Circular and Linear Plasmids of Lyme Disease ... - Europe PMC

JOURNAL OF BACTERIOLOGY, Apr. 1996, p. 2287–2298 0021-9193/96/$04.0010 Copyright q 1996, American Society for Microbiology

Vol. 178, No. 8

Circular and Linear Plasmids of Lyme Disease Spirochetes Have Extensive Homology: Characterization of a Repeated DNA Element ¨ CKERT* WOLFRAM R. ZU

AND

¨ RG MEYER JU

Department of Preventive Dentistry and Oral Microbiology, University of Basel Dental Institute, CH-4051 Basel, Switzerland Received 10 November 1995/Accepted 2 February 1996

We have cloned three copies of a repeated DNA segment from Borrelia burgdorferi sensu stricto strain B31, present on both circular and linear plasmids of this and other B. burgdorferi sensu lato strains. The DNA sequences are characterized by a highly homologous segment containing two open reading frames (ORFs), ORFA and ORF-B. Five additional ORFs can be found on the slightly less homologous flanking sequences: ORF-G on the opposite strand upstream of ORF-A, and ORF-C, ORF-D, ORF-E, and ORF-F downstream of ORF-B. The 4.6-kb-long element containing ORF-A through ORF-E is flanked by approximately 180-bp-long imperfect inverted repeats (IRs). The putative gene product of ORF-C displays homology to proteins involved in plasmid maintenance in a number of gram-positive and gram-negative bacteria. ORF-E features several short, highly homologous direct repeats. ORF-A, ORF-B, and ORF-D are homologous to three ORFs on a recently described 8.3-kb circular plasmid of Borrelia afzelii Ip21 that are flanked by similar IRs (J. J. Dunn, S. R. Buchstein, L.-L. Butler, S. Fisenne, D. S. Polin, B. N. Lade, and B. J. Luft, J. Bacteriol. 176:2706–2717, 1994). ORF-C and ORFE, however, are missing from this region on the Ip21 plasmid. Furthermore, the repeated DNA element as defined by the IRs is present in opposite orientations relative to the flanking sequences on the B31 and Ip21 plasmids.

established (11, 15). The analysis of two chromosomal genes led to the conclusion that B. burgdorferi sensu lato is clonal (19). Plasmids, however, seem to contribute to the plasticity of the spirochete’s genome by participating in lateral gene transfer: the linear-plasmid-encoded outer surface protein D (OspD) gene is thought to have been recently acquired by several strains through this mechanism (34). Moreover, the circularplasmid-encoded OspC genes of several strains seem to have evolved through recent intragenic recombination (27). Besides ospD (39) and ospC (47), genes for several other Osps of B. burgdorferi sensu lato have been mapped to extrachromosomal elements as well: ospA, ospB (5), ospE, and ospF (30) were found on linear plasmids. Other genes mapped to circular plasmids include two purine biosynthesis genes, guaA and guaB (35), as well as a gene for an exported protein, eppA (12). Recently, two additional genes carried by linear plasmids, pG (57) and s1 (55), have been described. In an earlier study, we cloned and characterized several copies of a repetitive DNA segment of B. burgdorferi B31 harbored on both circular (pOMB10, pOMB25, and pOMB65) and linear (pOMB14) plasmids but absent from the chromosome (60). These sequences constitute a common feature of B. burgdorferi, B. garinii, and B. afzelii, as homologies to circular as well as linear plasmids of strains belonging to each of the three species were detected. Yet the sequences are species specific for B. burgdorferi sensu lato, as they failed to hybridize to total DNA of several relapsing fever borreliae (60). This study was undertaken (i) to explore the structure and putative function of these multicopy DNA sequences, as they might represent insertion elements, transposons (22), virulence determinants (37), or even a combination of the latter two (59) and (ii) to assess their potential use in nucleic acidbased diagnostics. Repetitive DNA sequences have been used successfully as targets for either PCR primers or probes in

Borrelia burgdorferi is the causative agent of Lyme disease, a multisystemic infectious syndrome with dermatologic, musculoskeletal, and neurologic manifestations (18). Since the spirochete was first described in 1982 (9), a large number of B. burgdorferi strains have been isolated from various tick vectors as well as from the skin, joints, and cerebrospinal fluid of patients. Phenotypic and genotypic analyses of isolates, including serotyping (58), plasmid profiles together with restriction fragment length polymorphisms (4, 36, 54), multilocus enzyme electrophoresis (8), and ribotyping (1, 31, 33), have revealed a distinctive heterogeneity among strains. This led to the delineation of B. burgdorferi sensu lato into three species: B. burgdorferi sensu stricto, Borrelia garinii, and Borrelia afzelii (3, 10). The species assignment of the causative borreliae seems to correlate with the prevalence of different late-stage symptoms of the disease (56). The species of some strains could not be designated, and some B. afzelii isolates showed considerable genetic variation. Therefore, the occurrence of additional genospecies has been discussed (13, 21, 44). Recently, a further phylogenetic delineation has been proposed, introducing Borrelia japonica (28) and Borrelia andersonii (32). To date, however, no clinical isolates belonging to these two species have been recovered. Therefore, their possible association with Lyme disease remains to be established. A striking peculiarity of borreliae is their genome structure, consisting of an approximately 950 kb linear chromosome complemented by a series of circular and linear plasmids, ranging in size from 2 to 30 kb and 5 to 60 kb, respectively (7, 48). Physical as well as genetic maps of the chromosome have been

* Corresponding author. Present address: Department of Microbiology, University of Pennsylvania School of Medicine, 1033 Blockley Hall, Philadelphia, PA 19104-6021. Phone: (215) 898-7096. Fax: (215) 573-9068. Electronic mail address: [email protected]. 2287

