Classical RS1 and environmental RS1 elements in

Journal of Medical Microbiology (2010), 59, 302–308

DOI 10.1099/jmm.0.017053-0

Classical RS1 and environmental RS1 elements in Vibrio cholerae O1 El Tor strains harbouring a tandem repeat of CTX prophage: revisiting Mozambique in 2005 Seon Young Choi,1,23 Je Hee Lee,1,23 Eun Jin Kim,1 Hye Ri Lee,1 Yoon-Seong Jeon,1,2 Lorenz von Seidlein,1 Jaqueline Deen,1 M. Ansaruzzaman,3 G. Marcelino E. S. Lucas,4 Avertino Barreto,4 Francisco F. Songane,4 Catarina Mondlane,5 G. Balakrish Nair,6 Cecil Czerkinsky,1 John D. Clemens,1 Jongsik Chun1,2 and Dong Wook Kim1 Correspondence Dong Wook Kim [email protected]

1

International Vaccine Institute, Seoul, Republic of Korea

2

School of Biological Sciences, Seoul National University, Seoul, Republic of Korea

3

International Centre for Diarrhoeal Disease Research, Bangladesh (ICDDR,B), Dhaka, Bangladesh

4

Ministry of Health, Maputo, Mozambique

5

Centro de Higiene Ambiental e Exames Medicos, Beira, Mozambique

6

National Institute of Cholera and Enteric Diseases, Kolkata, India

Received 26 October 2009 Accepted 8 December 2009

Currently, Vibrio cholerae O1 serogroup biotype El Tor strains producing classical type cholera toxin (altered strains or El Tor variants) are prevalent in Asia and in Mozambique. Mozambican strains collected in 2004 contained a tandem repeat of CTX prophage on the small chromosome and each CTX prophage harboured the classical rstR and classical ctxB. We found that the majority of the strains collected in 2005 in Mozambique contained extra elements on the large chromosome in addition to the tandem repeat of CTX prophage on the small chromosome. New type RS1 elements RS1cla and RS1env, and a CTXenv with rstRenv and the classical ctxB were identified on the large chromosome of the Mozambican isolates collected in 2005.

INTRODUCTION Cholera is a severe diarrhoeal disease caused by Vibrio cholerae (Kaper et al., 1995; Sack et al., 2004). The current 7th cholera pandemic is being caused by V. cholerae O1 serogroup biotype El Tor strains producing El Tor type cholera toxin. Cholera toxin is encoded by ctxAB genes, which are carried in the genome of a filamentous, lysogenic bacteriophage, CTXW (McLeod et al., 2005). In El Tor strains, the CTX prophage is integrated in the genome of V. cholerae in various arrays, frequently together with a CTX phage-related genetic element, RS1, which is also the 3These authors contributed equally to this work. Abbreviation: MLVA, multilocus variable number of tandem repeats analysis. The GenBank/EMBL/DDBJ accession numbers for the sequences of the genome fragments of the strains described in this report are GQ466608–GQ466612. Supplementary tables are available with the online version of this paper.

302

genome of a satellite phage (McLeod et al., 2005). The RS1 element contains the replication related genes rstR, rstA and rstB, which are common to the CTX phage, plus rstC, which facilitates CTX phage gene expression (Davis et al., 2002). The rstR on the RS1 element has been shown to be the El Tor type, which has a different sequence from the classical type rstR on the classical CTX prophage (Davis et al., 2000). A tandem repeat of CTX prophage or CTX prophage-RS1 array is prerequisite for production of CTX virions due to the unique replication mechanism of CTX phage (Davis & Waldor, 2000). El Tor biotype strains were believed to contain El Tor type CTX prophage (harbouring El Tor type rstR and El Tor type ctxB) and classical biotype strains to contain classical type CTX prophage (classical type rstR and classical type ctxB) (Boyd et al., 2000). However, since as early as the 1990s, El Tor biotype strains with classical biotype characteristics (hybrid strains) and El Tor strains containing classical type cholera toxin, which is determined by B subunit gene ctxB (altered strains or El

Downloaded from www.microbiologyresearch.org by 017053 G 2010 SGM IP: 52.2.249.46 On: Sat, 17 Oct 2015 15:12:53

