Climate Changes and Potential Impacts on ...

9 788192 693545

CLIMATE CHANGE and its IMPLICATIONS ON CROP PRODUCTION and FOOD SECURITY Chief Editor

Ratnesh Kumar Rao

Editors

P.K. Sharma B. Jirli M. Raghuraman

Published by

Mahima Research Foundation and Social Welfare 194, Karaundi, Banaras Hindu University, Varanasi-221 005, UP, India Reg. # 643/2007-2008, www.mrfsw.org

Published by

©Mahima Research Foundation and Social Welfare 194, Karaundi, Banaras Hindu University, Varanasi-221005, UP, India Reg. # 643/2007-2008, www.mrfsw.org All rights reserved. No part of this publication may be reproduced or transmitted, in any form or by any means, without permission. Any person who does any unauthorized act in relation to this publication may be liable to criminal prosecution and civil claims.

ISBN: 978-81-926935-4-5

Year – 2016

Price: Rs. 2500.00 $ 400.00

Typing, Formatting and Designed by: Mahima Research Foundation and Social Welfare

Printed by

Mahima Publications 194, Karaundi, Banaras Hindu University, Varanasi-221 005

The views and content of this book are solely of author(s) of the chapter of book We have taken all reasonable care to ensure that the contents of the book do not violate any existing copyright or other intellectual property rights of any person in any manner whatsoever. In the event the author(s) has /have been unable to track any source and if any copyright has been inadvertently infringed, please notify the publisher in writing for corrective action.

Editorial Board Chief Editor

Ratnesh Kumar Rao Secretary, Mahima Research Foundation and Social Welfare 194, Karaundi, BHU, Varanasi-221 005, UP, india

Editors

P.K. Sharma Department of Soil Sciences and Agricultural Chemistry, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi-221 005

B. Jirli Department of Extension Education, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi-221 005

M. Raghuraman Department of Entomology and Agricultural Zoology Institute of Agricultural Sciences, Banaras Hindu University, Varanasi-221 005 Dr. Tuhina Verma

Dr. T. Thomas

Dr. J.K. Singh

Dr. S.K. Verma

Dr. R.S. Meena

Dr. B.K. Sharma

Dr. Manoj Kumar Singh

Year – 2016 Published by

©Mahima Research Foundation and Social Welfare 194, Karaundi, Banaras Hindu University, Varanasi-221005 Reg. # 643/2007-2008, www.mrfsw.org

Printed by

Mahima Publications 194, Karaundi, Banaras Hindu University, Varanasi-221005

Content Preface

i

Climate Change and Conflict for Water a Threat to Peace and Security in South Asia Abhaya K. Singh

1

Climate Change: Implication, Adaptation and Mitigation on Agriculture V. K. Verma, Gaurav, Abhishek Singh, Shudhanshu Verma

13

Protecting Food Security through Mitigation of Climate Change Sudhanshu Verma, Abhishek Singh, Swati Swayamprbha Pradhan, V.K. Verma, Shani Singh and S. B. Maurya

21

Role of Plant Biotechnology in Crop Improvement for Adoptation in Changing Climatic Conditions Mohd. Zahid Rizvi

29

Climate Change and its Effect on Food Security Ashish Kumar Maurya, Santosh Kumar, Vikas Kumar Jain, Girish Tantuway, Indra Bahadur Maurya and Indrajeet Kumar Mandal

37

Impact of Climate Change on Water Resource Potential of India Bhaskar Pratap Singh, V.K. Chandola, Dinesh Kumar, Raj Bahadur and Anshu Gangwar

43

Impact of Global Warming on Indian Agriculture: Mitigation and Adaptation Gaurav, V. K. Verma, S. K. Verma and Sunil Kumar

47

Effect of Climatic Changes on Mycorrhiza Maneesh Kumar, Sumit Rai, Avinash Kumar Rai, Priyanka Rani and Y.V. Singh

51

Role of Agricultural Extension to Harnessing the Climate Change Vulnerability Renu Gangwar and Amita Yadav