2288

¨ CKERT AND MEYER ZU

J. BACTERIOL.

TABLE 1. B. burgdorferi sensu lato isolates used in this study Isolate

B. burgdorferi sensu stricto B31 B. garinii NE83 B. afzelii VS461 F1 DN127 VS116

Geographic origin

Biological source

Reference

United States

Ixodes scapularis

9

Switzerland

Ixodes ricinus

54

Switzerland Sweden United States Switzerland

Ixodes Ixodes Ixodes Ixodes

3 44 44 42

ricinus ricinus scapularis ricinus

hybridization assays (20, 61). We therefore determined the nucleotide sequence of three copies of the repeated DNA segment cloned from strain B31. We also investigated the distribution and copy number of the sequences on the plasmids of B. burgdorferi B31 and five other B. burgdorferi sensu lato strains. MATERIALS AND METHODS Bacterial strains and plasmids. All B. burgdorferi sensu lato strains (see Table 1) were grown in BSK-H medium (43) (Sigma) at 348C. Recombinant plasmids pOMB25, pOMB65, and pOMB14 were generated as described before (60). The same procedure led to pOMB17, representing a 3.0-kb EcoRI-ClaI fragment from the linear plasmid fraction of strain B31 in pBluescriptIISK2 (Stratagene). Recombinant plasmids were propagated in Escherichia coli XL1-Blue grown at 378C in Luria broth or on Luria agar supplemented with ampicillin (100 mg/ml) (49). DNA preparation and restriction endonuclease digests. Plasmid DNA for nested deletion formation or double-stranded DNA sequencing was isolated with Qiagen-tip 20 gravity flow columns (Qiagen). B. burgdorferi sensu lato DNA fractions enriched for circular or linear plasmid DNA were obtained by cesium chloride-ethidium bromide gradient centrifugation as described previously (54). Restriction endonuclease digests were performed according to the manufacturers’ instructions (Boehringer Mannheim and New England Biolabs). Agarose gel electrophoresis and Southern hybridization. Restriction endonuclease digests of B. burgdorferi sensu lato DNA were separated by standard agarose (SeaKem FMC) gel electrophoresis (49) and transferred to nylon membranes (0.2-mm pore size; Pall Biodyne A) by a modified alkaline downward blotting procedure (14, 45) with 0.4 M NaOH as the transfer buffer. Large DNA fragments were separated by field inversion gel electrophoresis (FIGE; forward voltage, 180 V; reverse voltage, 120 V; run time, 16 h; switch time ramp, 0.1 to 0.4 s, linear shape) in a 1% agarose gel (SeaKem FMC) with the FIGE Mapper electrophoresis system (Bio-Rad). Linear plasmids were separated by clamped homogeneous electric field (CHEF) electrophoresis in a 1% agarose gel (voltage, 200 V; switch time, 0.2 to 5.0 s; run time, 18 h) with the CHEF II electrophoresis system (Bio-Rad). Southern blotting of FIGE and CHEF gels was performed as described above with 0.4 M NaOH–1.5 M NaCl as the transfer buffer. PCR products were separated on a 3% NuSieve (FMC) agarose gel. Nonradioactive Southern blot hybridizations were performed with the ECL direct nucleic acid labeling and detection system (Amersham). The inserts of recombinant plasmids used as probes were purified from low-melting-point agarose (SeaPlaque FMC) gels with the QIAEX binding matrix (Qiagen) according to the manufacturer’s instructions. Large fragments were purified as described earlier (60). Hybridizations were carried out in glass tubes in a Mini hybridization oven (Appligene) under standard or high-stringency conditions (0.53 and 0.33 SSC in primary wash, respectively; 203 SSC is 0.3 M sodium citrate plus 3 M NaCl, pH 7). Nested deletions. Nested deletions were generated by using the Erase-a-Base kit (Promega). Reactions were performed at 378C (corresponding to an exonuclease III [ExoIII] activity rate of approx. 500 bp/min), and samples were taken at 30-s intervals. Ligated deletion products were used for transformation of either electrocompetent or CaCl2-competent E. coli XL-1 Blue (Stratagene). Electroporation was performed with an ECM 600 system (BTX) with 2-mm-gap cuvettes. CaCl2-competent cells were prepared and transformed as described before (49). Several clones were analyzed at each deletion time point by BssHII

endonuclease digestion of miniplasmid DNA preparations (49), allowing fairly exact determination of the deletion sizes. Suitable clones were used for production of double-stranded sequencing templates. PCR. In vitro amplification of DNA was performed with the GeneAmp 2400 System (Perkin Elmer), using the PCR Core Kit (Boehringer Mannheim). Oligonucleotide PCR primers onPCR-L and onPCR-R, designed with the help of the OLIGO version 4.0 program for Macintosh (46) (see Fig. 1), were obtained from MWG Biotech. The PCR program used was as follows: 948C for 5 min; 948C for 45 s, 488C for 45 s, and 728C for 1 min for 40 cycles; and then 728C for 5 min. The final product was purified with the QIAquick PCR purification Kit (Qiagen). DNA sequencing. DNA sequencing was performed on both strands by the dideoxy method with the Sequenase version 2.0 kit (USB-Amersham) and Redivue [a-35S]ATP (Amersham). For PCR product sequencing, 5% Triton X-100 (Sigma) was included in each step of sample preparation. Annealing was performed by denaturation at 1008C followed by snap cooling on dry ice. Oligonucleotide primers (see above) were synthesized for confirmatory sequencing of regions that were refractory to deletion formation on one strand. The sequencing reactions were separated on a glycerol-tolerant TTE (203 TTE is 1.78 M Tris, 0.57 M taurine, plus 0.01 M EDTA) gradient denaturing 6% polyacrylamide gel (49) with a Sequi-Gen II/3000xi electrophoresis system (Bio-Rad). The gel was then transferred to 3MM paper (Whatman), dried on a Gel Slab dryer (BioRad), and exposed overnight to Kodak BioMax MR-1 film. Computer analysis of the DNA sequence. The DNA sequence data were assembled and analyzed with the Genetics Computer Group (GCG) program package version 7.2 for VAX/VMS (16). Database homology searches of nucleotide and amino acid sequences were supplemented by using the BLAST program (2). Nucleotide sequence accession numbers. The nucleotide sequence data reported in this paper will appear in the EMBL, GenBank, and DDBJ nucleotide sequence databases under accession numbers X87202 (pOMB10), X87127 (pOMB25/65), and X87201 (pOMB14/17).

RESULTS Comparison of DNA sequences. The DNA sequences of the entire pOMB10, pOMB25, and pOMB14 inserts as well as of subfragments of the pOMB65 and pOMB17 inserts were determined on both strands (Fig. 1 and 2). Alignment of the DNA sequences suggested that the pOMB25 and pOMB65 inserts are adjacent at a terminal EcoRI site. This hypothesis was confirmed by PCR with pOMB25- and pOMB65-specific oligonucleotides (Fig. 1) as primers on a circular-plasmid DNA template from strain B31. The amplified 355-bp product, bridging the right end of pOMB25 and the left end of pOMB65, was verified by restriction analysis (Fig. 3) as well as direct DNA sequencing. As no alteration from the expected sequences (Fig. 1) was revealed, the inserts of pOMB25 and pOMB65 can indeed be regarded as one contiguous circularplasmid sequence (pOMB25/65). The insert of pOMB10 represents a second, separate circular-plasmid sequence. The pOMB14 and pOMB17 insert sequences overlap by 1,016 bp (EcoRI to HindIII) and together constitute a sequence from the 50-kb linear plasmid (pOMB14/17). The DNA homology among the determined sequences of pOMB10, pOMB25/65, and pOMB14/17 is most pronounced (90 to 98%) in an internal 1.7-kb portion, dropping towards the right (75 to 68%). The left flanking sequences retain a higher degree of homology (approx. 80%). A second region of high homology (approx. 94%) was detected at the far right end of the sequences determined (Fig. 2). The lack of distinct divergence among the sequences indicates a repeated DNA segment longer than 5.2 kb present on both circular and linear plasmids of Lyme disease spirochetes. ORFs. Two open reading frames (ORFs), ORF-A and