Printed in Great Britain

Novel RS1 elements in V. cholerae O1 El Tor

Tor variants), have been reported in Asian countries and Mozambique (Nair et al., 2006; Raychoudhuri et al., 2008). Most of the recent clinical isolates from India, Bangladesh and Vietnam are El Tor strains that produce classical cholera toxin (Kumar et al., 2009; Nair et al., 2006; Nguyen et al., 2009; Raychoudhuri et al., 2008). These Asian endemic and epidemic strains usually contain an RS1 element followed by a CTX prophage harbouring El Tor type rstR (rstRET) and classical ctxB on the large chromosome. In contrast, V. cholerae O1 El Tor biotype clinical isolates collected in Mozambique in 2004 (representative strain B33) contained a tandem repeat of classical CTX prophage on the small chromosome (Faruque et al., 2007; Lee et al., 2006). Genomic analysis results suggest that the 2004 Mozambican strain B33 may have been generated from prototype 7th pandemic El Tor strains (Chatterjee et al., 2009; Faruque et al., 2007). A series of cholera outbreaks occurred in 2005 in Mozambique, and more than 800 V. cholerae O1 clinical isolates were collected from Beira, Mozambique, where B33 was found in 2004. Of the 2005 isolates, 20 randomly selected isolates were analysed for physiological or genetic changes compared to the 2004 isolates (Lee et al., 2006; Nusrin et al., 2004). In the present study, we identified novel RS1 elements, RS1env which has the environmental type rstR and RS1cla which contains the classical type rstR, among the clinical isolates of V. cholerae collected in Mozambique in 2005. We also report the full sequence of a

new CTX prophage that has the environmental rstR and classical type ctxB.

METHODS V. cholerae isolates collected in 2005. In 2005, 832 clinical

isolates of V. cholerae O1 were collected in Mozambique. Twenty randomly selected isolates were screened for antibiotic resistance by the disc diffusion method (BBL Sensi-Disc; Becton Dickinson) and potential genetic changes from the previous year. Four V. cholerae O1 strains, N16961 (biotype El Tor), O395 (biotype classical), B33 (an altered strain isolated in Mozambique in 2004) and MJ1236 (a hybrid strain isolated in Bangladesh in 1994), were used as reference strains in this study (Faruque et al., 2007; Lee et al., 2006; Safa et al., 2005). Genetic analyses. We analysed the genetic structures of V. cholerae

O1 isolates from Mozambique in 2005 by similar methods to those described elsewhere with the primers shown in Table 1 (Nguyen et al., 2009). The PCR primer set Ch1F0/Ch1R or Ch1F0/Ch1p3R was used for long-amplification PCR (Takara) to amplify CTX prophage and RS1 element(s) on the large chromosome. Then, restriction enzyme digestion analysis was performed to determine the array of CTX prophage and RS1 on the large chromosome. When the CTX prophage and RS1 array was determined, each element was amplified and sequenced individually. For example, RS1cla of IB1627 was amplified with primer set ctxBF/Ch1R. The entire fragment sequence was obtained by combining the sequences of the individual elements. The PCR products were sequenced in both directions using a Big Dye Cycle Sequencing kit (Applied Biosystems) and sequencing was performed on an ABI 3770 automatic sequencer at the International Vaccine Institute according to the manufacturer’s instructions.

Table 1. Primers used to determine the CTX prophage and RS1 element array Primer Ch1F Ch1F0 Ch1R Ch1p3R Ch2F Ch2R rstRclaF rstRclaR rstRclaR4 rstRETF rstRETR rstRETR4 rstAR rstCF rstCR rstCF4 rstCR4 ctxBF cepR rstRCalF rstRCalR rstREnvF rstREnvR rstREnvR4

Sequence (5§–3§)

Reference(s)

GACCACTCAGGCCGCTGAAAT GCGAGTAATGTTGAGCATTTTCCTCAC CCGCGCTCAAGTGGTTATCGG CTCCCTAGGAAACTACAACTTCAACTGGGG AACAACAGGTTGCAAGAGAGCATT TATTGCTTTTTTAATGGCCGTT CAGCAAAGCCTCCATCAAAA GTTCAAAAATTAGGGATTTAAGAGTTGAG CTGATGAGAAGTAAGAGTCG TGAGCATAAGCTCTTGATTT AAGGCTAGCCAACCAAAGAAAGG TCCAACAGTTAGATGAAGAAG CCGTGAAAGTCATCAACG GATGTTTACGATAGCCTAGAAGACTT TACAGTGATGGCTCAGTCAATGC AAATCCGCAACTCAAGGCATTGA TAAGCGCCTGAACGCAGATATAAAG AGATATTTTCGTATACAGAATCTCTAG AAACAGCAAGAAAACCCCGAGT TCAAGCTTTTTTTTGCTTTATCTTA TGGCAACAAAGCACATTAAAGA GCTTCATTTGTGTATTGGTCTATTAGGTAGTTA TCGAGTTGTAATTCATCAAGAGTGAAAA AACAGGCTTGAAGCGTTAAC

