Jun 24, 1987 - Vincenzo De Simone, Gennaro Cilibertol,. Elizabeth Hardon, Giacomo Paonessa, Franco Palla2,. Lennart Lundberg3 and Riccardo Cortese.
The EMBO Journal vol.6 no.9 pp.2759-2766, 1987
Cis- and trans-acting elements responsible for the cell-specific expression of the human Al-antitrypsin gene
Vincenzo De Simone, Gennaro Cilibertol, Elizabeth Hardon, Giacomo Paonessa, Franco Palla2, Lennart Lundberg3 and Riccardo Cortese European Molecular Biology Laboratory (EMBL), Meyerhofstrasse, 1 6900 Heidelberg, FRG, and 'Istituto di Scienze Biochimiche, University of Naples, Naples, Italy 2Present address: Istituto di Biol. Cellulare e dello Sviluppo, via Architrafi 22, I-90123 Palermo, Italy 30n leave of absence from Department of Biochemistry and Biophysics, Chalmers University of Technology, S-41296 Goteborg, Sweden Communicated by R.Cortese
The 5' flanking region of the human al-antitrypsin (al-AT) gene contains cis-acting signals for liver-specific expression and, when fused to a reporter gene, is able to drive the expression of this gene specifically in liver cells. Here we report the results of a functional dissection of the al-AT regulatory region. The expression of the bacterial chloramphenicol-transacetylase (CAT) gene, fused to a set of al-AT 5' flanking regions shortened by progressive deletions or mutated by base pair substitutions, has been compared by transfection in HepG2 (hepatocyte) and HeLa (non-hepatocyte) human cell lines. A minimal tissue-specific element has been identified between the nucleotides -137 and -37 (from the transcriptional start site). This DNA segment activates the heterologous SV40 promoter in hepatoma cell lines but not in HeLa cells. This element contains at least two regions referred to as the A (-125/-100) and B (-84/-70) domains, both essential for transcription. There are at least two other regulatory domains located upstream of the 'minimal element'; the most active of these is located between positions -261 and -210 from the cap site. These upstream elements activate the heterologous SV40 early promoter both in hepatoma cell lines and in HeLa cells. Upon fractionation of rat liver nuclear extracts two proteins have been identified, alTF-A and alTF-B, which bind specifically to the A and B domains respectively. Transcriptionally inactive A and B domain mutants are not able to bind these proteins. Key words: human alI-antitrypsin gene/upstream signal sequences/fusion gene/deletion analysis Introduction A large body of knowledge has accumulated on the mechanisms responsible for the control of gene expression in higher eukaryotes. Various experimental strategies have been used, including the introduction of cloned genes into cultured cell lines or the construction of transgenic animals. With very few exceptions it was possible to show that cloned DNA segments contain sufficient information for directing its expression in a cell- or tissuespecific manner. The 'cis-acting' information for tissue specificity is generally located within the 5' flanking region (for a review see Serfling et al., 1985). Some exceptions are known, however, like the immunoglobulin genes, in which a tissue-specific enhancer has been found downstream of the CAP site (Banerji et al., 1983; Gillies et al., 1983; Queen and Baltimore, 1983). More recently several trans-acting factors have been identified and IRL Press Limited, Oxford, England
purified (Briggs et al., 1986; Jones et al., 1987; Johnson et al.,
1987). In the last few years we have studied the mechanisms responsible for selective gene expression in the hepatocyte. The temporal regulation of gene expression in liver is rather complex: some genes are expressed only during fetal life, the best characterized of these is the gene coding for c-fetoprotein (Hammer et al., 1987). Other genes are expressed only after birth, for instance those coding for haptoglobin (Oliviero et al., 1987), a-I-acidglycoprotein (Dente et al., 1985, 1987) and many others (Greengard, 1971). Several other genes are expressed in the hepatocyte throughout development, like retinol-binding protein, a-I-antitrypsin and albumin (Gitlin and Gitlin, 1975). In order to begin to identify the molecular mechanisms responsible for this complex pattern of gene expression, several liver-specific genes have been cloned and characterized. We have shown that the 5' flanking regions of many of these genes contain sufficient information for their specific expression in hepatoma cell lines (Ciliberto et al., 1985; D'Onofrio et al., 1985; Colantuoni et al., 1987; Oliviero et al., 1987).
