector, Burlingame, CA) and diaminobenzidine (Kirkegaard & Perry, Gaithersburg, MD) as a chromogen (15,16). Microscopic analysis. Various types of cells in the ST, including lining cells and endothelial cells, were identified by immunohistochemical staining reaction and/or morphologic features. Macrophages were distinguished based on morphology and CD11b/c immunoreactivity. Score data were pooled, and the mean ⫾ SEM was calculated in each data group.

3572

SHAHRARA ET AL

Figure 2. CCR5, macrophage inflammatory protein 1␤ (MIP-1␤), and MIP-1␣ mRNA expression in rat adjuvant-induced arthritis (AIA). All mRNA expression levels were quantified by real-time reverse transcription–polymerase chain reaction and normalized to the levels of GAPDH. A, Up-regulation of CCR5 mRNA expression. CCR5 mRNA expression follows the same bell-shaped curve as expression of CCR1 and CCR2 (see Figures 1A and B), reaching its highest level on day 18. Clinical assessment was based on measurement of joint circumference. B, MIP-1␤ mRNA up-regulation coincides with peak inflammation, measured as the articular index score. C, MIP-1␣ mRNA regulation. Clinical assessment was based on measurement of paw volume. Values are the mean and SEM (n ⫽ number of ankles).

Vascularity (1 ⫽ marked decrease in vessels; 2 ⫽ normal density of vessels; 3 ⫽ increased density of vessels; 4 ⫽ marked increase in vessel density, resembling granulation tissue) and inflammation (1 ⫽ normal; 2 ⫽ increased number of inflammatory cells, arrayed as individual cells; 3 ⫽ increased number of inflammatory cells including distinct clusters [aggregates]; 4 ⫽ marked diffuse infiltrate of inflammatory cells) were scored on a 1–4 scale. Statistical analysis. Data were analyzed using Student’s t-test. P values less than 0.05 were considered significant.

RESULTS The expression of chemokines and chemokine receptors was determined during the progression of

inflammation in rat AIA. Among the more important receptors and chemokines in rat AIA are CCR1, CCR2, CCR4, CCR5, MIP-1␣, and MIP-1␤. For this purpose, chemokine and chemokine receptor mRNA in rat joints were quantified using TaqMan real-time RT-PCR with GAPDH as a housekeeping control. Quantification of CC chemokine and chemokine receptor mRNA in the time course of AIA using TaqMan real-time RT-PCR. Clinical assessment, based on joint circumference, AI score, paw volume, and body weight, demonstrated peak inflammation between day 18 and day 21. The CCR1 mRNA concentration in rat AIA increased progressively from day 14 (9-fold increase


3573

Figure 3. Tyrosine phosphorylation of CCR1 and CCR2 in rat adjuvant-induced arthritis (AIA). A, Tyrosine phosphorylation of CCR1. Protein extracted from rat AIA joints was immunoprecipitated with antiphosphotyrosine antibody (IP: *p-tyrosine) followed by Western blot analysis with anti-CCR1 antibody (WB: CCR1). B, Quantification of the phosphorylated CCR1 (*pCCR1)/actin shown in the Western blot in A. C, Tyrosine phosphorylation of CCR2. Protein extracts from rat joints were immunoprecipitated with antiphosphotyrosine antibody followed by Western blot analysis with anti-CCR2 antibody (WB: CCR2). D, Quantification of the p-CCR2/actin shown in the Western blot in C. The p-CCR1/actin and p-CCR2/actin band intensities in A and C, respectively, were quantified using UN-SCAN-IT version 5.1 software (see Materials and Methods). Values in B and D are the mean and SEM (n ⫽ number of ankles). C ⫽ control.

compared with controls), peaked on day 18 (37-fold increase compared with controls), and decreased thereafter (Figure 1A). CCR2 showed a similar pattern of mRNA upregulation starting on day 14 (51-fold higher compared with normal rats), with the highest level of expression on day 18 (500-fold increase compared with controls) and a stepwise decrease of mRNA levels from day 21 to day 29 (Figure 1B). The mean ankle circumference, an accurate way to monitor rat ankle inflammation, was significantly higher from day 14 to day 29 compared with controls. As shown in Figure 1C, the mean body weight of AIA rats

increased on the days prior to inflammation (days 0–14) and after peak inflammation (days 18–29). However, the body weight of AIA rats was down-regulated starting with the initial phases of inflammation (on day 14) until peak inflammation (on day 18). In contrast, CCR4 mRNA expression differed from that of CCR1 and CCR2 in that it peaked after maximal arthritis. CCR4 expression increased successively until day 18 (a 40-fold increase compared with controls), and it was rapidly up-regulated thereafter until day 24 (a 300-fold increase compared with controls), dropping significantly on day 29 (Figure 1C).