Heidelberg et al. (2000) Heidelberg et al. (2000) Heidelberg et al. (2000) This study Heidelberg et al. (2000) Heidelberg et al. (2000) This study This study This study Heidelberg et al. (2000); Nusrin et al. (2004) This study This study Heidelberg et al. (2000) Heidelberg et al. (2000) Heidelberg et al. (2000) Heidelberg et al. (2000) Heidelberg et al. (2000) Heidelberg et al. (2000) Heidelberg et al. (2000) Davis et al. (1999); Nusrin et al. (2004) Davis et al. (1999); Nusrin et al. (2004) Nusrin et al. (2004) Nusrin et al. (2004) This study

http://jmm.sgmjournals.org

Downloaded from www.microbiologyresearch.org by IP: 52.2.249.46 On: Sat, 17 Oct 2015 15:12:53

303

S. Y. Choi and others

Multilocus variable number of tandem repeats analysis (MLVA). Genomic DNA was prepared from LB agar grown cultures

using the Prepman Ultra kit (Applied Biosystems). Five loci for MLVA were amplified using the primers and PCR conditions described in previous studies (Ghosh et al., 2008; Stine et al., 2008): VC0147 (cell division protein, ftsY), VC0436–VC0437 (intergenic region), VC1650 (collagenase), VCA0171 (hypothetical protein) and VCA0283 (hypothetical protein). Sequence data for each isolate were added to a group of known sequences that were aligned simultaneously and edited through jPHYDIT (Jeon et al., 2005). An MLVA profile is composed by listing the number of repeat units of each locus in the order described above.

RESULTS AND DISCUSSION Isolates collected in 2005 in Mozambique The 20 selected isolates collected in 2005 were identified as V. cholerae O1 serotype Ogawa biotype El Tor. They were sensitive to ampicillin, chloramphenicol, tetracycline, kanamycin and ciprofloxacin but resistant to trimethoprim–sulfamethoxazole, characteristics similar to those of the isolates collected in 2004. The presence of the RS1 element was tested by PCR amplification of the rstC gene (primer pair rstCF/rstCR) (Nguyen et al., 2009). Of the 20 isolates, 18 contained rstC, which was not identified in isolates collected in 2004. Two other isolates that did not contain rstC were later found to have a tandem repeat of the CTX prophage array on the small chromosome. The DNA sequences of the CTX prophages of one of these two isolates (IB1482) were identical to those of the CTX prophages on B33. El Tor type rstR (primer pair rstRETF/rstRETR) was not amplified in any of these 20 isolates. All contained classical type rstR (rstRcla), which was confirmed by PCR amplification with primer pair rstRClaF/rstRClaR. Moreover, many contained the environmental type rstR (rstRenv), which was PCR amplified with rstREnvF/rstREnvR (Nusrin et al., 2004), while Calcutta type rstR (primer pair rstRCalF/rstRCalR), which exists in O139 strains, was not amplified (Davis et al., 1999). This implies the possibility of the presence of an RS1 element with rstRcla or rstRenv that has yet to be reported. Isolates with RS1env, RS1cla and CTXenv We determined the CTX prophage and RS1 array of two isolates by sequencing the CTX prophage and RS1 elements on both chromosomes. Both contained a tandem repeat of the classical CTX prophage on the small chromosome similar to strain B33 as shown in Fig. 1. In these two isolates (IB1627 and IB1346), a solitary CTX prophage identical to the CTX prophage on the small chromosome was present on the large chromosome followed by RS1 element(s). IB1627 contained a classical RS1 (RS1cla) with rstRcla. IB1346 contained a tandem repeat of the environmental RS1 (RS1env); the DNA sequences of these two RS1env elements were identical. In addition, a CTX 304