55

Climate Changes and Potential Impacts on Postharvest Quality of Horticultural Crops Sandeep Kumar Mauriya, Akhilesh Kumar Pal and Kulveer Singh Yadav

59

Decoding Cold Responsive Pathways in Plants: An Approach towards Encountering the Effect of Climate Change Santosh Kumar, Girish Tantuway, Ashish Kumar Maurya and Indrajeet Kumar Mandal

63

Impact of Climate Change on Pest Incidence Saxena R.P.N, P.S.Singh, Deepak Kumar Jaiswal, Vaibhav Singh, D.K.Singh and Prateek Singh

67

Climate Change and Tomato Processing Industry Ila Gaur and S. K. Goyal

71

Impact of Climate Change on Vegetable Crops Rupesh Kumar Mandal, Akhilesh K. Pal, Kulveer S. Yadav, Ravi Kumar and Pankaj K. Singh Impact of Climate Change and Food Security Bijendra Kumar Singh, Akhilesh K. Pal, Kulveer Singh Yadav and Ravi Kumar

77

Targeting Global Sustainability–Food Security, Biodiversity and Climate Change A. Jha

81

Influence of Climate Change on Some Foremost Floricultural Crops Kulveer Singh Yadav, Akhilesh K. Pal, Ravi Kumar, Pankaj K. Singh, and Rupesh K. Mandal

85

Impact of Climate Change on Food Security of India Anjali Agrawal

87

79

Climate Change Impact on Global Food Security Deepika Baranwal Food Security under Changing Climate; Problems, Priorities & Prospects D.R. Chowdary

96 103

Climate Change Response Strategies for Agriculture: Challenges and Opportunities for the 106 21st Century Govind Kumar Bagri, Avinash Kumar Rai, Rajesh Kumari and Dheeraj Kumar Bagri Effect of Climate Change on Horticultural Crops Kulveer Singh Yadav, Akhilesh K. Pal, Sandeep K. Mauriya Ravi Kumar, Pankaj K. Singh, and Rupesh K. Mandal

109

Climate Change and Food Security: Risks and Responses Pukhraj Meena, Arvind, A.D. Tripathi, and Manoj Kumar Meena

112

Ensuring Food Security through Evaluation of Decontamination Methodologies for Removal of Pesticide Residues in Tomato (Solanum lycopersicum) Sudhakar S. Kelageri, Cherukuri Sreenivasa Rao, V. Shashi Bhushan and P. Narayana Reddy

115

An Assessment on the Effect of Climate Change on Protease Producing Bacteria Tuhina Verma and Swati Agarwal

118

Hidden Harvest under Changing Climate Vikas Kumar Jain, Anil K. Singh, Prashant Bisen, Ashish Kumar Maurya, Anupam Tiwari, Sumit Pal and Risha Varan

125

Climate Change and Human Rights Violation Vivek Shukla

130

Development of Fingerprints of Linseed Cultivars and Genetic Purity Assessment through Morphological and Molecular Markers Vikas Pali and Nandan Mehta

133

Recent Trend of Monsoon Rainfall in the Dry Land Zone of West Bengal and its Impact on Agriculture Asutosh Goswami

143

Potentiality, Role and Constraints of Bio-Fertilizers in Sustaining Agriculture Production Abhishek Singh, Sudhanshu Verma, Sandeep Kumar, V. K. Verma, Uppu Sai Sravan

147

Water Balance and Moisture Adequacy Region of Eastern Uttar Pradesh Anamika Singh and B. N. Singh

153

Cost Effective Protected Cultivation of Strawberry under Subtropical Lucknow Conditions Ashok Kumar, Tarun Adak, Muralidhara B.M., Atul Singha and Veena G. L.