3574

SHAHRARA ET AL

Figure 4. A, CCR5 tyrosine phosphorylation coincident with peak inflammation in rat AIA. Protein extracted from AIA joints was immunoprecipitated with antiphosphotyrosine antibody followed by Western blot analysis with anti-CCR5 antibody. B, Quantification of the p-CCR5/actin shown in the Western blot in A. C, Activated JAK-1 associates with CCR1 in rat AIA. The joint protein extracted at different time points in the course of rat AIA was immunoprecipitated with anti-CCR1 antibody and Western blotted with anti–p-JAK-1 antibody. D, Quantification of the p-JAK-1/actin shown in the Western blot in C. The p-CCR5/actin and p-JAK-1/actin band intensities in A and C, respectively, were quantified using UN-SCAN-IT version 5.1 software (see Materials and Methods). Values in B and D are the mean and SEM (n ⫽ number of ankles). See Figure 3 for definitions.

CCR5 (Figure 2A) and MIP-1␤ (Figure 2B) mRNA expression followed the same bell-shaped curves as those of CCR1 and CCR2. The highest levels of expression were observed on day 18, coinciding with peak inflammation in rat AIA as measured by clinical assessment. The down-regulation of CCR1, CCR2, CCR5, and MIP-1␤ mRNA expression coincided with the upregulation of CCR4 mRNA expression on day 24. The greatest MIP-1␣ mRNA expression was detected on days 7 and 18, and lower mRNA concentrations were found on days 14, 21, 24, and 29 (Figure 2C).

Interestingly, the overproduction of MIP-1␣ mRNA levels on day 7 preceded clinical symptoms in rat AIA. The ingress of macrophages and lymphocytes into the joints reported in AIA (16) follows the same bellshaped curve as those of CCR1, CCR2, CCR5, and MIP-1␤ mRNA expression. Our results indicate that CCR1, CCR2, and CCR5 mRNA expression correlated with peak inflammation as measured by ankle circumference, AI score, and paw volume. In contrast, CCR4 mRNA expression peaked after maximal inflammation. Other investigators have found that CCR1, CCR2, and CCR5 are associated with a Th1 phenotype, whereas


3575

Figure 5. Association of activated signal transducer and activator of transcription 1 (STAT-1) and activated STAT-3 with CCR1 in rat AIA. A, Activated STAT-1 is associated with CCR1. The joint protein extracted at different time points in the course of rat AIA was immunoprecipitated with anti-CCR1 antibody and Western blotted with anti–p-STAT-1 antibody. B, Quantification of the p-STAT-1/actin shown in the Western blot in A. C, Activated STAT-3 is associated with CCR1. Joint protein extracted at different time points in the course of rat AIA was immunoprecipitated with anti-CCR1 antibody followed by Western blot analysis with anti-STAT-3 antibody. D, Quantification of the p-STAT-3/actin shown in the Western blot in C. The p-STAT-1/actin and p-STAT-3/actin band intensities in A and C, respectively, were quantified using UN-SCAN-IT version 5.1 software (see Materials and Methods). Values in B and D are the mean and SEM (n ⫽ number of ankles). See Figure 3 for other definitions.

CCR4 is predominantly expressed on the Th2 subset (17,18). Administration of neutralizing antibodies against the CC chemokines MCP-1, MIP-1␣, and RANTES delayed the onset of arthritis and reduced the severity of the disease in rodents (9,19–21). Leukocytes are believed to be recruited from the circulation to the synovial tissue and to migrate into the joint space (22). After encountering ligands and entering the inflamed joint, these receptors are down-regulated, possibly by ligand binding or cytokine modulation. The presence of MIP-1␣ and MIP-1␤ in the rat AIA joint suggests that

they exist as functional ligands for the described receptors within the joint. Phosphorylation of CCRs and the associated signaling pathways. In order to determine the activation of CCR1, CCR2, and CCR5, we quantified the tyrosine phosphorylation of these receptors during the time course of AIA. For this purpose, rat ankle homogenates were immunoprecipitated with antiphosphotyrosine and probed with anti–chemokine receptor antibodies. The intensity of each band was normalized by its actin value. The data demonstrate that CCR1 tyrosine phosphoryla-