The human a-l-antitrypsin (a(l-AT) gene has been extensively characterized. We have shown (Perlino et al., unpublished) that there are two different acl-AT mRNAs transcribed from different promoters located 2 kb from each other. The upstream promoter is active only in macrophages, while the downstream promoter is hepatocyte-specific. We have also shown that 'cis' signals necessary for the hepatocyte-specific expression of the a(l-AT gene are contained in the first 721 bp of the 5' flanking region (Ciliberto et al., 1985). Moreover, experiments with transgenic mice have demonstrated that the cloned human gene contains information for tissue-specific expression which is independent of the chromosomal location or of any other 'position effect' in the genome (Kelsey et al., 1987; Sifers et al., 1987; Ruther et al., unpublished). Here we report the functional dissection of the al-AT liverspecific regulatory region. We show that several cis-acting elements contribute to the efficiency and the specificity of al -AT transcription. We have also identified and partially purified two protein factors from rat liver nuclear extracts. These proteins bind specifically to two of the identified functional domains. A correlation between protein activity in vitro and transcriptional levels in vivo has been established. -
Results A DNase I-hypersensitive site is present in the S'flanking region of the al-AT gene in HepG2 but not in HeLa cells The a(l-AT gene is expressed in HepG2 (Knowles et al., 1980) but not in HeLa cells. Consistent with this observation we have found a strong DNase I-hypersensitive site in the a l-AT gene located between nucleotides -300 and -100 from the liverspecific cap site, only in HepG2 (Figure 1). It is likely that the interactions responsible for this DNase I-hypersensitive site are those necessary for the cell-specific expression of the a l-AT gene. We have previously shown that the 721 bp of the 5' flank2759
V.De Simone et al.
_-
He p ] 2 1.
A
..
I..-
i.
-4 8 0
A.A Y,.'.* --t
a
4
B
.4
23( 2 -20 2Q -
.
-
F-11,11,
426
-9
_
FR
56 D
(I 1 1 (I r ., I C". . 1'.. f
4 2& Fl)./ I dr (Iri 1r -
1"
Fig. 1. Cell-specific DNase I-hypersensitive site in the 5' flanking region of the human cxl-AT. HeLa and HepG2 nuclei were treated with DNase I. DNA was extracted and digested with EcoRI (see Materials and methods). The numbers at the top indicate the amount of DNase (ug/ml) used for each slot. The numbers on the side are the sizes of mol. wt markers (X-DNA digested by HindIII). The schematic drawing shows the relative position of the 32P-labelled probe (the BamHI/BamHI fragment) and that of the fragments generated by the EcoRI and DNase I digestion (A and B fragments). B appears less intense than A because its region of complementarity with the probe is much smaller.
ing region are capable of directing accurate and efficient hepatocyte-specific transcription and, more recently, it has been shown that 750 bp are sufficient for accurate, tissue-specific expression of the human al-AT in transgenic mice (S.L.C.Woo, personal communication). In the work presented here the region surrounding the DNase I-hypersensitive site has been analysed in detail by deletion and site-directed mutagenesis. Progressive 5'- 3' deletions of the al-AT 5'flanking region result in a step-wise decrease in expression level To identify the DNA domains involved in the liver-specific regulation of the a l-AT gene expression, we dissected the 5' flanking region of this gene by progressively deleting the upstream sequences in the 5'-3' direction. The ability of these segments to drive the expression of the bacterial chloramphenicol-transacetylase (CAT) gene has been tested in short-term expression experiments. Plasmids containing the progressively deleted a l-AT regulatory
2760
regions (Figure 2A) fused to the CAT gene have been transfected, in parallel, into both the human hepatoma HepG2 cell line (liverspecific host) and the human HeLa cell line (non-liver host). The relative level of expression of these different plasmids has been determined by enzymatic CAT assay (Figure 2B) and by S1 mapping of the CAT transcripts (Figure 3). For the SI mapping experiments the cal-AT constructs were cotransfected with constant amounts of the plasmid SV-fglobin (Wasylyk et al., 1984), used here as internal marker. Progressive deletions in the 5'- 3' direction result in a stepwise decrease of CAT gene expression in the HepG2 cell line: deletions down to the -261 position do not significantly affect the expression of the test gene. Deletion of the sequences from the position -261 to -208 causes an -4-fold decrease of expression. Deletion of the sequences from -208 to -137 does not have any additional effect, but a further deletion of 9 bp results in a significant reduction of the activity. Finally, deletion down to -110 reduces the activity to background levels. The
Expression of the human al-AT gene IF c o R e
FCO RI
] 1- i
t
Kpn
._
A
t,
--I
-.
:
fin t. - tr yps In
I- -
gene
Cat
I P.
~~~~~~~ ..--A-
04M
2< . ~~~~~~ . -2
A
--
10: C
En
50.
B L]
rVo -957
-337
:
--028
-168
137
i rf%rr7 -128 -1I T.