prophage that had an rstRenv and classical ctxB was identified in another isolate (IB1617), which was amplified by PCR (approx. 7 kb) with primer set rstREnvF/ rstRenvR4. However, the exact CTX prophage and RS1 element array of this isolate was not determined. The simplest CTX prophage and RS1 array of the large chromosome of this isolate is likely to be CTXcla– CTXenv–RS1env–RS1cla. We compared variable sites of CTX prophage(s) and RS1 elements of El Tor biotype strain N16961 (GenBank accession nos AE003852/ AE003853), classical biotype strain O395 (CP000626/ CP000627), B33 (ACHZ00000000) and Mozambican 2005 strains (Tables 2 and 3 and Supplementary Table S1 in JMM Online). Different rstR genes and the intergenic regions ig-1 and ig-2 in different phages were also compared, although their sequences and lengths differ (Supplementary Table S2). Regardless of collection year, all CTX prophages in Mozambican isolates had identical DNA sequences except for nine nucleotide variations between the CTX prophages (Supplementary Table S3) and a slight variation in the number of ToxR binding repeats (TTTTGAT) between zot and ctxA (Table 2). DNA sequences of rstA and rstB varied not only among different types of CTX prophages and RS1 elements, but also between the same type of CTX prophage and RS1 (Table 3), which indicates that the genetic change of RS1 is independent from that of CTX prophage. CTX prophage in Mozambican isolates The Mozambican CTX prophage is not identical to the classical CTX prophage (CTXcla) of classical biotype strain O395. It appears that the Mozambican CTX prophage has the mosaic structure of El Tor and classical CTX prophages. ig-1, rstR, ig-2, the first one-third of rstA and ctxB of the Mozambican CTX prophage are identical to those in CTXcla (Supplementary Table S2). Most of the core regions, from the middle of rstA to ctxA, are more similar to those in CTXET (Supplementary Table S1). In particular, a 3 bp insertion between nucleotides 77 and 79 in rstB and the number of ToxR binding repeats between zot and ctxA of the Mozambican CTX prophage are more similar to the CTXET prophage than to the CTXcla prophage (Table 2). Thus, we suggest calling the Mozambican CTX prophage CTXMoz. More CTX prophages in various strains should be analysed to elucidate the origin of CTXMoz. Genetic relatedness of 2004 and 2005 isolates To investigate the genetic relatedness of the isolates collected in 2004 and 2005, an MLVA method was applied to the isolates (Ghosh et al., 2008). B33 and most of the 2004 isolates had an MLVA profile of 8,7,8,11,20 or 7,7,8,11,20, and some isolates contained allele type 21 or 22 at the last locus (Table 4). The isolates collected in 2005 had the profiles 7,7,8,11,20 and 7,7,8,13,20. One isolate (IB1482) had the profile 6,8,8,14,17. Altered strains found

Downloaded from www.microbiologyresearch.org by IP: 52.2.249.46 On: Sat, 17 Oct 2015 15:12:53

Journal of Medical Microbiology 59

Novel RS1 elements in V. cholerae O1 El Tor

Fig. 1. Genetic structures of RS1 elements and CTX phages in the strains analysed in this study. Block arrows indicate the transcription direction of each gene. Black triangles on the genome indicate the repeat sequence flanking the integrated phage DNA. Classical rstR and environmental rstR are indicated in black and grey, respectively. PCR primers bordering CTX prophage integration sites of each chromosome are shown. Strains have in common a tandem repeat of CTXMoz on the small chromosome while lacking the TLC (toxin-linked cryptic) element on the large chromosome (shown in squares). IB1346 contains an additional CTXMoz on the large chromosome followed by a tandem repeat of RS1env. The agarose gel shows the PstI digestion pattern of the fragment amplified with primer set Ch1F0/Ch1p3R and that of N16961. The PstI site in the orfU gene is shown on the map. IB1482 has the same CTXMoz array as B33 (Faruque et al., 2007; Lee et al., 2006). IB1627 contains an additional CTXMoz followed by an RS1cla on the large chromosome. The agarose gel shows the PstI digestion pattern of the fragment amplified with primer set Ch1F0/Ch1R and that of N16961. The size of the PCR-amplified fragment, the sequenced region (in parentheses) and GenBank accession number are shown.

in Asian countries containing RS1-CTX prophage on the large chromosome could be categorized into 10,6,7,x,x and 9,3,6,x,x/9,7,6,x,x groups (S. Y. Choi and others, unpublished). Some Bangladeshi strains (MJ1236, MG116926 and E1781), which also have a tandem repeat of CTXMoz on the http://jmm.sgmjournals.org

small chromosome, possessed 8,7,8,x,x (Table 4). This shows that all of these strains that harbour a tandem repeat of the CTXMoz prophage on the small chromosome compose a unique clade among the hybrid and altered V. cholerae O1 strains.