161

Adoption of Modern Plant Breeding Approaches for Crop Improvement Dan Singh Jakhar, Amit Kumar, Saket Kumar and Rajesh Singh

165

Soil Solarization: An Efficient and Eco Friendly Approach for Plant Protection under Sustainable Agricultural System Kiran Rana, Manoj Parihar, Sunil Kumar, H.S. Jatav and S.S. Jatav

169

Effect of Integrated Nutrient Management on Physico-Chemical Properties of Soil and Growth and Yield of Hybrid Maize (Zea mays L.) Var. Hybrid 9637 T. Thomas, P. Smriti Rao, Gitesh Dewangan and Sinha Parshottam

179

An Appraisal of Seasonal Variations in Thermal Indices, Heat and Water Use Efficiency in Mango Tarun Adak, Kailash Kumar and Vinod Kumar Singh

183

Effect of Weed Management Practices on Weed Dynamics and Nutrient Uptake by the Crop and Weeds in Kharif Maize (Zea mays L.) Neha Sharma and A.V. Dahiphale

189

Assessment of Macronutrients in Soils of Bastar Plateau Region, Chhattisgarh, India P. Smriti Rao, Tarence Thomas, Ashish David and Anita Kerketta

193

Effect of Temperature and Relative Humidity on Growth of Beauveria bassiana Isolated from Helicoverpa armigera Tahseen Fatima, Neeta Sharma, Y.K. Sharma and P.K. Shukla

199

Economical and Eco-friendly Drying Methods and Modeling for Retention of Quality Attributes of Amla Payel Ghosh, Sandeep Singh Rana, Rama Chandra Pradhan and Sabyasachi Mishra

203

Enhancing Use of Genetic Diversity for Pulses Improvement against Biotic and Abiotic Stresses under Changing Climatic Scenario Seema Sheoran

209

The Science Behind Golden Rice Shama Parveen, Himanshu Trivedi, Madhuri Arya and P.K. Singh

213

Brassinoteroids–A Stress Mitigating Option in Modern Agriculture Shivani Lalotra, Sandeep Kumar, A. Hementranjan and Jyostanarani Pradhan

219

Irrigation Scheduling for Higher Yield and Water Use Efficiency in Wheat Kairovin Lakra, Gaurav, Ravi Prakash Singh, S.K. Verma, S.K. Prasad and S.B. Singh

223

Effect of Heavy Metals on Plants and Human Health Surya Kant, P.K. Sharma, Vipen Kumar, Achin Kumar and Anil. K. Shukla

229

Constraints and Prospects of GM-Mustard Sunil Kumar, Vikram Kumar, R.N. Meena, K. Hemalatha and Rajesh Kumar Singhal

233

Status of Nitrogen, Phosphorus, Potassium, Sulphur and Zinc in Jamunapar Soils and Heavy Metals in Sewage Water of Allahabad Region Tarence Thomas and P. Smriti Rao

237

Farming Systems for Food, Income and Environmental Security Vikram Kumar, Sunil Kumar, R.K. Singh, Gaurendra Gupta and Rajesh Kumar Singhal

241

Toxicological Effects of Microcystin on Fishes Ashvani Kumar Srivastav

245

Important Storage Pest and its Management Deepak Kumar Jaiswal, Vaibhav Singh, Prateek Singh, A.B. Singh and Anamika

251

Bonsai: An Amalgam of Science and Art Himanshu Trivedi, Shama Parveen and Parul Punetha

259

Records on the Activity Phototectic Insects in Medicinal Crops Amit Kumar Sharma, Rishikesh Mandloi and A.K. Bhowmick

265

Insect Pests of Cowpea and their Integrated Management Ram Keval

269

Insect Pests of Brinjal and its Integrated Pest Management Kantipudi Rajesh Kumar, Rakshit Roshan and Tanweer Alam

273

Evaluation of Soil Fertility Status in Soils of Bastar Plateau Region, Chhattisgarh, India Tarence Thomas, P. Smriti Rao, Anita Kerketta, Ashish David

275

Crop Fungus Pathogen Management by Plant Growth Promoting Rhizobacteria Deepmala Katiyar, A. Hemantaranjan and Bharti Singh

280

Response of Rice Phenophage to Water Deficit J. Pradhan, M. Kar, S. K. Sahoo, S. Lalotra and K. K. Panigrahi