D35L72 IrT
E19
pU[
C8T2
Fig. 2. Activity of the 5' deletions (CAT assay). (A) Schematic representation of the CAT plasmids containing progressive 5' deletions of the acl-AT regulatory region. All the plasmids are identical, except for the length of the cal-AT segments. The restriction sites which have been used during the cloning procedures are indicated (see also Materials and methods). (B) The results of the CAT assays after transfection of HepG2 and HeLa cells with the plasmids indicated in the upper panel. The level of CAT activity obtained with the plasmid containing the longer cal-AT fragment (a557-CAT) has been assumed as 100%. As positive and negative controls we have used respectively pSV2-CAT (Gorman et al., 1982), a plasmid containing the whole regulatory region of the SV40 virus, and pUC19-CAT2 (G.Ciliberto, unpublished), a plasmid containing the SV40 early promoter (21-bp repeats and TATA) which is not active in HepG2 or HeLa cells.
results of the SI analysis
are
in good agreement with the CAT
assays. This means that the decrease of CAT activity is a consequence of a proportionally decreased number of CAT mRNA
transcripts starting at the hepatocyte-specific cap site. These data suggest that there are at least two positive regulatory domains, one located within the -261/ -208 region and another whose 5' boundary is located between nucleotides 137 and -110. None of these constructs shows any detectable expression in HeLa cells. -
Multiple domains contribute to the regulation of 1-ATgene expression The step-wise decrease of activity following progressive 5' deletions indicates the existence of multiple elements contributing to the overall expression of the al-AT gene. In order to identify and characterize these elements we have cloned different segments of the al-AT 5' flanking region (-488/-37, -488/-356, -356/-210 and -137/-37) in front of the SV40 promoter a
(21-bp repeats and TATA) fused to the CAT gene (see Figure 4A), and analysed the efficiency of expression of these constructs (Figure 4B). The -488/-37 segment acts as a tissue-specific enhancer: the expression level is 20-fold higher than the enhancerless construction in HepG2 cells, and there is no effect -
in HeLa cells. The same results are obtained with the - 137/-37 segment. In contrast the other two segments, -488/-356 and -356/-210, behave as general enhancers, with the same efficiency in both cell lines. The -356/-210 element, however, is much more active. These results show that the shortest fragment of the al-AT gene 5' flanking region which is still active in hepatoma cells (- 137/ +44, Figures 2B and 3) is also an autonomous regulatory element able to act as a cell-specific activator, when fused to the heterologous SV40 promoter. Other elements located more upstream contribute to the general level of expression. However, these elements are probably not involved in determining tissue specificity of the cal-AT expression, at least not in our experimental system. 2761
V.De Simone et al. H
Hn; m H;
HepG2
371:
I
---
L1i
3N-
; .4czntp riti trUpsin 9n S4I F
--.--
t
!i-l-
'I
0 ._
Hep32
*
IHeL
En a)
L-4
5 Ci
-,
24
a) 0 .-
2 a-
I::
a)
c .,
j
|
l
u a,
1E0-^
co
(K,
W---
488 37
-
. " -Iii1
Hi ti1 irC
V' 3~
rr1 -anti-lrypsin +
I
Cat
gene
44
' 8HaHHH es I
_ 1 -- ig
--globgne
Fig. 3. Activity of the 5' deletions (SI mapping). S1 mapping of the RNAs extracted from HepG2 cells transfected with some of the 5' deletion plasmids described in Figure 1A. In all transfection experiments the SV-3globin plasmid has been used as an internal control. The positions of the axl-AT and ,B-globin protected bands are indicated. In the lower panel a schematic drawing shows the position of the probes (open bars) and that of the protected band (solid bars) with respect to the CAT and ,B-globin transcription units.
The minimal a l-AT regulatory element (- 137/-37) contains two adjacent domains, both essential for transcription Deletion analysis of the a 1-AT regulatory region has revealed the existence of at least three functional units, the most downstream of which is referred to as the minimal proximal element required for tissue-specific transcription. In order to investigate the internal organization of this proximal element we constructed a series of base pair substitution mutants in the aIl-AT - 137/ -37 region. In each mutant a block of 4-6 nucleotides of the original sequence has been substituted by site-directed mutagenesis, introducing the maximum number of transversions compatible with the creation of a site for the EcoRV restriction enzyme (GATATC). These mutations were introduced in the context of the original deletion mutant A-261 (Figure SA). The 2762
--
488 356
-356 -2210
-137 pUC19 pSlJ2 -37 C1RT2 C A-
Fig. 4. Regulatory elements in the 5' flanking region. Upper panel: schematic representation of the plasmids containing different a1-AT fragments fused to the SV40 promoter (see Materials and methods for the detailed description). Lower panel: the results of the CAT assays after transfection of HepG2 and HeLa cells with the plasmids described in the upper panel. The data are expressed as enhancement of expression, assuming 1 = the background level of expression of the enhancerless construct (pUC19-CAT2).