Downloaded from www.microbiologyresearch.org by IP: 52.2.249.46 On: Sat, 17 Oct 2015 15:12:53

305

Dots indicate sequence identical to that of N16961. Strain

N16961 O395 IB1346 IB1617 IB1627 O395 MJ1236 B33 IB1346 IB1482 IB1617 IB1627

Chr.

rstA

CTXET CTXcla CTXMoz CTXenv CTXMoz CTXcla CTXMoz CTXMoz CTXMoz CTXMoz CTXMoz CTXMoz

1

2

rstB

zot–ctxA

27

51

52

162

183

258

345

354

414

459

516

540

558

579

609

774

77–79

90

96

288

291

344

C T T T T T T T T T T T

T ? ? C ? ? ? ? ? ? ? ?

T ? ? G ? ? ? ? ? ? ? ?

C T T T T T T T T T T T

C A A ? A A A A A A A A

G C C ? C C C C C C C C

G T ? ? ? T ? ? ? ? ? ?

C ? ? T ? ? ? ? ? ? ? ?

T ? ? A ? ? ? ? ? ? ? ?

C ? ? T ? ? ? ? ? ? ? ?

G A ? A ? A ? ? ? ? ? ?

A G ? G ? G ? ? ? ? ? ?

C ? ? T ? ? ? ? ? ? ? ?

T C ? C ? C ? ? ? ? ? ?

T C ? ? ? C ? ? ? ? ? ?

C T ? ? ? T ? ? ? ? ? ?

GTA (2)* ? ? ? ? ? ? ? ? ? ?

A T ? ? ? T ? ? ? ? ? ?

T C ? ? ? C ? ? ? ? ? ?

A G ? ? ? G ? ? ? ? ? ?

C T ? ? ? T ? ? ? ? ? ?

G ? T T T ? ? T T T T T

ctxB

ToxR 115 203 binding repeat 4 7 3 3 3 7 4, 4 4, 4 3, 4 4, 4 3, 4 3, 4

T C C C C C C C C C C C

T C C C C C C C C C C C

*Not present on CTXcla.

Table 3. Nucleotide variation sites among different RS1 elements Dots indicate sequence identical to that of N16961. Journal of Medical Microbiology 59

Strain

N16961 IB1346 IB1627

Chr.

1

rstA

ET

RS1 RS1env RS1cla

rstB

27

51

52

162

183

258

354

414

459

516

540

558

579

654

774

894

927

933

942

86

97

105

C T T

T C ?

T G ?

C T T

C ? A

G ? C

C T ?

T A ?

C T ?

G A ?

A G ?

C T ?

T C ?

C T ?

C T ?

T C ?

C ? T

T ? C

T ? G

C T T

A G G

A G G

Downloaded from www.microbiologyresearch.org by IP: 52.2.249.46 On: Sat, 17 Oct 2015 15:12:53

285 288 A G G

C T T

S. Y. Choi and others

306

Table 2. Nucleotide variation sites among different CTX prophages

Novel RS1 elements in V. cholerae O1 El Tor

Table 4. MLVA profiles of V. cholerae strains Allele number indicates the number of repeat units of each locus. The repeat units of the MLVA loci are: AACAGA at VC0147, GACCCTA at VC0436-7, GATAATCCA at VC1650, TGCTGT at VCA0171, and ACCAGA at VCA0283. Original ID

Country, year

VC0147 cell division protein (ftsY)

VC0436-7 non-coding (intergenic)

VC1650 collagenase

VCA0171 hypothetical protein

VCA0283 hypothetical protein

B33 IB243 IB261 IB280 MJ1236 MG116926 E1781 IB1346 IB1482 IB1617 IB1627

Mozambique, 2004 Mozambique, 2004 Mozambique, 2004 Mozambique, 2004 Bangladesh, 1994 Bangladesh, 1991 Bangladesh, 2000 Mozambique, 2005 Mozambique, 2005 Mozambique, 2005 Mozambique, 2005