FIG. 1. DNA sequence comparison of the pOMB10, pOMB25, pOMB65, pOMB14, and pOMB17 inserts. Uppercase letters indicate identical nucleotides in at least two copies. Dashes denote gaps introduced by the PILEUP algorithm. Restriction sites and other features are marked by solid underlining and as follows: »IR-L to IR-L«, location of the left inverted repeat; »IR-R to IR-R«, location of the right inverted repeat (see also Fig. 2 and 4); »ORF-X, start codon, and ***ORF-X, stop codon of the ORF; onPCR-L and onPCR-R, primers used for amplification of the pOMB25/pOMB65-linking fragment (see Fig. 3); u---u, direct repeats found in the ORF-E region. The 33- and 21-bp direct repeats are numbered I to VII/i to vi for ORF-E(14/17) and I9 to VIII9/i9 to vii9 for ORF-E(25/65).

2289

FIG. 1—Continued.

2290

FIG. 1—Continued.

2291

2292


J. BACTERIOL.

FIG. 2. Putative gene organization and sequence homologies among pOMB inserts. Arrows indicate the location, direction, and size of the ORFs. Open triangles mark the positions of the inverted repeats (IR-L and IR-R). Underlining indicates the sequences shown in Fig. 1 and 4. Shaded boxes indicate the degree of homology between the respective segments, as derived from pairwise comparisons with the COMPARE and BESTFIT algorithms. Restriction sites are indicated as follows: Ac, AccI; Ba, BamHI; Cl, ClaI; E, EcoRI; Hi, HindIII; Xb, XbaI; Xm, XmnI. 14XbCl indicates the probe used in Southern blot hybridizations shown in Fig. 6C to E (see also the text).

ORF-B, were found on all three repeated DNA segment copies in the highly conserved internal portion (Fig. 2). They are arranged in tandem, separated by 12 bp (Fig. 1). While consensus promoter sequences and a ribosome-binding site (RBS) can be identified upstream of ORF-A, ORF-B possesses only the latter. This arrangement matches the genetic organization of the cotranscribed B. burgdorferi outer surface protein genes ospA and ospB (6), suggesting that ORF-A and ORF-B could also be transcribed from a common promoter. Among the copies of ORF-B, nucleotide variations are mainly found in the third position of the codons (81% of all variations). For ORF-A, the overall bias towards third-base differences is less pronounced (47%). The less homologous region downstream of ORF-B carries three additional ORFs on the same strand of both the circular and linear plasmid copies, designated ORF-C through ORF-E. ORF-C overlaps the 39 end of ORF-B by 21 bp in all three copies and features both RBS and putative promoter sequences. Different stop codon positions in each copy cause ORF-C to vary in size by up to 30 bp. ORF-D shows an up-

stream RBS. It starts at identical positions on pOMB65 and pOMB14 but 33 bp further downstream on pOMB10. Additional size variations (21 bp) are caused by different stop codons. ORF-E features identical start and stop codon positions yet differs because of internal sequence variation (see below). Potential promoter and RBS sequences can be identified upstream of the ORF-E start codon. The same is true for ORF-F, which is located in the highly homologous right-end region and shows neither variation in start codon position nor internal divergence. A stop codon was determined only on pOMB65. On the opposite strand upstream of ORF-A of all copies, we detected the 59 end of ORF-G. The characteristics of the ORFs and putative proteins are summarized in Table 2. Comparisons among the putative ORF products of each copy are shown in Table 3. TABLE 2. Characteristics of ORFs and putative proteins found on the pOMB inserts ORFa

FIG. 3. PCR product analysis of the pOMB25/pOMB65-bridging DNA fragment. Numbers on the left indicate fragment sizes (in base pairs). Lane M, size markers (HinfI digest of pBR322 [Gibco BRL]); lane u, undigested PCR product; lane E, cut with EcoRI; lane Ac, cut with AccI. Labeled arrows indicate resulting fragments with the following expected sizes (see Fig. 1): a, 355 bp; b/c, 176 and 179 bp; d, 231 bp; e, 124 bp.

Putative coding region

Putative protein

Length (bp)

% A1T content

Size (kDa)

pI

ORF-A(10) ORF-A(25/65) ORF-A(14/17)

1,086 1,098 1,095

77 76 76

43.7 44.2 43.9

10.50 10.56 10.43

ORF-B(10) ORF-B(25/65) ORF-B(14/17)

564 564 564

72 72 73

22.7 22.6 22.6

10.50 10.53 10.47

ORF-C(10) ORF-C(25/65) ORF-C(14/17)

771 738 753

73 75 75

29.5 28.6 29.2

6.56 9.85 9.75

ORF-D(10) ORF-D(25/65) ORF-D(14/17)

522 555 579

76 77 77

21.0 22.0 23.1

10.25 10.23 10.22

ORF-E(25/65) ORF-E(14/17)

630 534

75 76

24.1 20.6

5.11 6.57

ORF-F(25/65)

681

71

26.0

9.04

a

Numbers in parentheses indicate pOMB copy.

REPEATED DNA ON B. BURGDORFERI PLASMIDS

VOL. 178, 1996 TABLE 3. Comparisons of putative proteins encoded on pOMB inserts and Ip21 cp8.3 ORFsa

ORF-A/ORF-1

ORF-B/ORF-2

ORF-C ORF-D/ORF-3

ORF-E ORF-F/ORF-7/8c

pOMB insert

pOMB10 pOMB25/65 pOMB14/17 pOMB10 pOMB25/65 pOMB14/17 pOMB10 pOMB25/65 pOMB10 pOMB25/65 pOMB14/17 pOMB10b pOMB25/65 pOMB25/65

% similar/identical aa pOMB25/65 pOMB14/17

88.4/84.5

96.7/94.2 87.1/82.2

98.4/97.3

98.9/98.9 98.4/97.3

78.9/58.9

76.5/58.3 78.5/59.8 77.6/55.7 79.2/60.1

83.3/61.5

83.0/74.5

76.6/68.1 86.0/77.5 99.0/97.9

pOMB14/17 ORF-G/ORF-4d

pOMB10 pOMB25/65 pOMB14/17

99.0/98.0

82.5/79.4 80.3/75.8

cp8.3

70.7/59.4 74.0/60.6 70.7/58.6 71.0/50.8 71.6/50.8 71.6/50.8

77.4/56.0 79.1/52.2 75.1/57.8

76.7/65.1; 95.4/91.7 76.7/66.3; 94.4/90.3 80.2/70.3 80.2/70.3 76.6/68.8

a For each pair of ORFs, the pOMB ORF is listed first, followed by the corresponding cp8.3 ORF. b Comparison was made to the corresponding 48 aa of the N terminus of ORF-E(10). c Comparison was made from aa 1 to 93 for ORF-8 (first set of values) and from aa 120 to 227 for ORF-7 (second set of values). d Comparison was made to the corresponding part of the N terminus of ORF-4 [ORF-G(10), 101 aa; ORF-G(25/65), 104 aa; ORF-G(14/17), 68 aa].