285

Estimation of Losses due to Pulse Beetle (Callosobruchus chinensis L.) in Black Gram R. S. Meena, M. A. Laichattiwar and Gautam Kumar

292

Genetics and Molecular Validation of New Donors for Different Types of Floods in Rice M. Girijarani, P.V. Satyanarayana, N. Chamundeswari, B. N. S. V. R. Ravikumar, P. V. Ramana Rao, T. Srinivas and Y. Suneeta

295

Edible Flowers: Flavours of Kitchen Parul Punetha, Shailja Punetha and Himanshu Trivedi

298

Structural Change in India with Special Reference to Agriculture Pawan Kumar Singh

303

Soil Quality Monitoring of Salt-Affected Lands after Reclamation in Western Uttar Pradesh B. Lal, M. S. Yadav, Poonam Varshney, K. Singh, Amit Singh, Ranjeet, Laxmi and Alok Mathur

310

Use of Decision Support System in Soil Microbiology Priyanka Rani, Sumit Rai and Maneesh Kumar

315

Effect of Foliar Spray and Differential Dose of Nitrogen on Quality and Yield of Indian Mustard Rajni Sinha

318

Development of a Suitable Biocides by Using Essential Oils for Controlling Fusarium oxysporum and Rhizoctonia solani Causing Wilt Disease and Damping off Disease in Crop Plants Renu Shukla, Soni Tiwari and Rajeeva Gaur

321

Guinea Grass (Panicum maximum)–An Efficient, Palatable, Fast Growing Perennial Grass- 328 Book Review Sandeep Kumar, A. V. Dahipahle, Hari Singh, Neha Sharma, Sanjeev Kashyap and Abhishek Singh Seasonal Incidence and Influence of Weather Parameters of Whitefly, Bemicia tabaci (Gennadius) and jassid, Amrasca devastans (Distant) on Brinjal Crop Sanjay Kumar Das, M. Raghuraman, Ingle Dipak Shyamrao and Santeshwari

335

Role of Plastic Mulch in Soil Health and Crop Productivity Shiv Bahadur, Surajyoti Pradhan, Sudhanshu Verma, Rohit Maurya and S. K. Verma

338

Enhancing Water-Use Efficiency of Indian Mustard (Brassica juncea) under Deficit and Adequate Irrigation Scheduling with hydrogel S.M. Singh, Sumit Chaudhary, Anil Shukla, M. S. Negi, Chandra Bhushan and B. S. Mahapatra

345

Importance of Soil Temperature and Moisture on Nitrogen Mineralization in Soil System Sunil Kumar, H. S. Jatav, Manoj Parihar and Gaurav

348

Dynamics of Powdery Mildew in Mango and its Evaluation Using Humid Thermal Index: An Appraisal P.K. Shukla, Tarun Adak and Gundappa

351

Seed Production in Vegetable Crops; the Indian Prospects Vaibhav Singh, Durga Prasad Moharana, Deepak Kr. Jaiswal, D.K.Singh and Pradip Kumar Singh