3576

SHAHRARA ET AL

Figure 6. Association of activated JAK-2 and activated STAT-1 with CCR2 in rat AIA. A, Activated JAK-2 associates with CCR2. The joint protein extracted at different time points in the course of rat AIA was immunoprecipitated with anti-CCR2 antibody and Western blotted with anti–p-JAK-2 antibody. B, Quantification of the p-JAK-2/actin shown in the Western blot in A. C, Activated STAT-1 associates with CCR2. The joint protein extracted at different time points in the course of rat AIA was immunoprecipitated with anti-CCR2 antibody and Western blotted with anti–p-STAT-1 antibody. D, Quantification of the p-STAT-1/actin shown in the Western blot in C. The p-JAK-2/actin and p-STAT-1/actin band intensities in A and C, respectively, were quantified using UN-SCAN-IT version 5.1 software (see Materials and Methods). Values in B and D are the mean and SEM (n ⫽ number of ankles). See Figures 3 and 5 for definitions.

tion was up-regulated significantly on days 14, 18, 21, and 24 (30–50% increase) compared with controls (nonarthritic rats) (Figures 3A and B). Significant differences were observed in tyrosine phosphorylation levels of CCR2 on days 14 and 18 (40–50% increase) compared with controls (Figures 3C and D). Additionally, an increase in CCR5 tyrosine phosphorylation was detected on days 14, 18, and 21 (20–30% increase) (Figures 4A and B). Interestingly, tyrosine phosphorylation and upregulation of levels of CCR1, CCR2, and CCR5 mRNA followed the same pattern during the time course of rat

AIA. CCR expression and phosphorylation increased with peak inflammation in the AIA model. To ascertain which kinases were responsible for the CC receptor phosphorylation, rat joint tissue lysates were immunoprecipitated with anti-CCR1, anti-CCR2, and anti-CCR5 antibodies and were then probed with anti–p-JAK-1, anti–p-JAK-2, anti–p-STAT-1, and anti– p-STAT-3 antibodies by Western blot analysis. On days 14 and 18, CCR1 was associated with tyrosine phosphorylation of JAK-1 (1.7-fold and 2.9-fold increases, respectively, compared with controls) (Figures 4C and D),


3577

Figure 7. A, Association of p-STAT-3 with CCR2 in rat AIA. The joint protein extracted at different time points in the course of rat AIA was immunoprecipitated with anti-CCR2 antibody and Western blotted with anti–p-STAT-3 antibody. B, Quantification of the p-STAT-3/actin shown in the Western blot in A. C, Association of activated JAK-1 with CCR5 in rat AIA. The joint protein extracted at different time points in the course of rat AIA was immunoprecipitated with anti-CCR5 antibody and Western blotted with anti–p-JAK-1 antibody. D, Quantification of the p-JAK-1/actin shown in the Western blot in C. The p-STAT-3/actin and p-JAK-1/actin band intensities in A and C, respectively, were quantified using UN-SCAN-IT version 5.1 software (see Materials and Methods). Values in B and D are the mean and SEM (n ⫽ number of ankles). See Figures 3 and 5 for definitions.

STAT-1 (1.6-fold and 2.2-fold increases, respectively, compared with controls) (Figures 5A and B), and STAT-3 (2.5-fold and 2.7-fold increases, respectively, compared with controls) (Figures 5C and D). On day 18, CCR2 was associated with phosphorylation of JAK-2 (2.7-fold increase compared with controls) (Figures 6A and B), STAT-1 (3.4-fold increase compared with controls) (Figures 6C and D), and STAT-3 (5.4-fold increase compared with controls) (Figures 7A and B). JAK-1 phosphorylation was associated with CCR5 on day 18 (2-fold increase compared with controls) (Figures 7C and D). Both STAT-1 and STAT-3 were

associated with CCR5 and were highly tyrosine phosphorylated on days 18 and 21 (Figure 8), during active arthritis. The results suggest that CCR5 expression is up-regulated starting on day 14, and that CCR5 is simultaneously tyrosine phosphorylated. The association of STAT-1 and STAT-3 with CCR5 on days 18 (5-fold phosphotyrosine up-regulation) and 21 (2-fold phosphotyrosine up-regulation) correlated with JAK-1 phosphorylation and binding on day 18. Taken together, these results show that CCR1, CCR2, and CCR5 are phosphorylated during active arthritis and are associated