Homologies to other B. burgdorferi sensu lato sequences. A search for homologies to the pOMB sequences in the GenEMBL database revealed 70% identity to a 3-kb segment of a recently sequenced 8.3-kb circular plasmid (cp8.3) of B. afzelii Ip21 (17), containing three consecutive ORFs (ORF-1 to ORF-3) flanked by 95% homologous inverted repeats (IRs) of 184 bp (IR-A and IR-B). ORF-1 to ORF-3 showed homologies to ORF-A, ORF-B, and ORF-D, respectively. However, two remarkable differences emerged (Fig. 4). (i) The ORF-G region starting upstream of ORF-A displayed no homology to the sequences upstream of ORF-1 but to ORF-4, which is located downstream of ORF-3 and IR-B. Furthermore, ORF-F displayed homology to ORF-8 and ORF-7, which are located upstream of ORF-1 on the opposite strand. This indicates that at the ORF-A–ORF-E segment of strain B31 and the ORF1ORF3 segment flanked by the IRs on cp8.3 of Ip21 are present in opposite orientations relative to flanking sequences. (ii) The two segments encoding ORF-C and ORF-E are absent from cp8.3 of Ip21. The extents of homologies of the putative proteins ORF-A, ORF-B, and ORF-D to the gene products of ORF-1, ORF-2, and ORF-3 are shown in Table 3. Inverted and direct repeats. We found IRs similar to IR-A and IR-B of Ip21 cp8.3 upstream of ORF-A and downstream of ORF-E on pOMB25/65 and pOMB14/17 (marked IR-L and IR-R, respectively, in Fig. 1, 2, and 4). pOMB10 only carries an IR-L copy. As the 59 end of ORF-E is located at the right terminus of pOMB10, IR-R could be located beyond the EcoRI site on an adjacent restriction fragment. The DNA sequence homologies among the IRs, as determined by the BESTFIT algorithm, ranged from about 65 to 95%. IR-L and IR-R on pOMB25/65 are 90.1% homologous. Interestingly, IR-L(14/17) seems to be more related to IR-L(10) (94%) than to IR-R(14/17) (83.1%). In analogy, IR-R(14/17) displays a

2293

higher degree of homology with IR-R(25/65) (91.5%). A comparison of the IR copies on Ip21 cp8.3 and the pOMB inserts is shown in Fig. 5. A striking pattern of short, direct repeats is seen in ORF-E. Seven (pOMB14/17) or eight (pOMB25/65) copies of a 33-bp repeat, which are 67 to 88% homologous, are separated by three (pOMB14/17) or six (pOMB25/65) copies of a less homologous (41 to 67%) repeat of 21 bp (Fig. 1). The direct repeats are all present in the same frame and therefore could lead to a repeated protein motif. Potential functions of the ORF products. ORF-2 on Ip21 cp8.3 (17) had been postulated to code for a RepC homolog, based on the homology of its gene product to the active site of Rep proteins (KKYSDKGLI). Its strain B31 homolog ORF-B therefore might also be considered a RepC homolog, although the site is partially altered (KKYPEQGPL) in all three copies. When we searched for protein homologies to the putative gene product of ORF-C in various protein databases, we found homologies (FASTA scores of 146 to 265) to a group of proteins involved in chromosome segregation (e.g., Bacillus subtilis Soj, accession number P37522 in SwissProt), plasmid partition (e.g., E. coli ParA, P07620 in SwissProt), or copy number control (e.g., Enterococcus faecalis RepB, B47092 in PIR2). A series of hypothetical proteins were also part of this group, interestingly including one encoded on a Streptomyces clavuligerus linear plasmid (S30400 in PIR3). The homologies among this group of proteins and the putative ORF-C gene product are most pronounced in the N-terminal half, including a putative ATP-binding site. The direct-repeat region of the putative ORF-E product displayed homology (FASTA score of 174) to OmpA of the as yet unclassified prokaryote Thermatoga maritima (Q01969 in SwissProt). The homologous region of OmpA features three 25-amino-acid (aa) approximate direct repeats. OmpA is thought to be involved in linking the organism’s outer and inner membranes. In a BLAST search, the direct repeats of ORF-E also exhibited limited homology (34% identity and 51% similarity over 43 aa) to an internal segment of the B. burgdorferi p100 protein (26). Number of repeated DNA segments in B. burgdorferi B31. As described above, one copy of the repeated DNA segment is carried by lp50, and the other two are carried by circular plasmids. From DNA electron microscopy studies (54) showing only two size groups of B31 circular plasmids, we had previously assumed that the pOMB10, pOMB25, and pOMB65 inserts all originated from cp29, as cp26 of this strain lacked any homology to pOMB10 (60). However, digestion of the circular-plasmid fraction of B31 with BamHI gave rise to four fragments of 29, 26, 21, and 9.5 kb (Fig. 6A). We therefore concluded that this B31 line contained three circular plasmids, cp26 (26-kb BamHI fragment), cp29 (29 kb), and cp30.5 (9.5 and 21 kb). cp29 and cp30.5 seem to have a high degree of sequence homology, as the 9.5-kb fragment cross-hybridized with the 29-kb fragment (results not shown). Furthermore, the EcoRI restriction patterns of the 21- and 29-kb BamHI fragments are similar (Fig. 6B). Southern blot hybridizations of the above digests (Fig. 6A and B) with the inserts of pOMB10, pOMB25, and pOMB65 as probes showed that (i) cp29 and cp30.5 share the 1.45- and 3.8-kb EcoRI fragments cloned in pOMB25 and pOMB10, respectively, and (ii) the insert of pOMB65 originates from cp30.5. An additional homologous 8.5-kb EcoRI fragment is found on cp29 (see also reference 60). In conclusion, cp29 and cp30.5 would each carry at least two homologous, repeated DNA segments: pOMB10 would represent one copy on either cp29 or cp30.5. A second copy on cp30.5 would consist of pOMB25/65, while the uncloned

2294


J. BACTERIOL.

FIG. 4. Comparison of pOMB10, pOMB25/65, and pOMB14/17 sequences in both orientations to the homologous region on Ip21 cp8.3 (17). DOTPLOT graph of pOMB and cp8.3 sequences aligned by the COMPARE algorithm (window, 28 bp; stringency, 21 bp). Solid arrows indicate the location, direction, and size of the ORFs on pOMB (labeled A to G) and cp8.3 (labeled 1 to 9 and X). Solid shaded triangles mark the locations of IR-A and IR-B on cp8.3; open shaded triangles mark the locations IR-L and IR-R on the pOMB10, pOMB25/65, and pOMB14/17 inserts.