analysis of their expression in HepG2 and HeLa cells is shown in Figure 5B (CAT assays) and Figure 5C (SI mapping). No expression can be detected with the EM-3, EM-4 and PM-1 mutants, indicating the presence of two essential domains in the proximal element, separated by a sequence which appears to have no function in the control of expression (EM-5 and EM-6). Mutations on either side of these two critical regions show almost normal activity. The two domains can be located between nucleotides - 125/-100 (proximal domain A) and the -85/-70 (proximal domain B). None of these mutants is transcribed in HeLa cells. Proteins from rat liver nuclear extracts specifically bind to the A and B region of the wild-type but not of the transcriptionally inactive mutants The functionally important domains of the a 1-AT regulatory region are presumably recognized by trans-acting proteins. Preliminary experiments using whole-cell extracts of HepG2 and HeLa cells in gel retardation assays showed the presence of proteins binding specifically to different fragments of the cal-AT regulatory region (data not shown). In order to have a more abundant and easily available source of liver-specific DNA binding protein we have started the fractionation of rat liver nuclear extracts by conventional chromatographic techniques (see Materials and methods). The various fractions were assayed for specific DNA binding properties by
Expression of the human al-AT gene
K pn
A 2 -
A
1.
1,
E. uHF
5.!:
V~~~~~~~
'ntitrypDIn
(I
CPI ILPALC If,Tt(C ( C 46;1 6 Rl,Cl
f, G P- .TCPG
RIH!
I lNTNlTIAT
HttIn
f
em
irST
_
x
FM
P
pTAL
rn S
ern
_
gonePfl
----. . .... .. , , .
ITh
CTO IN 'NA. II T. AT
lA
TNO'
Ca t
I
44
'-
26I
t-
b
iOri
Tht
T R I," R
r
r
AT
h)
p
pfr,
n
r-
p1
-
LCL Ti ILCGAlfTf C RTNTO LANIT
-T;
.;, .,
i
pm- '.
pm 6
12 1.. U, 0
C.
I.
,
t ,
.'1 _ Z i
1,
I-
.-I
PfIT
pm"
.' I ". ,.
A-
.4
-
Pm
--
2
4
PeM-5
r----3 pi
...
1t
P m
H/A[,' 'I
pm 2
IV- ..,
T , pm
/ .,1
.1
pm 4
PM
.1
.", A
r1 ,1
I --ffor
m-
'I,
v
C w ~ ~~~ A
w- t.
Pm
V8-qlobill
A4
SX
1t
i
444
_
.
-
2
1
Pm
Pm
4
P
.-i
m
Pm
pm
I
2
3
4
pm
prr
pm
6f pm
pm
Fig. 5. Site-directed mutagenesis of the minimal proximal domain. (A) Schematic representation of the nucleotides substituted in the EM and PM mutants. All the mutations are inserted in the context of the A-261-CAT plasmid (see also Figure 2A). (B) The results of the CAT assays after transfection of HepG2 cells with the plasmids containing the mutations described in the upper panel. The CAT activity of the wild-type plasmid is assumed as 100%. (C) SI mapping of the RNAs from an experiment similar to that shown in (B). The probes and the strategy are identical to those shown in Figure 3.
gel retardation of the 1-AT DNA segment comprising nucleotides -261 to -37 (data not shown). With this assay it has been possible to identify, on a heparin agarose column resolved with a KCl salt gradient, two fractions, o1lTF-A (eluting with 700 mM KCl) and ctaTF-B (eluting with 350 mM KCl), containing protein(s) specifically binding to the -261/-37 DNA segment. The DNA stretches interacting with ca1TF-A and ca1TF-B correspond to the A and B domains defined by mutational analysis (see below). The purification and characterization of these proteins will be reported elsewhere. Here we show the results of a gel retardation experiment (Figure 6), where 32P-labelled -261/-37 segments containing the a
-
a(l-AT 5' sequence of the wild-type, or those of two transcriptionally inactive mutants, EM-3 and PM-1, were incubated in the presence of a1ITF-A or a1TF-B and then separated by polyacrylamide gel electrophoresis. The EM-3 mutant does not bind to alTF-A but does bind efficiently to a1TF-B. PM-1 binds efficiently to a1ITF-A but not to a1ITF-B. The wild-type DNA segment binds efficiently to both proteins. These results show a clear correlation between the transcriptional activity of these mutants and their ability to bind the two proteins. The mutant EM-3 of the A domain and the mutant PM-I of the B domain are likely to be inactive because they are not recognized by aiTF-A and aITF-B respectively. 2763
V.De Simone et al. -488/-356
-137/-37
-261/-210
A
U
y 1-
- Ir -. C. ..'A .*.r'
-z"..
#0
x
DISTAL ELEMENTS
.,
1p-
"
I
-215
A~~~~~~ .-.
B
TATrA AtA
I
PROHIMRL " ELEMENT
-246
i*
-S:I
aB
% %
P
__
_
LGGAACGGACGCTGTGGTTTCTGAGCCAGG Haptoglobin
(-80/-71)
RBP " CORE" enhancer (-237/-228)
Fig. 7. (A) Schematic model of the organization of the al-AT regulatory region. (B) Sequence homologies between the upstream element of the al-AT regulatory region and: the -80/-69 region of the haptoglobin gene; the 'core' enhancer consensus sequence; and the -252/-237 human retinolbinding protein (RBP) sequence.