3578

SHAHRARA ET AL

Figure 8. Association of activated STAT-1 and activated STAT-3 with CCR5 in rat AIA. A, Activated STAT-1 associates with CCR5. The joint protein extracted at different time points in the course of rat AIA was immunoprecipitated with anti-CCR5 antibody and Western blotted with anti–p-STAT-1 antibody. B, Quantification of the p-STAT-1/actin shown in the Western blot in A. C, Activated STAT-3 associates with CCR5. The joint protein extracted at different time points in the course of rat AIA was immunoprecipitated with anti-CCR5 antibody and Western blotted with anti–p-STAT-3 antibody. D, Quantification of the p-STAT-3/actin shown in the Western blot in C. The p-STAT-1/actin and p-STAT-3/actin band intensities in A and C, respectively, were quantified using UN-SCAN-IT version 5.1 software (see Materials and Methods). Values in B and D are the mean and SEM (n ⫽ number of ankles). See Figures 3 and 5 for definitions.

with the JAK/STAT pathway during different stages (time points) of the disease; however, their signaling activation overlaps with peak inflammation in AIA. Finally, we examined whether activated JNK associates with CCR5. The evidence from rat joint CCR5 immunoprecipitation and Western blots probed with anti–p-JNK showed that activated JNK did not associate with CCR5 (results not shown). Cell type distribution of CCR5, p-STAT-1, and p-STAT-3 in rat AIA versus nonarthritic joints. CCR5 was expressed on synovial lining cells, macrophages, and

endothelial cells. Compared with day 0, on day 18, CCR5 expression was significantly elevated on synovial lining cells (9-fold increase), macrophages (7-fold increase), and endothelial cells (4-fold increase) (Figure 9). (Colocalization of macrophages and CCR5⫹ cells was confirmed by immunostaining of day-18 rat AIA serial tissue sections with anti-CD11b/c and anti-CCR5 antibodies.) Compared with day 0 (control), the degree of inflammation and vascularity was generally higher on day-18 immunostaining for CCR5, p-STAT-1, and p-STAT-3. Similar to CCR5, p-STAT-1 was predomi-


3579

Figure 9. Expression pattern of CCR5 in synovial tissue (ST) from rats with adjuvant-induced arthritis (AIA). Arrowheads in A–C indicate subsynovial macrophages. A, CCR5 immunostaining in AIA rat ST on post–adjuvant injection day 18. B, CD11b/c-positive staining in serial sections from arthritic rats on day 18. C, CCR5 immunostaining in AIA rat ST on day 18. Arrow indicates lining cell layer. Inset, Double arrowhead indicates vascular endothelial staining. D, Negative control for C. Inset, Absence of vascular endothelial staining. E, Lack of CCR5 immunostaining in AIA rat ST on day 0 (control). F, Negative control for E. (Original magnification ⫻200 in C and E; ⫻400 in A, B, D, F, and insets in C, and D.) G, Quantification of CCR5 immunoreactivity in AIA rat ST on day 18 compared with day 0. Values are the mean and SEM (n ⫽ number of ankles). Inflam ⫽ inflammation score (1–4); Vasc ⫽ vascularity score (1–4); Lining ⫽ synovial lining; Mac ⫽ macrophages; Endo ⫽ endothelial cells. Color figure can be viewed in the online issue, which is available at http://www.arthritisrheum.org.

nantly found in the synovial lining layer and on macrophages, but was also detected on endothelial cells. Immunostaining for p-STAT-1 on synovial lining cells and macrophages was 4–5-fold higher during active AIA (on day 18) than on day 0 (Figure 10). There was no difference in p-STAT-1 staining on endothelial cells between arthritic and nonarthritic tissues. The highest expression of p-STAT-3 was detected on endothelial cells in rat AIA on day 18 and, to a lesser extent, on synovial lining cells and macrophages (Figure 11). Compared with day 0, however, on day 18 the expression of p-STAT-3 was significantly increased on synovial lining cells (3-fold), macrophages (2-fold), and endothelial cells (3-fold).

DISCUSSION In this study, we induced AIA and harvested rat joints at different time points after injection of adjuvant. Joint mRNA was analyzed by TaqMan real-time PCR. The data presented in Figure 1A demonstrate that the CCR1 mRNA concentration in rat AIA increases progressively from day 14, peaks on day 18, and decreases thereafter. Interestingly, the ingress of macrophages and lymphocytes into the joints reported in AIA (16) follows the same pattern of expression. CCR1- and CCR2immunoreactive cells were found in RA ST and colocalized with CD68⫹ macrophages (10). In the present study, CCR1 mRNA levels increased with peak inflam-