1.45-kb and 8.5-kb EcoRI fragments would form a second cp29 copy. Number of repeated DNA elements in other B. burgdorferi sensu lato strains. As shown by chromosomal restriction fragment length polymorphism (RFLP) typing, isolates assigned to B. afzelii are very heterogeneous (13, 21). In this study, we therefore included three B. afzelii strains that are related to different degrees to the species type strain VS461 and might in the future be regarded as members of different genospecies (44) (Table 1). The homologies between the B31 clones and Ip21 cp8.3 were most pronounced in the ORF-A–ORF-B/ ORF-1–ORF-2 region (Fig. 2). In order to estimate the num-

ber of repeated DNA element copies in different B. burgdorferi sensu lato strains, we therefore used the 1.15-kb XbaI-ClaI fragment of pOMB14 as an internal ORF-A–ORF-B probe in Southern blot hybridizations to HindIII digests of DNA fractions enriched for circular or linear plasmids. HindIII was used because it does not cut within the probe target region in either B. burgdorferi strain B31 or Sh-2-82 (52) or in B. afzelii Ip21 (17). The results indicate the presence of ORF-A/ORF-B homologs in multiple copies on circular and linear plasmids of the six representative B. burgdorferi sensu lato strains (Fig. 6E). For strain B31, the indicated approximate sizes of the hybridizing HindIII fragments correlate with pOMB restriction maps

VOL. 178, 1996


(Fig. 2). The copy number relates to the estimation outlined above. As for the other strains, the sizes of the hybridizing fragments range from 1.0 to about 12 kb. Signals observed in both the circular-plasmid and linear-plasmid fractions most likely resulted from contamination of the linear-plasmid fraction with linearized circular plasmids and were counted only once. If every strong signal is considered to represent one copy, the copy numbers for circular/linear plasmids in each strain can be estimated as follows: NE83, 3/1; VS461, 4/1; DN127, 10/1; VS116, 3/1; and F1, 5/1. We also hybridized the probe to undigested circular and linear plasmids of the same strains (Fig. 6C and D). Homologies to ORF-A/ORF-B were detected on differently sized circular and linear plasmids of all six strains. All circular plasmids of 8 to 9 kb in five strains hybridized to the probe.

cp8.3. Compared with the B31 copies, however, the regions spanning ORF-1 to ORF-3 (between IR-A and IR-B) and ORF-A to ORF-E (between IR-L and IR-R) are present in opposite orientations relative to the flanking regions (Fig. 4). A recombinogenic function of the IRs can therefore still be considered. Apparently, there is extensive homology (i) among circular plasmids of different sizes and (ii) between circular and linear plasmids, continuing beyond the IRs flanking the repeated DNA element. Small circular plasmids of about 9 kb (e.g., Ip21 cp8.3) seem to carry one copy of the homologous region, while large circular plasmids (e.g., cp29 and cp30.5 of strain B31) have at least two copies. One possible explanation for this observation is that the large plasmids evolved from concatemerization of the small plasmids. Stable dimerization has been described previously for a small circular 9.2-kb plasmid in B. burgdorferi CT1, consisting of tandem repeats of 4.6 kb (25). The evenly spaced circular plasmid bands hybridizing to the repeated DNA element probe (see Fig. 6C) could represent multimers, supporting this hypothesis. The extensive sequence overlap between circular and linear plasmids is remarkable. Repeated and shared homologous DNA regions, like the ones described in this study, would allow not only intra- but also intermolecular recombinational events, leading to a dynamic flux of extrachromosomal genetic information. As described above, IR-L and IR-R on the 50-kb linear plasmid of B31 are more related to their corresponding circular plasmid IR copies than to each other. This might be a first indication of recombination between circular and linear plasmids. Additional information will be needed to determine whether these differently shaped DNA molecules are even further related. Plasmid-associated repeated DNA sequences were also described earlier by Simpson and coworkers (52). They isolated three EcoRI restriction fragments of B. burgdorferi Sh-2-82 (52). Two of these, pSPR13 and pSPR14, were shown to have homology with pOMB10 (60). In order to determine the extent of relatedness among pSPR13 and pSPR14, they performed heteroduplex mapping, allowing for up to 16% nucleotide mismatch. Under these conditions, they observed a 1.8-kb conserved region flanked by 1.5 kb of higher sequence mismatch. This would be in accordance with our findings: the region spanning ORF-A and ORF-B is 1.7 kb long and more than 90% homologous among the copies of strain B31, the flanking sequences exhibiting about 80% (upstream) and 70% (down-

DISCUSSION We have described a repeated DNA segment present on both circular and linear plasmids of B. burgdorferi B31. This region of homology is at least 5.2 kb long and contains a circa 4.6-kb-long repeated DNA element flanked by IRs about 180 bp in length. Five ORFs were found on the repeated DNA element, while analysis of the flanking sequences indicated the presence of two additional coding sequences. Sequences homologous to the most highly conserved two ORFs within the repeated DNA element were discovered on plasmids of other B. burgdorferi sensu lato strains (60; this study). On the DNA sequence level, the B31 copies show homology to a recently sequenced 8.3-kb circular plasmid of B. afzelii Ip21. On this plasmid, the repeated DNA element as defined above comprises only three of the five ORFs flanked by IRs (17). Dunn and coworkers have examined several B. burgdorferi sensu lato strains, including B31, for homologies to the IRs of Ip21 cp8.3. They used an internal 21-bp oligonucleotide (on2443; see Fig. 5) complementary to both IR-A and IR-B as a probe and did not detect any homologies in other strains. However, two to five terminal and three or five internal nucleotides of on2443 do not match corresponding nucleotides on the targets of B. burgdorferi B31 (Fig. 5). These mismatches destabilize the hybrid significantly and presumably render the oligonucleotide probe specific for the B. afzelii Ip21 cp8.3 IR sequences. Dunn et al. (17) found no evidence for the recombinationbased isomerization of the region between the IRs on Ip21

2295

FIG. 5. Comparison of the inverted repeat sequences IR-A and IR-B of Ip21 cp8.3 with the inverted repeats IR-L and IR-R found on pOMB10, pOMB25/65, and pOMB14/17. Sequences shown correspond to the IR segments indicated in Fig. 1. Lowercase letters indicate nucleotides that do not match in at least four other copies. Dashes denote gaps introduced by the PILEUP algorithm. XmnI sites present on pOMB25 and pOMB65 are underlined. CTATAGGGCTTTACCAAATTC on2443 indicates the oligonucleotide probe used by Dunn et al. (17). Underlined on2443 nucleotides differ from at least one pOMB IR copy (see also the text).