*t.
E
0f.
Fig. 6. Gel retardation experiment with wild-type and mutant DNA fragments (from -261 to -37). The three lanes are: without nuclear extract, with alTF-A and alTF-B respectively; the relative retarded bands are indicated by arrows.
Discussion Cis-acting elements So far, there are only a few cases in which a highly detailed analysis of the complex system of transcriptional signals present in eukaryotic genes has been performed. The results obtained in the best-studied systems, the enhancer-promoter region of the SV40 early transcriptional unit (Schirm et al., 1987) and the 5' flanking region of the metallothionein gene (Lee et al., 1987), have shown that there are several independent transcriptional signals, which bind different proteins. From these and other studies it appears that most transcriptional signal sequences are relatively short. The signals are often located adjacent to each other, so as to accommodate several different proteins in a short DNA region. The formation of this multiprotein-DNA complex is dependent on DNA-protein interaction (sequence-specific binding) (Davidson et al., 1986) a well as on protein -protein interaction (Takahashi et al., 1986). Our experiments indicate that the organization of the a l-AT regulatory region reflects this general architecture. Figure 7A shows a schematic model of the organization of the oal-AT 5' flanking region, as suggested by the data presented in this paper. A dominant proximal element is located within the first 100 nucleotides immediately upstream of the TATA box (-137/ 2764
-37). These sequences are indispensable for high levels of transcription, and contain sufficient information to activate the otherwise inactive SV40 early promoter in hepatoma but not in HeLa cells. The analysis of the organization of the proximal element by site-directed mutagenesis has revealed the existence of two domains, A and B, located close to each other. Both domains are essential for high levels of transcription from the al-AT promoter. From the deletion analysis the presence of a distal element (the X block in Figure 7A) can be inferred, whose 5' boundary is located between positions -261 and -208. These data, together with the finding that the nucleotides -356/-210 contain a sequence which is able to increase transcription from the SV40 promoter, suggest that this element is located between positions -261 and -210. In this region we have found some structural similarities with other liver-specific genes (see below). The quantitative contribution of the X element to transcription is relatively small juding from the effect of its deletion (a 4- to 5-fold decrease in transcription). In contrast, the X element is a strong activator of the SV40 promoter (40- to 50-fold activation). The effects of X and A + B on the SV40 early promoter are not additive. A construct which has both blocks in front of the SV40 promoter is expressed to the same extent as constructs carrying only X or only A + B (data not shown). It could be that the relatively low potency of the X element in the natural promoter region might be due to attenuation by the presence of an unidentified negative element. Alternatively, one can imagine that the trans-acting factor(s) bound to the X block might be more active in combination with SpI and the other proteins on the SV40 early promoter than with the other cxl-AT promoter binding factors. It is also clear from our results that the X block and the A + B block play different roles in the transcription of the el-AT gene: the deletion of the X block decreases (4- to 5-fold) but does not abolish transcription. In contrast, base pair substitutions in the A or B domain, or internal deletions (not shown) reduce transcription to background levels. The distal element can activate the SV40 early promoter both in HepG2 and in HeLa cells. It is therefore likely that it contains transcriptional elements capable of interacting with trans-acting factors present in both cell lines. Another transcriptional signal is located further upstream, within the -488/-356 DNA segment (the Y block in Figure
Expression of the human al-AT gene
7A). Its existence is revealed by activation of the SV40 promoter (3-4-fold). Also in this case the activation is not cell-specific. Trans-acting factors A large body of evidence indicates that also in higher eukaryotes the mechanisms of control of gene expression are largely dependent on the specific interaction between proteins and transcriptional signals. Recently many trans-acting factors, recognizing specific DNA sequences on various genes, have been identified and characterized (Brigss et al., 1986; Jones et al., 1987; Johnson et al., 1987). Only a few of them, however, have precisely established roles in gene expression. In most cases their importance is deduced from indirect evidence, for instance DNase I footprinting or gel retardation experiments. That this may be misleading is shown by the important observation of Davidson et al. (1986). These authors have shown that the transcriptional signal usually referred to as the octamer, present in the enhancer of SV40, is not required for expression and does not bind to the octamer-binding protein in HeLa cells, even though this protein is present in HeLa cell nuclei and can bind to SV40 DNA in vitro (Bohman et al., 1987). In this paper we correlate in vitro binding properties with in vivo genetic analysis and provide evidence in support of the conclusion that aITF-A and aI TF-B are two essential components of the machinery responsible for the transcription of the al-AT gene in vivo. Preliminary experiments indicate that they are also essential for in vitro transcription of the al-AT gene in rat liver nuclear extracts (Monaci and Nicosia, unpublished) and that their amount, measured by gel retardation, is much higher in hepatoma than in HeLa cell extracts (Swart, unpublished).