3580

SHAHRARA ET AL

Figure 10. Cell type expression of phosphorylated signal transducer and activator of transcription 1 (p-STAT-1) in AIA rat ST. A, Phosphorylated STAT-1 immunostaining in AIA rat ST on post–adjuvant injection day 18. Arrow indicates lining cell layer. Arrowheads indicate subsynovial macrophages. Inset, Double arrowhead indicates vascular endothelial staining. B, Negative control for A. Phosphorylated STAT-1 immunostaining in AIA rat ST on day 0 (control). D, Negative control for C. (Original magnification ⫻200 in A; ⫻400 in B–D and inset in A.) E, Quantification of p-STAT-1 immunoreactivity in AIA rat ST on day 18 compared with day 0. Values are the mean and SEM (n ⫽ number of ankles). See Figure 9 for other definitions. Color figure can be viewed in the online issue, which is available at http://www.arthritisrheum.org.

mation in the rat AIA joint. This contrasts with the surface expression of CCR1, which was found to be decreased in human RA SF and PB compared with human normal SF and PB (10). CCR1⫹ monocytes may be depleted from the PB as they are recruited into the joint. As shown in Figure 1B, CCR2 showed the same pattern of mRNA expression as CCR1 in AIA. CCR2 and CCR1 have also been shown to have the same pattern of protein expression in human RA PB and SF (10). Results from our laboratory also indicate that CD3⫹ lymphocytes expressing CCR2 are significantly elevated in RA PB compared with normal PB (23). Since CCR1 expression and CCR2 expression increase with peak inflammation in the AIA model, they may be important for initial recruitment of monocytes and T cells from the circulation to the site of inflammation. Additional evidence supporting the importance of CCR2 in the initial phases of inflammation is that MCP-1 (one of the ligands for CCR2) has 3 times more immunoreactivity on day 18 than on day 25 in rat AIA (following the same pattern of expression as that of CCR2 in rat AIA) (24). CCR4 mRNA expression differs from that of

CCR1 and CCR2 (Figure 1C). CCR4 expression increases successively until day 18 and then is rapidly up-regulated until day 24, dropping significantly on day 29. Investigators in our group also showed that CCR4 was expressed on significantly more monocytes in RA PB than in RA SF or normal PB (10). CCR4 has been associated with Th2 cells, which produce cytokines that may attenuate RA inflammation. The CCR5 mRNA expression detected in rat AIA correlates with peak inflammation on day 18 (Figure 2A). Additional data from our laboratory indicate that RA SF monocytes exhibit the highest CCR5 expression compared with RA and normal PB monocytes. Interestingly, joint patterns of TNF␣ protein expression in rat AIA correlate well with CCR5 mRNA expression in the same model (25). Theoretically, CCR5 may be down-regulated after encountering the ligands in the inflamed joint, possibly by ligand binding or cytokine modulation. The mRNA expression of MIP-1␤ (the ligand for CCR1 and CCR5) in AIA joints follows the same bell-shaped curve as those of the expression of CCR1 and CCR5, with maximum expression on day 18 (Figure 2B). Previously, investigators in our group also showed that immunostaining for MIP-1␤ in RA ST was


3581

Figure 11. Cell type distribution of p-STAT-3 in AIA rat ST. A, Phosphorylated STAT-3 immunostaining in AIA rat ST on post–adjuvant injection day 18. Arrow indicates lining cell layer. Arrowheads indicate subsynovial macrophages. Inset, Double arrowhead indicates vascular endothelial staining. B, Negative control for A. Inset, Absence of vascular endothelial staining. C, Lack of p-STAT-3 immunostaining in AIA rat ST on day 0 (control). D, Negative control for C. (Original magnification ⫻400.) E, Quantification of p-STAT-3 immunoreactivity in AIA rat ST on day 18 compared with day 0. Values are the mean and SEM (n ⫽ number of ankles). See Figures 9 and 10 for definitions. Color figure can be viewed in the online issue, which is available at http://www.arthritisrheum.org.