356

PREFACE

C

limate change will affect all four dimensions of food security: food availability, food accessibility, food utilization and food systems stability. It will have an impact on human health, livelihood assets, food production and distribution channels, as well as changing purchasing power and market flows. Its impacts will be both short term, resulting from more frequent and more intense extreme weather events and long term, caused by changing temperatures and precipitation patterns, People who are already vulnerable and facing food insecurity are likely to be the first affected. Access to sufficient food, clean water, stable health condition, ecosystem resources and security of settlements are intricately intermingled with agriculture. No doubt, climate change will have profound impact on agriculture on both of its crucial components, the production and protection sector. Agriculture-based livelihood systems that are already vulnerable to food insecurity face immediate risk of increased crop failure, new patterns of pests and diseases, lack of appropriate seeds and planting material, and loss of livestock. Peoples living on the coastal areas, floodplains as well as on mountains, dry lands and the Arctic zones are mostly at risk. As an indirect effect, low-income people are everywhere, but particularly in urban areas, will be at risk of food insecurity owing to loss of assets and lack of adequate insurance coverage. Food systems will also be affected through possible internal and international migration, resourcebased conflicts and civil unrest triggered by climate change and its impacts. Agriculture, forestry and fisheries would not only be affected by climate change, but also contribute to it through emitting greenhouse gases. They also hold part of the remedy, though they can contribute to climate change mitigation through reducing greenhouse gas emissions by changing agricultural practices. Production of food and other agricultural commodities may keep pace with aggregate demand, but there are likely to be significant changes in local cropping patterns and farming practices. There has been a lot of research on the impacts that climate change might have on agricultural production, particularly cultivated crops. Some 50 percent of total crop production comes from forest and mountain ecosystems, including all tree crops, while crops cultivated on open, arable flat land account for only 13 percent of annual global crop production. Production from both rainfed and irrigated agriculture in dryland ecosystems accounts for approximately 25 percent, and rice produced in coastal ecosystems for about 12 percent. Agricultural production operations include preparation of land, use of the appropriate crop and its cultivars, application of fertilizers and pesticides, and water management. All these operations require energy. Historically, draft animals provided a major source of energy. With mechanization providing a more efficient means of farm operations, draft energy was gradually replaced by fossil fuels. This has lead to a gradual decrease in farm families. As a result, today in developed countries less than 5% of the total population is engaged in agriculture. However, in developing countries agriculture continues to be the major occupation of a majority of the population. Today, India is at the cross road in the context of global climate change. Adequate attention has been offered worldwide in order to create greater awareness amongst the public, policy makers and of course the scientific community. The existing studies present that climate change models with higher spatial resolution can be a way forward for future climate projections. Meanwhile, scholastic projections of more than one climate model are necessary for providing insights into model uncertainties as well as to develop risk management strategies. It is projected that water availability will increase in some parts of the world, which will have its own effect on water use efficiency and water allocation. Crop production can increase if irrigated areas are expanded or irrigation is intensified, but these may increase the rate of environmental degradation. Since climate change impacts on soil water balance will lead to changes of soil evaporation and plant transpiration, consequently, the crop growth period may shorten in the future impacting on water productivity. Crop yields affected by climate change are projected to be different in various areas, in some areas crop yields will increase, and for other areas it will decrease depending on the latitude of the area and irrigation application. In the future, particularly in the changing climate conditions, to ensure food security will require a greater emphasis than now on land and water management, crop management and post-

ii

Climate Change and its Implications on Crop Production and Food Security

harvest management. The availability of energy will be a significant factor affecting production. Developments in the use of non-polluting, renewable resources of energy will play a significant role in conserving the resource base of agricultural production. Any major breakthrough in this sector, should be globally shared without reservations about political, social or economic considerations. Such a breakthrough, in addition to supporting agricultural production, would help control the "greenhouse effect" itself and will be to the benefit of mankind. Often developing countries are blamed by the affluent developed nations that the developing nations are more prone and vulnerable to the impacts of climate change. Hence in this book, an initiative on this burning topic, which is need of the hour will be deliberated with possible causes and management due to climate change. We are extremely thankful for the financial support from various Government agencies like ICAR, DST, NABARD and DBT without, whose support this book would not have been possible.

Ratnesh Kumar Rao Secretary Mahima Research Foundation and Social Welfare 194, Karaundi, BHU, Varanasi-221005

CLIMATE CHANGE AND CONFLICT FOR WATER A THREAT TO PEACE AND SECURITY IN SOUTH ASIA Abhaya K. Singh Associate Professor, Department of Defence & Strategic Studies, K. S. Saket Post Graduate College, (Dr. R. M. L. Awadh University) Ayodhya, Faizabad-224001- INDIA