Tissue specificity We have shown that in the a l-AT 5' flanking region the minimal information for tissue-specific expression is contained in a short segment of DNA immediately upstream of the transcriptional start point. Further upstream there are other transcriptional signals, which contribute to the expression of the gene. When tested in front of an heterologous promoter only the minimal proximal element (- 137/-37) contains enough information to activate transcription in a cell-specific way. The X and Y blocks seem not to contain tissue-specific information by this assay. The organization of transcriptional signals would consist of two blocks, X and Y, which increase the transcriptional rate, and a proximal element which has both the capacity to stimulate transcription and to determine its cell specificity. This implies a mechanism of dominance of the proximal element over the X and Y elements, responsible for the restriction of their potentially universal activity only to hepatic cells. The mechanism of this 'dominance' is not clear at the moment: the simplest hypothesis involving the presence in HeLa of a repressor which binds somewhere in the proximal element is in contrast with the lack of activation in HeLa by mutagenesis of the - 137/-37 region. The possibility remains, however, that either our set of mutations has failed to hit the repressor binding site, or that in the proximal element there are more than one repressor binding sites, each of them sufficient to prevent the expression in HeLa cells. A non-cell-specific activator adjacent to cell-specific elements has also been found in the retinol-binding protein gene (Colantuoni et al., 1987). At present it is not yet clear whether the selectivity of transcription depends on the crucial contribution of strictly cell-specific transacting factors or whether it is a consequence of a unique combination of trans-acting factors which are themselves not cell
specific. We have been unable either by deletion or
by internal mu-
tations, to induce al-AT expression in HeLa cells. Probably the cis information for liver specificity coincides or overlaps with a region essential for transcription. This interpretation suggests that an essential positive factor(s) plays a role in this phenomenon. Homologies with other genes Several genes are specifically expressed in the hepatocyte. It is not clear at present whether hepatocyte-specific expression is based on a general mechanism or whether there are multiple and independent strategies to achieve cell specificity. A careful identification of cis- and trans-acting elements essential for the expression of several liver-specific genes will allow an answer to these questions. This study is in progress in our laboratory. Comparison of the sequence of the cal-AT X blocks (Figure 7B) with that of other liver-specific genes and with that of other known transcriptional signals reveals some interesting structural features. In this region we observe a cluster of three nucleotide stretches, as shown in Figure 7B. In the centre (nucleotides -229/ -222) there is an octamer corresponding to the canonical core enhancer (Weiher et al., 1983). Upstream of the core enhancer there is a block of 11 bases which shows a high degree of conservation (10/11 bases) with a sequence present in the promoter region of the human haptoglobin gene (Bensi et al., 1985) within the minimal DNA segment essential for efficient transcription (Oliviero et al., 1987). Downstream of the core enhancer there is a block of 10 bases identical to a region of the human retinolbinding gene (D'Onofrio et al., 1985) which is contained within the shortest segment carrying information for cell-specific expression of that gene (Colantuoni et al., 1987). This region shows also homology with the cis-acting element recognized by the Apl protein, which is present in the 5' flanking region of the human metallothionein I gene and in the SV40 enhancer (Lee et al., 1987). Also in the proximal element there are conserved regions: the A domain identified on the basis of the results of functional analysis coincides with a sequence present in the promoter region of the haptoglobin gene (Oliviero et al., 1987). These observations suggest that, despite the lack of any obvious structural homology among the regulatory regions of the various liver-specific genes, common elements are present in different combinations. This picture favours the hypothesis that in the architecture of a transcriptional complex there is the possibility for substituting some of the subunits with different but functionally equivalent proteins. Materials and methods DNase I sensitvity assay Confluent HepG2 and HeLa cells (-2 x 107) were harvested and washed in PBS. Nuclei were isolated and treated with DNase I according to Tuan and London (1984). DNA was extracted from treated nuclei, digested with EcoRl and fractionated on a 0.8% agarose gel, then blotted onto a nitrocellulose filter and hybridized with a 32P-labelled BamHI/BamHI 1. -kb fragment of the al -AT (Ciliberto et al., 1985; see also Figure 1). Plasmid constructions To obtain 5' progressive deletions, the al-AT sequence from the SphI (-721) to the BamHI (-37) restriction sites was cloned in mpl8 (Messing and Vieira, 1982). The resulting DNA was linearized by SphI and incubated at different times in the presence of Bal31 exonuclease as previously described (Ciliberto et al.,
1985).