predominantly on macrophages (colocalizing with CCR1 and CCR5) (10). The greatest MIP-1␣ mRNA expression was detected on days 7 and 18, and lower mRNA concentrations were found on days 14, 21, 24, and 29 (Figure 2C). The overproduction of synovial MIP-1␣ mRNA levels on day 7 precedes clinical symptoms and thus may contribute to recruiting monocytes prior to day 18. Furthermore, MIP-1␣ mRNA levels follow the same pattern as that of total leukocyte counts in AIA. In fact, the pattern of expression of MIP-1␣ mRNA is similar to that of MIP-1␣ protein in rat AIA reported by us previously (25). The binding of CC chemokines to GPCRs follows a series of events including dimerization, phosphorylation, and association with downstream signaling pathways (26). In this study, we observed phosphotyrosine activation of CCR1 (Figures 3A and B), CCR2 (Figures 3C and D), and CCR5 (Figures 4A and B). Interestingly, the duration of CCR1 tyrosine phosphorylation (days 14, 18, 21, and 24) is longer than that of CCR2 (days 14 and 18) or CCR5 (days 14, 18, and 21). Nevertheless, the baseline CCR1 mRNA levels are lower than those of the other two receptors. Furthermore, our data demonstrate higher mRNA levels and shorter tyrosine phosphorylation duration for CCR2 compared with CCR5. All 3

CCRs are tyrosine phosphorylated on days 14 and 18, which is the period between initial and peak inflammation. The data suggest that tyrosine phosphorylation is triggered in the early phases of inflammation and that it coincides with up-regulation of CCR mRNA (11). Recently, it has been reported that CCRs, including CCR2 and CCR5, signal through the JAK/STAT pathway. In the CCR5-transfected HEK 293 cell response to RANTES, CCR5 is rapidly tyrosine phosphorylated, and JAK-1 associates with CCR5. JAK-1 association in response to RANTES promotes STAT-5b transcription factor association to the receptor, as well as its activation (11,27). A CCR2 dominant-negative mutant that retains its capacity to form homodimers in response to MCP-1 but that cannot be tyrosine phosphorylated is unable to recruit and trigger JAK-2 phosphorylation (28). In this study, we investigated the JAK/STAT signaling pathway associated with CCR1, CCR2, and CCR5. CCR1 is associated with JAK-1/STAT-1/STAT-3 phosphorylation on days 14 and 18 (Figures 4C, 4D, and 5), which coincides with its initial mRNA and phosphotyrosine up-regulation. CCR2 signals through the JAK2/STAT-1/STAT-3 pathway at peak inflammation (Figures 6, 7A, and 7B). JAK-1 association with CCR5 on

3582

day 18 (Figures 7C and D) is subsequent to the initial CCR5 phosphorylation on day 14 (Figures 4A and B). Moreover, both STAT-1 and STAT-3 (Figure 8) demonstrate an increase in tyrosine phosphorylation associated with CCR5 activation on days 18 and 21. These results suggest that CCR5 expression is up-regulated starting on day 14, and that CCR5 is simultaneously tyrosine phosphorylated. The association of STAT-1 and STAT-3 with CCR5 on days 18 and 21 correlates with JAK-1 phosphorylation and binding on day 18. It is noteworthy that CCR1 is associated with activation of the JAK/STAT-1/STAT-3 pathway during early to peak inflammation. While CCR2 signals through the same pathway only during peak inflammation, CCR5 activation is associated with the JAK/STAT pathway during peak to later stages of inflammation. Nevertheless, all 3 receptors are associated with the JAK/STAT family on day 18. This implies that membrane-localized protein tyrosine kinases are recruited to CC ligand–stimulated receptors (phosphorylated receptors), where they are activated and act in concert to initiate intracellular signaling cascades during maximal inflammation. Shouda et al demonstrated increased STAT-3 phosphorylation in mouse collagen-induced arthritis at peak inflammation and a significant down-regulation within 10 days (29). Furthermore, the simultaneous tyrosine phosphorylation of STAT-1 and STAT-3 may be important for STAT-1/STAT-3 dimerization. In accordance with findings of these studies, we and others have shown that the phosphorylation of STAT-1 and STAT-3 is significantly higher in RA ST than in normal ST (29,30). Consistent with our findings, it has been shown that STAT-1 decoy oligodeoxynucleotide and adenovirally delivered dominant-negative STAT-3 gene administered intraarticularly in animals with arthritis significantly suppressed the arthritis score and paw volume and clinical arthritis parameters (29,31). TNF␣ induces suppressor of cytokine signaling 3 (SOCS-3), which is an endogenous JAK kinase inhibitor. It appears that SOCS-3 functions as a component of a negative feedback loop to dynamically terminate cytokinemediated signals. It is noteworthy that the proinflammatory cytokines, such as TNF␣ and IL-6, signal through the same pathway as CCRs. Immunohistochemical analysis demonstrated that CCR5, p-STAT-1, and p-STAT-3 were expressed on synovial lining cells, macrophages, and endothelial cells in arthritic rat ankles on post–adjuvant injection day 18. While the majority of the CCR5 and p-STAT-1 immunostaining was on synovial lining cells and macrophages, p-STAT-3 was predominantly expressed on endothelial