2296


J. BACTERIOL.

FIG. 6. Distribution and copy number of the repeated DNA sequences in several B. burgdorferi sensu lato strains. Numbers to the left of each panel indicate sizes (in kilobases) as deduced from phage lambda DNA restriction digests (A), a 1-kb DNA ladder (Gibco BRL) (B and E), as well as from earlier measurements (54) (C and D). (A) Left, BamHI digest of the circular plasmid (cp) fraction of B. burgdorferi B31 separated by FIGE; right, Southern blot hybridization of the same gel under high-stringency conditions, using the inserts of pOMB10, pOMB25, and pOMB65 as probes. (B) Left, EcoRI digest of purified 21- and 29-kb BamHI fragments separated on a 0.7% agarose gel. An asterisk marks a presumably partially digested fragment. Right, Southern blot hybridizations of the same gel using the insert of pOMB10 and pOMB65 as probes. (C) Left, Circular plasmids separated on a 0.4% agarose gel (0.7 V/cm, 50 h); right, Southern blot of the same gel hybridized with 14XbCl. (D) Left, Linear plasmids separated by CHEF. Two asterisks indicate a band supposedly representing linearized circular plasmids contaminating the linear plasmid fraction. Right, Southern blot of the same gel hybridized with the 1.15-kb XbaI-ClaI fragment of pOMB14 (14XbCl; see Fig. 2). (E) Southern blot of a HindIII digest of circular (cp) and linear (lp) plasmid fractions separated on a 0.7% agarose gel hybridized with 14XbCl. The sizes of strain B31 DNA fragments are marked (see Fig. 2).

stream) homology. Therefore, we assume that pSPR13 and pSPR14 carry the Sh-2-82 homologs of ORF-A and ORF-B as well as the putative genes encoded on the flanking, less homologous segments. The recent development of a genetic system for B. burgdorferi (50) might facilitate the functional study of the ORFs encoded on the repeated DNA segment. Primary targets might be ORF-C and ORF-E, as they are missing from the Ip21 plasmid. The putative product of ORF-C displays homology to several proteins involved in plasmid maintenance and copy number control. It is tempting to speculate that their absence might contribute to the often observed loss of plasmids during cultivation. The correlation of the latter phenomenon to the virulence of Lyme disease spirochetes remains controversial: whereas it rendered B. burgdorferi isolates avirulent in a mouse model (51, 53), recent studies of clonal populations showed no significant differences in plasmid profiles between high- and low-infectivity phenotypes (40). This suggests that the changes leading to decreased infectivity may be more subtle. The function of the short, directly repeated sequences in ORF-E remains unknown. They might represent repeated protein motifs. Alternatively, in analogy to similar direct repeats in the cis-acting partition site of the E. coli F plasmid par region

(38), the repeated sequences might contribute to plasmid stability in B. burgdorferi. Molecular mechanisms ensuring proper segregation would be essential for the maintenance of both circular and linear plasmids, as they are present in low copy number when B. burgdorferi is grown in medium containing serum (24). Interestingly, B. burgdorferi plasmid sequences were amplified readily in diagnostic PCR of synovial fluid, whereas chromosomal target sequences have been ineffective (41). Plasmid DNA-containing membrane vesicles found in clinical specimens as well as in bacterial cultures (23) have been implicated in this phenomenon. An alternative explanation is environment-specific upregulation of plasmid copy numbers, as already described for relapsing fever borreliae (29). A first hint for the presence of the same mechanism in B. burgdorferi could be the circular-plasmid location of two housekeeping genes involved in purine biosynthesis (35). From the difference in purine levels, these genes might be important for survival in mammalian blood but unessential for maintenance in the arthropod host. The possibility of using the repeated sequences for DNA diagnostics of Lyme disease needs to be examined in more detail. The 70% homology of the plasmid-associated repeated DNA sequences of B31 with the homologous segment of Ip21

VOL. 178, 1996


cp8.3 would allow the use of the sequences as hybridization probes. For the design of PCR primers, however, unique stretches of about 20 identical nucleotides are a prerequisite. Only a few such stretches were found in the above comparison. In order to evaluate the repeated sequences for this use, it would be highly beneficial to know the homologous sequences on plasmids of a variety of B. burgdorferi sensu lato strains.