The resulting fragments were subcloned in the SmaI-BamHI sites of M13-mpl8 mpl9 and sequenced by the chain terminator method (Sanger et al., 1977). The progressively deleted al-AT fragments (all ending at the -37 BamHI site) were subcloned into an expression vector (pEMBLal-CAT) containiing the bacterial CAT gene fused to the -37/+44 fragment of the al-AT (Figure IA). The-488/-37,-488/-356,-356/-210 and-137/-37 fragments of the al-AT were isolated by exploiting the EcoRl site present in the polylinker of all constructs, the Bgll site at position -356, and BgIlI sites introduced by siteor
2765
V.De Simone et al. directed mutagenesis at positions -210 and -137 and the BamHI site present at position - 37. The EcoRI/BamHI, EcoRI/BgEl, BgllBgIl and Bglll/BamHI fragments were purified by agarose low-melting electrophoresis and cloned into an analogous expression vector, pUC19-CAT2 (G.Ciliberto, unpublished) in which the al-AT promoter is replaced by the SV40 region from nucleotides 179 and 5145 (2nd SphI site to HindIll), containing the cap site, the TATA box and the three 21-bp repeats (Tooze, 1980). Cell culture, DNA transfections and CAT assays Human hepatoma cell lines HepG2 (Knowles et al., 1980) and HeLa cells were cultured as monolayers in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. DNA transfections were performed by the calcium phosphate precipitation technique (Graham and van der Eb, 1973). Cells were transfected with 5 Ag (5-cm e dishes) or 15 Ag (10-cm e dishes) of plasmid DNA; each precipitate contained the SVjO-globin plasmid as an internal marker at 1/20th of the total DNA. Transfected cells were harvested 48 h after transfection either for CAT assay or for RNA extraction by the guanidine thiocyanate procedure (Chirgwin et al., 1979). The CAT assays were performed according to Gorman et al. (1982). The quantitation was done by cutting the area of the chromatogram corresponding to the acetylated and non-acetylated forms of the [14C]chloramphenicol and counting them in a liquid scintillation counter. The ratio of the acetylated form to the total was then plotted as percentage of conversion. SI mapping SI mapping was performed according to Berk and Sharp (1977). Various labelled probes were used as indicated in the corresponding figures. All probes were obtained by in vitro elongation on M13 single-strand templates in the presence of [a-32P]dATP and [a-2P]dCTP. For transcripts from plasmids containing the al -AT promoter fused to the CAT gene a fragment from the BamHI site (-37) to the EcoRI site (+220 in the CAT gene) was cloned into M13-mpl9. For transcripts from plasmids where the a l-AT promoter was substituted with the SV40 promoter, a BamHI-EcoRI fragment from SV2-CAT was cloned in M13mpl9. For transcripts from the SV-,Bglobin internal marker (Wasylyk et al., 1984) a BamHI-BamHI fragment was cloned into the BamHI site of M13-mpl9. The elongated DNA was then recut with PstI. The resulting single-strand probes were isolated by PAGE under denaturing conditions. Site-directed mutagenesis The mutagenesis of the - 140/-35 region of the a l-AT was carried out by the oligo-directed procedure described by Kunkel (1985). From the A-261-CAT plasmid (Figure 2A) the KpnI/EcoRI fragment was isolated and cloned in M13mpl 8. The single strand of this clone was then used as a template for the in vitro synthesis of the complementary strand. A set of synthetic oligonucleotides containing the base substitutions to be inserted (flanked at both sides by 12 matching nucleotides) were used as primers for the second strand. The mutations were designed to insert a site for the EcoRV restriction enzyme. The M13 mutant clones were verified by sequencing and the KpnI/BamHI fragments were subcloned into the pEMBLaIl-CAT expression vector. Liver nuclear extract fractionation Protein extracts from rat liver nuclei were prepared according to Dignam et al. (1983). The nuclear extract was applied to a DEAE Sepharose column in buffer D300 (20 mM Hepes, 300 mM KCl, 10% glycerol, 0.2 mM EDTA, 0.5 mM PMSF and 0.5 mM DTT). The flow-through was collected, diluted with DO (as D300 but no salt) to 200 mM KCl, applied to a heparin-Sepharose column and eluted with a linear gradient of KCl in buffer D. The pooled fractions containing the binding activity were used for gel retardation assays. Gel retardation assays The end-labelled probes used in the gel retardation assays were prepared from the -261 al-AT plasmid. The plasmid DNA was digested with BamHI, labelled with the polynucleotide kinase +[-y-32P]ATP and then re-cut with KpnI. Gel retardation assays were carried out according to Fried and Crothers (1981).
Acknowledgements We are grateful to Iain Mattaj for critically reading the manuscript. The work was partially supported by an EEC Grant No. BAP-1 15 to R.C. The work in Italy was supported by grants from P.F. Ingegneria Genetica e Basi Molecolari delle Malattie Ereditarie and P.F. Oncologia, Roma, Italy. V.DeS. is a recipient of an EMBO fellowship, and L.L. was supported by a grant from the National Swedish Board for Technical Development.