SHAHRARA ET AL

cells. The expression of CCR5 and p-STAT-1 on synovial lining cells and macrophages might indicate that this pathway is involved in proinflammatory cytokine production by synovial macrophages. CCR5-deficient mice show reduced cytokine production by peritoneal macrophages following stimulation with lipopolysaccharide plus interferon-␥. Consistent with findings of the present study, investigators in our group previously showed that the CCR5-immunoreactive cells in RA ST were predominantly macrophages (10), indicating that CCR5 might have a role in monocyte migration into the ST. STAT-3 phosphoactivation on endothelial cells might be important for proliferation and chemoattraction of inflammation mediators. Tyrosine phosphorylation of STAT-1 and STAT-3 at peak inflammation in rat AIA coincides with activation in the synovial lining layer, considered an area most actively involved in chronic synovitis, and may reflect the in situ production of TNF␣ and IL-1. In conclusion, CCR1, CCR2, and CCR5 mRNA levels are up-regulated and activated with peak inflammation. We demonstrate that CCR1, CCR2, and CCR5 tyrosine phosphorylation are associated with the JAK/ STAT pathway and with macrophage and endothelial cell infiltration in rat AIA. Targeting this signaling pathway may provide a novel therapeutic avenue in RA. ACKNOWLEDGMENTS Anti-CCR5 was obtained from BD PharMingen (San Diego, CA) through the NIH AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH, Bethesda, MD. We thank the staff of Dr. Wolinsky’s laboratory (Northwestern University) for allowing us to use the TaqMan apparatus.

REFERENCES 1. Koch AE, Kunkel SL, Harlow LA, Mazarakis DD, Haines GK, Burdick MD, et al. Macrophage inflammatory protein-1 alpha: a novel chemotactic cytokine for macrophages in rheumatoid arthritis. J Clin Invest 1994;93:921–8. 2. Sallusto F, Lanzavecchia A, Mackay CR. Chemokines and chemokine receptors in T-cell priming and Th1/Th2-mediated responses. Immunol Today 1998;19:568–74. 3. Patel DD, Zachariah JP, Whichard LP. CXCR3 and CCR5 ligands in rheumatoid arthritis synovium. Clin Immunol 2001;98:39–45. 4. Hosaka S, Akahoshi T, Wada C, Kondo H. Expression of the chemokine superfamily in rheumatoid arthritis. Clin Exp Immunol 1994;97:451–7. 5. Luster AD. Chemokines—chemotactic cytokines that mediate inflammation. N Engl J Med 1998;338:436–45. 6. Mantovani A. Chemokines: introduction and overview. Chem Immunol 1999;72:1–6. 7. Suzuki N, Nakajima A, Yoshino S, Matsushima K, Yagita H, Okumura K. Selective accumulation of CCR5⫹ T lymphocytes into inflamed joints of rheumatoid arthritis. Int Immunol 1999;11: 553–9. 8. Mack M, Bru ¨hl H, Gruber R, Jaeger C, Cihak J, Eiter V, et al.


9.

10.

11. 12. 13.

14.

15.

16. 17.

18. 19.