22. Galas, D. J., and M. Chandler. 1989. Bacterial insertion sequences, p. 109– 162. In D. E. Berg and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C. 23. Garon, C. F., D. W. Dorward, and M. D. Corwin. 1989. Structural features of Borrelia burgdorferi—the Lyme disease spirochete: silver staining for nucleic acids. Scanning Microsc. 3:109–115. 24. Hinnebusch, J., and A. G. Barbour. 1992. Linear- and circular-plasmid copy numbers in Borrelia burgdorferi. J. Bacteriol. 174:5251–5257. 25. Hyde, F. W., and R. C. Johnson. 1988. Characterization of a circular plasmid from Borrelia burgdorferi, etiologic agent of Lyme disease. J. Clin. Microbiol. 26:2203–2205. 26. Jauris-Heipke, S., R. Fuchs, A. Hofmann, F. Lottspeich, V. Preac-Mursic, E. Soutschek, G. Will, and B. Wilske. 1993. Molecular characterization of the p100 gene of Borrelia burgdorferi strain PKo. FEMS Microbiol. Lett. 114: 235–242. 27. Jauris-Heipke, S., G. Liegl, V. Preac-Mursic, D. Ro¨ssler, E. Schwab, E. Soutschek, G. Will, and B. Wilske. 1995. Molecular analysis of genes encoding outer surface protein C (OspC) of Borrelia burgdorferi sensu lato: relationship to ospA genotype and evidence of lateral gene exchange of ospC. J. Clin. Microbiol. 33:1860–1866. 28. Kawabata, H., T. Masuzawa, and Y. Yanagihara. 1993. Genomic analysis of Borrelia japonica sp. nov. isolated from Ixodes ovatus in Japan. Microbiol. Immunol. 37:843–848. 29. Kitten, T., and A. G. Barbour. 1992. The relapsing fever agent Borrelia hermsii has multiple copies of its chromosome and linear plasmids. Genetics 132:311–324. 30. Lam, T. T., T.-P. K. Nguyen, R. R. Montgomery, F. S. Kantor, E. Fikrig, and R. A. Flavell. 1994. Outer surface proteins E and F of Borrelia burgdorferi, the agent of Lyme disease. Infect. Immun. 62:290–298. 31. Marconi, R. T., and C. F. Garon. 1992. Identification of a third genomic group of Borrelia burgdorferi through signature nucleotide analysis and 16S rRNA sequence determination. J. Gen. Microbiol. 138:533–536. 32. Marconi, R. T., D. Liveris, and I. Schwartz. 1995. Identification of novel insertion elements, restriction fragment length polymorphism patterns, and discontinuous 23S rRNA in Lyme disease spirochetes: phylogenetic analyses of rRNA genes and their intergenic spacers in Borrelia japonica sp. nov. and genomic group 21038 (Borrelia andersonii sp. nov.) isolates. J. Clin. Microbiol. 33:2427–2434. 33. Marconi, R. T., L. Lubke, W. Hauglum, and C. F. Garon. 1992. Speciesspecific identification of and distinction between Borrelia burgdorferi genomic groups by using 16S rRNA-directed oligonucleotide probes. J. Clin. Microbiol. 30:628–632. 34. Marconi, R. T., D. S. Samuels, R. K. Landry, and C. F. Garon. 1994. Analysis of the distribution and molecular heterogeneity of the ospD gene among the Lyme disease spirochetes: evidence for lateral gene exchange. J. Bacteriol. 176:4572–4582. 35. Margolis, N., D. Hogan, K. Tilly, and P. A. Rosa. 1994. Plasmid location of Borrelia purine biosynthesis gene homologs. J. Bacteriol. 176:6427–6432. 36. Meister-Turner, J., E. Filipuzzi-Jenny, O. Pe´ter, A. G. Bretz, M. Stålhammar-Carlemalm, and J. Meyer. 1993. Genotypic and phenotypic diversity among nine Swiss isolates of Borrelia burgdorferi. Zentralbl. Bakteriol. 276: 173–179. 37. Mekalanos, J. J. 1983. Duplication and amplification of toxin genes in Vibrio cholerae. Cell 35:253–263. 38. Nordstro¨m, K., and S. J. Austin. 1989. Mechanisms that contribute to the stable segregation of plasmids. Annu. Rev. Genet. 23:37–69. 39. Norris, S. J., C. J. Carter, J. K. Howell, and A. G. Barbour. 1992. Lowpassage-associated proteins of Borrelia burgdorferi: characterization and molecular cloning of OspD, a surface-exposed, plasmid-encoded lipoprotein. Infect. Immun. 60:4662–4672. 40. Norris, S. J., J. K. Howell, S. A. Garza, M. S. Ferdows, and A. G. Barbour. 1995. High- and low-infectivity phenotypes of clonal populations of in vitrocultured Borrelia burgdorferi. Infect. Immun. 63:2206–2212. 41. Persing, D. H., B. J. Rutledge, P. N. Rys, D. S. Podzorski, P. D. Mitchell, K. D. Reed, B. Liu, E. Fikrig, and S. E. Malawista. 1994. Target imbalance: disparity of Borrelia burgdorferi genetic material in synovial fluid from Lyme arthritis patients. J. Infect. Dis. 169:668–672. 42. Pe´ter, O., and A. G. Bretz. 1992. Polymorphisms of outer surface proteins of Borrelia burgdorferi as a tool for the classification. Zentralbl. Bakteriol. 277: 28–33. 43. Pollack, R. J., S. R. I. Telford, and A. Spielman. 1993. Standardization of medium for culturing Lyme disease spirochetes. J. Clin. Microbiol. 31:1251– 1255. 44. Postic, D., M. V. Assous, P. A. D. Grimont, and G. Baranton. 1994. Diversity of Borrelia burgdorferi sensu lato evidenced by restriction fragment length polymorphism of rrf (5S)-rrl (23S) intergenic spacer amplicons. Int. J. Syst. Bacteriol. 44:743–752. 45. Reed, K. C., and D. A. Mann. 1985. Rapid transfer of DNA from agarose gels to nylon membranes. Nucleic Acids Res. 13:7207–7221. 46. Rychlik, W., and R. E. Rhoads. 1989. A computer program for choosing optimal oligonucleotides for filter hybridization, sequencing and in vitro amplification of DNA. Nucleic Acids Res. 17:8543–8551.

