J Mol Neurosci (2010) 40:267 DOI 10.1007/s12031-009-9303-7
ERRATUM
Erratum to: Differential Regulation of α7 Nicotinic Receptor Gene (CHRNA7) Expression in Schizophrenic Smokers Sharon Mexal & Ralph Berger & Judy Logel & Randal G. Ross & Robert Freedman & Sherry Leonard
Published online: 10 November 2009 # Humana Press 2009
Erratum to: J Mol Neurosci DOI 10.1007/s12031-009-9233-4 The original version of this article unfortunately contained a mistake. In Table 2, Reverse primer for CHRNA7 should read: TGTGGAATGTGGCGTCAAAG
Proceedings of the XIII International Symposium on Cholinergic Mechanisms The online version of the original article can be found at http://dx.doi. org/10.1007/s12031-009-9233-4. R. Berger : J. Logel : R. G. Ross : R. Freedman : S. Leonard (*) Department of Psychiatry, University of Colorado Denver, Mail Stop 8344, P.O. Box 6511, Aurora, CO 80045, USA e-mail:
[email protected] R. Freedman : S. Leonard The Veterans Affairs Medical Research Service, Denver, CO, USA S. Mexal Cenomed BioSciences, Irvine, CA, USA