Predominance of mononuclear cells expressing the chemokine receptor CCR5 in synovial effusions of patients with different forms of arthritis. Arthritis Rheum 1999;42:981–8. Barnes DA, Tse J, Kaufhold M, Owen M, Hesselgesser J, Strieter R, et al. Polyclonal antibody directed against human RANTES ameliorates disease in the Lewis rat adjuvant-induced arthritis model. J Clin Invest 1998;101:2910–9. Katschke KJ Jr, Rottman JB, Ruth JH, Qin S, Wu L, LaRosa G, et al. Differential expression of chemokine receptors on peripheral blood, synovial fluid, and synovial tissue monocytes/macrophages in rheumatoid arthritis. Arthritis Rheum 2001;44:1022–32. Heinrich PC, Behrmann I, Muller-Newen G, Schaper F, Graeve L. Interleukin-6-type cytokine signalling through the gp130/Jak/ STAT pathway. Biochem J 1998;334:297–314. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156–9. Endesfelder S, Krahn A, Kreuzer KA, Lass U, Schmidt CA, Jahrmarkt C, et al. Elevated p21 mRNA level in skeletal muscle of DMD patients and mdx mice indicates either an exhausted satellite cell pool or a higher p21 expression in dystrophin-deficient cells per se. J Mol Med 2000;78:569–74. Favy DA, Lafarge S, Rio P, Vissac C, Bignon YJ, Bernard-Gallon D. Real-time PCR quantification of full-length and exon 11 spliced BRCA1 transcripts in human breast cancer cell lines. Biochem Biophys Res Commun 2000;274:73–8. Szekanecz Z, Haines GK, Harlow LA, Shah MR, Fong TW, Fu R, et al. Increased synovial expression of transforming growth factor (TGF)-beta receptor endoglin and TGF-beta 1 in rheumatoid arthritis: possible interactions in the pathogenesis of the disease. Clin Immunol Immunopathol 1995;76:187–94. Halloran MM, Szekanecz Z, Barquin N, Haines GK, Koch AE. Cellular adhesion molecules in rat adjuvant arthritis. Arthritis Rheum 1996;39:810–9. Bonecchi R, Bianchi G, Bordignon PP, D’Ambrosio D, Lang R, Borsatti A, et al. Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J Exp Med 1998;187:129–34. Sallusto F, Mackay CR, Lanzavecchia A. Selective expression of the eotaxin receptor CCR3 by human T helper 2 cells. Science 1997;277:2005–7. Ogata H, Takeya M, Yoshimura T, Takagi K, Takahashi K. The role of monocyte chemoattractant protein-1 (MCP-1) in the pathogenesis of collagen-induced arthritis in rats. J Pathol 1997; 182:106–14.

3583

20. Schrier DJ, Schimmer RC, Flory CM, Tung DK, Ward PA. Role of chemokines and cytokines in a reactivation model of arthritis in rats induced by injection with streptococcal cell walls. J Leukoc Biol 1998;63:359–63. 21. Kasama T, Strieter RM, Lukacs NW, Lincoln PM, Burdick MD, Kunkel SL. Interleukin-10 expression and chemokine regulation during the evolution of murine type II collagen-induced arthritis. J Clin Invest 1995;95:2868–76. 22. Harris ED Jr. Rheumatoid arthritis: pathophysiology and implications for therapy. N Engl J Med 1990;332:1277–87. 23. Ruth JH, Rottman JB, Katschke KJ Jr, Qin S, Wu L, LaRosa G, et al. Selective lymphocyte chemokine receptor expression in the rheumatoid joint. Arthritis Rheum 2001;44:2750–60. 24. Woods JM, Katschke KJ Jr, Volin MV, Ruth JH, Woodruff DC, Amin MA, et al. IL-4 adenoviral gene therapy reduces inflammation, proinflammatory cytokines, vascularization, and bony destruction in rat adjuvant-induced arthritis. J Immunol 2001;166: 1214–22. 25. Szekanecz Z, Halloran MM, Volin MV, Woods JM, Strieter RM, Haines GK III, et al. Temporal expression of inflammatory cytokines and chemokines in rat adjuvant-induced arthritis. Arthritis Rheum 2000;43:1266–77. 26. Mellado M, Rodriguez-Frade JM, Manes S, Martinez-AC. Chemokine signaling and functional responses: the role of receptor dimerization and TK pathway activation. Annu Rev Immunol 2001;19:397–421. 27. Rodriguez-Frade JM, Vila-Coro AJ, Martin A, Nieto M, SanchezMadrid F, Proudfoot AE, et al. Similarities and differences in RANTES- and (AOP)-RANTES-triggered signals: implications for chemotaxis. J Cell Biol 1999;144:755–65. 28. Mellado M, Rodriguez-Frade JM, Aragay A, del Real G, Martin AM, Vila-Coro AJ, et al. The chemokine monocyte chemotactic protein 1 triggers janus kinase 2 activation and tyrosine phosphorylation of the CCR2B receptor. J Immunol 1998;161:805–13. 29. Shouda T, Yoshida T, Hanada T, Wakioka T, Oishi M, Miyoshi K, et al. Induction of the cytokine signal regulator SOCS3/CIS3 as a therapeutic strategy for treating inflammatory arthritis. J Clin Invest 2001;108:1781–8. 30. Hu X, Herrero C, Li WP, Antoniv TT, Falck-Pedersen E, Koch AE, et al. Sensitization of IFN-gamma Jak-STAT signaling during macrophage activation. Nat Immunol 2002;3:1–8. 31. Brauer R, Stoeckigt R, Hueckel M, Petrow PK, Wagner AH, Hecker M. Amelioration of murine antigen-induced arthritis by treatment with STAT-1 decoy oligodeoxynucleotide [abstract]. Arthritis Rheum 2002;46 Suppl 9:S304.