T

here is a popular, tongue-in-cheek saying in America attributed to the writer Mark Twain, who lived through the early phase of the California Water Wars that “whiskey is for drinking and water is for fighting over.” It highlights the consequences, even if somewhat apocryphally, as ever-scarcer water resources create a parched world. Currently South Asia is reeling under its worst drought in modern times. Among the issues that will shape our future world are water and other natural resources, demographics, and sustainable economic growth, as well as an accelerated weaponisation of science and other geopolitical elements. A combination of these factors will create winners and losers in the world. Adequate availability of water, food and energy is critical to global security. The sharpening, international, geopolitical competition over natural resources has turned some strategic resources into engines of power struggle and triggered price volatility. The geopolitics of natural resources promises to get murkier. Water, the sustainer of life and livelihoods is already the world’s most exploited natural resource. With nature’s freshwater-renewable capacity lagging behind humanity’s current rate of utilisation, tomorrow’s water is being used to meet today’s need. At a time when South Asia is at a defining moment in its history, water stress has emerged as one of its most serious challenges. Water shortages have not only stirred geopolitical tensions by intensifying competition over the resources of shared rivers and aquifers, but they also threaten Asia’s continued economic rise. The following causes of water scarcity in South Asia:  Rapidly growing population  Urbanisation  Unsustainable land-use change,  To the excessive extraction of groundwater,  Water-related disasters and  Climate change Impact Mechanisms of Climate Change: Overexploitation of natural resources has spurred an environmental crisis, which, in turn, is furthering regional climate change. When climate changes significantly or environmental conditions deteriorate to the point that necessary resources are not available, societies can become stressed, sometimes to the point of collapse (CNA, 2007). Climate change is fast emerging as the most defining challenges of the 21st century as global risks with impacts far beyond just the environment and implications on national security and development. It poses a systemic challenge to India’s national security. Climate change challenges at the national, regional and global level are enormously demanding and interconnected and have obvious implications in terms of human security. Security analysts and academics have warned that climate change threatens water and food security, the allocation of resources, and coastal populations, threats which in turn could increase forced migration, raise tensions and trigger conflict (Mathews, 1989). The security implications of climate change cover a wide spectrum. The recent scientific assessment presents a worrisome picture. According to the Fourth Assessment Report of IPCC, eleven of the last twelve years (1995-2006) rank among the twelve warmest years since 1850. The 2007 IPCC report predicts temperature rise of 1.1 - 6.4 °C by 2100. The number of natural disasters in the world may double during the next 10 to 15 years. Over the past ten years, 3,852 disasters killed more than 780,000 people, affected more than two billion others and cost a minimum of $960 billion (http://www.thedailystar.net/newDesign/news-details.php?nid=198040). The Fourth Assessment Report of the Intergovernmental Panel on Climate Change (IPCC) also established that warming of the climate system was ‘unequivocal’ and if the annual emission of Greenhouse gases remains are today’s levels, by 2050 it will be 550 parts per million (Thomas, 1991). This means a potentially catastrophic mean global temperature increase of 5 degree Celsius. That would imply seas rising and submerging half of Bangladesh. Glaciers would melt, leading first to

2


floods and then droughts as river run dry. There would be more dengue, more malaria, and more diarrhea (Thomas, 1991). The IPCC also established that the range of global average surface warming over the period of this century vary from 0.3℃ to 6.4℃. The corresponding average rise in sea levels ranges from 0.18m to 0.59m, excluding the impact of dynamic changes in the ice flow (IPCC, 2007). In Southern Asia, the mean annual increase in temperature by the end of the century is projected to be around 3.8℃ in the Tibetan plateau and 3.3℃ in South Asia (Christensen et al., 2007). While there is still an ongoing debate over the pace at which the temperature is expected to rise over the coming century, potential mechanisms by which the change will affect the region are clear. These are: the changes to subcontinent’s river systems that flow from the Tibetan plateau to the Indian Ocean, and, rising sea levels and their impact on river-deltas and low-lying islands (Brahma, 2007). In addition, a third mechanism pertinent to the this study: extreme weather—cyclones, droughts, floods etc., that do not exclusively result from global warming but are both vitiated by it and complicate our response to the disasters it causes Climate change is currently taking place at an unprecedented rate and is projected to compound the pressures on natural resources and the environment associated with rapid urbanisation, industrialisation, and economic development. It will potentially have profound and widespread effects on the availability of, and access to, water resources. By the 2050s, access to freshwater in Asia, particularly in large basins, is projected to decrease.