8 8 7 8 8 8 8 7 6 7 7

7 7 7 7 7 7 7 7 8 7 7

8 8 8 8 8 8 8 8 8 8 8

11 11 11 11 12 14 9 11 14 13 11

20 22 20 21 19 23 24 20 17 20 21

Origin and role of the novel RS1 elements cla

env

It remains to be elucidated whether RS1 and RS1 have only now been recognized or whether they have emerged recently. Perhaps it is more likely that these novel RS1 elements and the CTXenv with classical ctxB have not been identified despite having co-existed with RS1ET, CTXET and CTXcla. Alternatively, as for the mosaic El Tor CTX prophage harbouring El Tor type rstR and classical type ctxB found in Asian altered strains, perhaps the new RS1cla and RS1env were generated by genetic exchange among different strains. If these new RS1 elements were generated recently, more isolates should also be analysed to reveal the origin of the RS1 (rstC) and to see whether any more genetic changes are occurring. It seems that these new strains co-exist and continue to cause outbreaks together with the strains from the previous year, and these new strains are now more prevalent. B33 is shown to be incapable of producing CTX phages although the tandem repeat of the CTXMoz prophage might be able to facilitate the phage DNA replication (Faruque et al., 2007). RstC encoded by the RS1 element is shown to be an antirepressor of RstR and to promote CTX phage transmission (Davis et al., 2002). Whether these new strains harbouring RS1cla and RS1env are able to produce the CTX phage by having RS1 is being investigated.

acquisition of distinct CTXWs by toxigenic Vibrio cholerae. J Bacteriol 182, 5530–5538. Chatterjee, S., Patra, T., Ghosh, K., Raychoudhuri, A., Pazhani, G. P., Das, M., Sarkar, B., Bhadra, R. K., Mukhopadhyay, A. K. & other authors (2009). Vibrio cholerae O1 clinical strains isolated in 1992 in

Kolkata with progenitor traits of the 2004 Mozambique variant. J Med Microbiol 58, 239–247. Davis, B. M. & Waldor, M. K. (2000). CTXW contains a hybrid genome derived from tandemly integrated elements. Proc Natl Acad Sci U S A 97, 8572–8577. Davis, B. M., Kimsey, H. H., Chang, W. & Waldor, M. K. (1999). The Vibrio cholerae O139 Calcutta bacteriophage CTXW is infectious and

encodes a novel repressor. J Bacteriol 181, 6779–6787. Davis, B. M., Moyer, K. E., Boyd, E. F. & Waldor, M. K. (2000). CTX

prophages in classical biotype Vibrio cholerae: functional phage genes but dysfunctional phage genomes. J Bacteriol 182, 6992–6998. Davis, B. M., Kimsey, H. H., Kane, A. V. & Waldor, M. K. (2002). A

satellite phage-encoded antirepressor induces repressor aggregation and cholera toxin gene transfer. EMBO J 21, 4240–4249. Faruque, S. M., Tam, V. C., Chowdhury, N., Diraphat, P., Dziejman, M., Heidelberg, J. F., Clemens, J. D., Mekalanos, J. J. & Nair, G. B. (2007).

Genomic analysis of the Mozambique strain of Vibrio cholerae O1 reveals the origin of El Tor strains carrying classical CTX prophage. Proc Natl Acad Sci U S A 104, 5151–5156. Ghosh, R., Nair, G. B., Tang, L., Morris, J. G., Sharma, N. C., Ballal, M., Garg, P., Ramamurthy, T. & Stine, O. C. (2008). Epidemiological

study of Vibrio cholerae using variable number of tandem repeats. FEMS Microbiol Lett 288, 196–201.

ACKNOWLEDGEMENTS This work was supported by the Cholera Vaccine Initiative, funded by the Bill and Melinda Gates Foundation. The International Vaccine Institute is supported by the governments of Korea, Sweden and Kuwait. J. H. L. and D. W. K. were supported by grant number RTI0501-01 from the Regional Technology Innovation Program of the Ministry of Knowledge and Economy (MKE).