ACKNOWLEDGMENTS We thank O. Pe´ter (ICHV Sion, Switzerland) for bacterial strains, W. Arber (Basel) and P. Linder (Geneva) for advice, and H. Sandmeier (Basel) for comments on the manuscript. This work was supported by the Swiss National Science Foundation (grant 31-25680.88/2). REFERENCES 1. Adam, T., G. S. Gassmann, C. Rasiah, and U. B. Go ¨bel. 1991. Phenotypic and genotypic analysis of Borrelia burgdorferi isolated from various sources. Infect. Immun. 59:2579–2585. 2. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403–410. 3. Baranton, G., D. Postic, I. Saint Girons, P. Boerlin, J. C. Piffaretti, M. Assous, and P. A. D. Grimont. 1992. Delineation of Borrelia burgdorferi sensu stricto, Borrelia garinii sp. nov., and group VS461 associated with Lyme borreliosis. Int. J. Syst. Bacteriol. 42:378–383. 4. Barbour, A. G. 1988. Plasmid analysis of Borrelia burgdorferi, the Lyme disease agent. J. Clin. Microbiol. 26:475–478. 5. Barbour, A. G., and C. F. Garon. 1988. The genes encoding major surface proteins of Borrelia burgdorferi are located on a plasmid. Ann. N.Y. Acad. Sci. 539:144–153. 6. Bergstro ¨m, S., V. G. Bundoc, and A. G. Barbour. 1989. Molecular analysis of linear plasmid-encoded major surface proteins, OspA and OspB, of the Lyme disease spirochaete Borrelia burgdorferi. Mol. Microbiol. 3:479–486. 7. Bergstro ¨m, S., C. F. Garon, A. G. Barbour, and J. MacDougall. 1992. Extrachromosomal elements of spirochetes. Res. Microbiol. 143:623–628. 8. Boerlin, P., O. Pe´ter, A. G. Bretz, D. Postic, G. Baranton, and J. C. Piffaretti. 1992. Population genetic analysis of Borrelia burgdorferi isolates by multilocus enzyme electrophoresis. Infect. Immun. 60:1677–1683. 9. Burgdorfer, W., A. G. Barbour, S. F. Hayes, J. L. Benach, E. Grunwaldt, and J. P. Davis. 1982. Lyme disease—a tick-borne spirochetosis? Science 216: 1317–1319. 10. Canica, M. M., F. Nato, L. du Merle, J. C. Mazie, G. Baranton, and D. Postic. 1993. Monoclonal antibodies for identification of Borrelia afzelii sp. nov. associated with late cutaneous manifestations of Lyme borreliosis. Scand. J. Infect. Dis. 25:441–448. 11. Casjens, S., and W. M. Huang. 1993. Linear chromosomal physical and genetic map of Borrelia burgdorferi, the Lyme disease agent. Mol. Microbiol. 8:967–980. 12. Champion, C. I., D. R. Blanco, J. T. Skare, D. A. Haake, M. Giladi, D. Foley, J. N. Miller, and M. A. Lovett. 1994. A 9.0-kilobase-pair circular plasmid of Borrelia burgdorferi encodes an exported protein: evidence for expression only during infection. Infect. Immun. 62:2653–2661. 13. Chetcuti, M., M. Blot, and J. Meyer. 1994. Genomic variations among Borrelia afzelii strains. Med. Microbiol. Lett. 3:423–430. 14. Chomczynski, P. 1992. One-hour downward alkaline capillary transfer for blotting of DNA and RNA. Anal. Biochem. 201:134–139. 15. Davidson, B. E., J. MacDougall, and I. Saint Girons. 1992. Physical map of the linear chromosome of the bacterium Borrelia burgdorferi 212, a causative agent of Lyme disease, and localization of rRNA genes. J. Bacteriol. 174: 3766–3774. 16. Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387–395. 17. Dunn, J. J., S. R. Buchstein, L.-L. Butler, S. Fisenne, D. S. Polin, B. N. Lade, and B. J. Luft. 1994. Complete nucleotide sequence of a circular plasmid from the Lyme disease spirochete, Borrelia burgdorferi. J. Bacteriol. 176: 2706–2717. 18. Duray, P. H., and A. C. Steere. 1988. Clinical pathologic correlations of Lyme disease by stage. Ann. N.Y. Acad. Sci. 539:65–79. 19. Dykhuizen, D. E., D. S. Polin, J. J. Dunn, B. Wilske, V. Preac-Mursic, R. J. Dattwyler, and B. J. Luft. 1993. Borrelia burgdorferi is clonal: implications for taxonomy and vaccine development. Proc. Natl. Acad. Sci. USA 90:10163– 10167. 20. Eisenach, K. D., M. D. Cave, J. H. Bates, and J. T. Crawford. 1990. Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis. J. Infect. Dis. 161:977–981. 21. Filipuzzi-Jenny, E., M. Blot, N. Schmid-Berger, J. Meister-Turner, and J. Meyer. 1993. Genetic diversity among Borrelia burgdorferi isolates: more than three genospecies? Res. Microbiol. 144:295–304.

2297

2298


47. Sadziene, A., B. Wilske, M. S. Ferdows, and A. G. Barbour. 1993. The cryptic ospC gene of Borrelia burgdorferi B31 is located on a circular plasmid. Infect. Immun. 61:2192–2195. 48. Saint Girons, I., S. J. Norris, U. B. Go¨bel, J. Meyer, E. M. Walker, and R. Zuerner. 1992. Genome structure of spirochetes. Res. Microbiol. 143:615– 621. 49. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, p. 1659. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 50. Samuels, D. S., K. E. Mach, and C. F. Garon. 1994. Genetic transformation of the Lyme disease agent Borrelia burgdorferi with coumarin-resistant gyrB. J. Bacteriol. 176:6045–6049. 51. Schwan, T. G., W. Burgdorfer, and C. F. Garon. 1988. Changes in infectivity and plasmid profile of the Lyme disease spirochete, Borrelia burgdorferi, as a result of in vitro cultivation. Infect. Immun. 56:1831–1836. 52. Simpson, W. J., C. F. Garon, and T. G. Schwan. 1990. Borrelia burgdorferi contains repeated DNA sequences that are species specific and plasmid associated. Infect. Immun. 58:847–853. 53. Simpson, W. J., C. F. Garon, and T. G. Schwan. 1990. Analysis of supercoiled circular plasmids in infectious and non-infectious Borrelia burgdorferi. Microb. Pathogen. 8:109–118. 54. Stålhammar-Carlemalm, M., E. Jenny, L. Gern, A. Aeschlimann, and J. Meyer. 1990. Plasmid analysis and restriction fragment length polymorphisms of chromosomal DNA allow a distinction between Borrelia burgdorferi strains. Zentralbl. Bakteriol. 274:28–39. 55. Sunlian, F., D. Subrata, L. Tuan, R. A. Flavell, and E. Fikrig. 1995. A

J. BACTERIOL.

56.

57.

58.

59.

60.

61.

55-kilodalton antigen encoded by a gene on a Borrelia burgdorferi 49-kilobase plasmid is recognized by antibodies in sera from patients with Lyme disease. Infect. Immun. 63:3459–3466. van Dam, A. P., H. Kuiper, K. Vos, A. Widjojokusumo, B. M. de Jongh, L. Spanjaard, A. C. Ramselaar, M. D. Kramer, and J. Dankert. 1993. Different genospecies of Borrelia burgdorferi are associated with distinct clinical manifestations of Lyme borreliosis. Clin. Infect. Dis. 17:708–717. Wallich, R., C. Brenner, M. D. Kramer, and M. M. Simon. 1995. Molecular cloning and immunological characterization of a novel linear-plasmid-encoded gene, pG, of Borrelia burgdorferi expressed only in vivo. Infect. Immun. 63:3327–3335. Wilske, B., A. G. Barbour, S. Bergstro ¨m, N. Burman, B. I. Restrepo, P. A. Rosa, T. Schwan, E. Soutschek, and R. Wallich. 1992. Antigenic variation and strain heterogeneity in Borrelia spp. Res. Microbiol. 143:583–596. Yamamoto, T., and T. Yokota. 1981. Escherichia coli heat-labile enterotoxin genes are flanked by repeated deoxyribonucleic acid sequences. J. Bacteriol. 145:850–860. Zu ¨ckert, W. R., E. Filipuzzi-Jenny, M. Stålhammar-Carlemalm, J. MeisterTurner, and J. Meyer. 1994. Repeated DNA sequences on circular and linear plasmids of Borrelia burgdorferi sensu lato, p. 253–260. In J. S. Axford and D. H. E. Rees (ed.), Lyme borreliosis. Plenum Press, New York. Zuerner, R. L., and C. A. Bolin. 1988. Repetitive sequence element cloned from Leptospira interrogans serovar hardjo type hardjo-bovis provides a sensitive diagnostic probe for bovine leptospirosis. J. Clin. Microbiol. 26:2495– 2500.