References Banerji,J., Olson,L. and Schaffner,W. (1983) Cell, 33, 729-740. Bensi,G., Raugei,G., Klefenz,H. and Cortese,R. (1985) EMBOJ., 4, 119-126. Berk,A.J. and Sharp,P.A. (1977) Cell, 12, 721-732.
2766
Bohman,D., Keller,W., Dale,T., Scholer,H., Tebb,G. and Mattaj,I.W. (1987) Nature, 326, 268-272. Briggs,M.R., Kadonaga,J.T., Bell,S.T. and Tjian,R. (1986) Science, 234, 47-52. Chirgwin,J.M., Przbyla,A.E., MacDonald,R.J. and Rutter,W.J. (1979) Biochemistry, 18, 5294-5299. Ciliberto,G., Dente,L. and Cortese,R. (1985) Cell, 41, 531-540. Colantuoni,V., Pirozzi,A., Blance,C. and Cortese,R. (1987) EMBO J., 6, 631 636. Davidson,I., Fromental,C., Augereau,P., Wildeman,A., Zenke,M. and Chambon, P. (1986) Nature, 323, 544-548. Dente,L., Ciliberto,G. and Cortese,R. (1985) Nucleic Acids Res., 13, 3941-3952. Dente,L., Pizza,M.G., Metspalu,A. and Cortese,R. (1987) EMBO J., 6, 2289-2296. Dignam,J.D., Lebowitz,R.M. and Roeder,R.G. (1983) Nucleic Acids Res., 11, 1476-1489. D'Onofrio,C., Colantuoni,V. and Cortese,R. (1985) EMBO J., 4, 1981 - 1989. Fried,M. and Crothers,D.M. (1981) Nucleic Acids Res., 9, 6505-6525. GllMies,S.D., Morrison,S.L., Oi,V.T. and Tonegawa,S. (1983) Cell, 33, 717-728. Gitlin,D. and Gitlin,J.D. (1975) In Putnam,F.W. (ed.), The Plasma Proteins. 2nd ed. Academic Press, New York, Vol. II, pp. 263-319. Gorman,C.M., Moffat,L.F. and Howard,B.H. (1982) Mol. Cell. Biol., 2, 10441051. Graham,F.L. and Van der Eb,A.J. (1973) Virology, 52, 456-467. Greengard,O. (1971) In Campbell,P.N. and Dickens,F. (eds), Essays in Biochemistry. Academic Press, New York, Vol. VII, pp. 195-205. Hammer,R.E., Krmnlauf,R., Camper,S.A., Brinster,R.L. and Tilghman,S. (1987) Science, 235, 53-58. Johnson,P.F., Landschulz,W.F., Graves,B.J. and McKnight,S. (1987) Genes Develop., 1, 133-146. Jones,K.A., Kadonaga,J.T., Rosenfeld,P.J., Kelly,T.J. and Tjian,R. (1987) Cell, 48, 79-89. Kelsey,G.D., Povey,S., Bygrave,A.E. and Lovell-Badge,R.H. (1987) Genes Develop., 1, 161-171. Knowles,B.B., Howe,C.C. and Aden,D.P. (1980) Science, 209, 497-499. Kunkel,T.A. (1985) Proc. Natl. Acad. Sci. USA, 82, 488-492. Lee,W., Halinger,A., Karin,M. and Tjian,R. (1987) Nature, 325, 368-373. Messing,J. and Vieira,J. (1982) Gene, 19, 269-276. Oliviero,S., Morrone,G. and Cortese,R. (1987) EMBO J., 6, 1905-1912. Queen,C. and Baltimore,D. (1983) Cell, 33, 741-748. Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl. Acad. Sci. USA, 74, 5463-5467. Schirm,S., Jirichy,J. and Schaffner,W. (1987) Genes Develop., 1, 65-74. Serfing,E., Jasin,M. and Schaffner,W. (1985) Trends Genet., 1, 224-230. Sifers,R.N., Carlson,J.A., Clift,S.M., De Mayo,F.J., Bullock,D.W. and Woo, S.L.C. (1987) Nucleic Acids Res., 15, 1459-1466. Takahashi,K., Vigneron,M., Matthes,H., Wildeman,A., Zenke,M. and Chambon, P. (1986) Nature, 319, 121-126. Tooze,J. (1980) DNA Tunor Viruses. Cold Spring Harbor Laboratory Press, New York. Tuan,D. and London,I.M. (1984) Proc. Natl. Acad. Sci. USA, 81, 2718-2722. Wasylyk,B., Wasylyk,C. and Chambon,P. (1984) Nucleic Acids Res., 12, 55895608. Weiher,H., Konig,M. and Gruss,P. (1983) Science, 219, 626-631. Received on June 2, 1987; revised on June 24, 1987