Heidelberg, J. F., Eisen, J. A., Nelson, W. C., Clayton, R. A., Gwinn, M. L., Dodson, R. J., Haft, D. H., Hickey, E. K., Peterson, J. D. & other authors (2000). DNA sequence of both chromosomes of the cholera pathogen

Vibrio cholerae. Nature 406, 477–483. Jeon, Y. S., Chung, H., Park, S., Hur, I., Lee, J. H. & Chun, J. (2005).

jPHYDIT: a JAVA-based integrated environment for molecular phylogeny of ribosomal RNA sequences. Bioinformatics 21, 3171– 3173.

REFERENCES

Kaper, J. B., Morris, J. G., Jr & Levine, M. M. (1995). Cholera. Clin

Boyd, E. F., Heilpern, A. J. & Waldor, M. K. (2000). Molecular analyses of a putative CTXW precursor and evidence for independent

Kumar, P., Jain, M., Goel, A. K., Bhadauria, S., Sharma, S. K., Kamboj, D. V., Singh, L., Ramamurthy, T. & Nair, G. B. (2009). A large cholera

http://jmm.sgmjournals.org

Microbiol Rev 8, 48–86.

Downloaded from www.microbiologyresearch.org by IP: 52.2.249.46 On: Sat, 17 Oct 2015 15:12:53

307

S. Y. Choi and others outbreak due to a new cholera toxin variant of the Vibrio cholerae O1 El Tor biotype in Orissa, Eastern India. J Med Microbiol 58, 234–238. Lee, J. H., Han, K. H., Choi, S. Y., Lucas, M. E., Mondlane, C., Ansaruzzaman, M., Nair, G. B., Sack, D. A., von Seidlein, L. & other authors (2006). Multilocus sequence typing (MLST) analysis of

Vibrio cholerae O1 El Tor isolates from Mozambique that harbour the classical CTX prophage. J Med Microbiol 55, 165–170. McLeod, S. M., Kimsey, H. H., Davis, B. M. & Waldor, M. K. (2005). CTXW and Vibrio cholerae: exploring a newly recognized type of

Nusrin, S., Khan, G. Y., Bhuiyan, N. A., Ansaruzzaman, M., Hossain, M. A., Safa, A., Khan, R., Faruque, S. M., Sack, D. A. & other authors (2004). Diverse CTX phages among toxigenic Vibrio

cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic in Bangladesh. J Clin Microbiol 42, 5854–5856. Raychoudhuri, A., Mukhopadhyay, A. K., Ramamurthy, T., Nandy, R. K., Takeda, Y. & Nair, G. B. (2008). Biotyping of Vibrio cholerae O1: time to

redefine the scheme. Indian J Med Res 128, 695–698.

phage-host cell relationship. Mol Microbiol 57, 347–356.

Sack, D. A., Sack, R. B., Nair, G. B. & Siddique, A. K. (2004). Cholera.

Nair, G. B., Qadri, F., Holmgren, J., Svennerholm, A. M., Safa, A., Bhuiyan, N. A., Ahmad, Q. S., Faruque, S. M., Faruque, A. S. & other authors (2006). Cholera due to altered El Tor strains of

Lancet 363, 223–233.

Vibrio cholerae O1 in Bangladesh. J Clin Microbiol 44, 4211–4213. Nguyen, B. M., Lee, J. H., Cuong, N. T., Choi, S. Y., Hien, N. T., Anh, D. D., Lee, H. R., Ansaruzzaman, M., Endtz, H. P. & other authors (2009).

Cholera outbreaks caused by an altered Vibrio cholerae O1 El Tor biotype strain producing classical cholera toxin B in Vietnam in 2007 to 2008. J Clin Microbiol 47, 1568–1571.

308

Safa, A., Bhuiyan, N. A., Alam, M., Sack, D. A. & Nair, G. B. (2005).

Genomic relatedness of the new Matlab variants of Vibrio cholerae O1 to the classical and El Tor biotypes as determined by pulsed-field gel electrophoresis. J Clin Microbiol 43, 1401–1404. Stine, O. C., Alam, M., Tang, L., Nair, G. B., Siddique, A. K., Faruque, S. M., Huq, A., Colwell, R., Sack, R. B. & other authors (2008).

Seasonal cholera from multiple small outbreaks, rural Bangladesh. Emerg Infect Dis 14, 831–833.

Downloaded from www.microbiologyresearch.org by IP: 52.2.249.46 On: Sat, 17 Oct 2015 15:12:53

Journal of Medical Microbiology 59