CLIMATE CHANGE AND ROUTES OF CONFLICT

Human Economic Activity

Co2 Emission

Regional & Global Climatic Changes

Changes in Agricultural Output Altered ResourceAvailability

CLIMATE CHANGE Global Conflict Saturday, October 15, 2016

Food Shortages

Regional Conflict

Political Dispute, Ethnic Tension & Civil Unrest

9

Geography of Himalayan Glaciers: Before the introduction of machines in the warfare Himalaya was playing the role of natural guard to protect our Northern Frontiers. The period from mechenised warfare to till date, more or less, it played its important role to secure our borders. But the further role is changing. It may cause grievous conflict between different surrounding countries along with major powers of the world for its God gifted resource of drinking water. Till now it was producing sufficient water for its surrounding countries but as for the population of these countries are increasing the need of Himalayan water is also increasing. And in the contrast, due to global warming and other various causes the water of Himalayan Rivers are coming down. The Himalayas have the largest concentration of glaciers outside the polar caps. The world's third largest freshwater stores are in the Himalayan glaciers. That is why; they are called the “Water Towers of Asia (The Tribune, 2008).” The Himalayas lie to the north of the Indian subcontinent and to the south of the central Asian high plateau. They are bound by the Indus on the west slope of Mt Nanga Parbat (near Gilgit), and in the west, by river Jaizhug Qu on the eastern slope of Mt Namjabarwa. The Geological Survey of India claims that the Himalayan glaciers occupy about 17 per cent of the total mountainous range (Vohra 1978) (as compared to 2.2% in the Swiss Alps), while an additional 30 to 40 per cent area has seasonal snow cover. In the whole of the Himalayan range, independent geologists claim that there are 18,065 small and big glaciers with a total area of 34,659.62 km2 and a total ice volume of 3,734.4796 km3.The

Climate Change and Conflict for Water a Threat to Peace and Security in South Asia

3

major clusters of glaciers are around the 10 Himalayan peaks and massifs: Nanga Parbat (Gilgit), the Nanda Devi group in Garhwal, the Dhaulagiri massif, the Everest-Makalu group, the Kanchenjunga, the Kula Kangri area, and Namche Bazaar. The Indian Himalayan glaciers are broadly divided into three-river basins of the Indus, Ganga and Barahmaputra. The Indus basin has the largest number of glaciers (3,538), followed by the Ganga basin (1,020) and the Barahmaputra (662). The principal glaciers are: Siachen 72 km; Gangotri 26 km; Zemu 26 km; Milam 19 km and Kedarnath 14.5 km (http://assets.panda.org/downloads/ himalayaglaciersreport2005.pdf). Table 1: A Status of the Glacier Inventory of Indus Basin Basins Numbers of Glaciers Jhelum 133 Satluj 224 Others 3398 Total 3755 Source: Kaul et al. 1999

Glacierised Area(Km2) 94.0 420.0 33382.0 33896.0

Table 2: A Status of the Glacier Inventory of Ganga- Brahmaputra Basins Basins Numbers of Glaciers Numbers of Glaciers(Km2) Bhagirathi 238 755.0 Tista 449 706.0 Brahmaputra 161 223.0 Others 640 2378.0 Total 1488 4062.0

Ice Volume(Km3) 3.0 23.0 26.0 Ice Volume(Km3) 67.0 40.0 10.0 117.0

Source: Kaul et al. 1999

The Himalayan glaciers feed seven of Asia’s great rivers: the Ganga, Indus, Brahmaputra, Salween, Mekong, Yangtze and Huang Ho- ensuring a year-round water supply to hundreds of millions of people in the Indian subcontinent. But, due to climate change, about 70 per cent of glaciers are retreating at a startling rate in the Himalayas. The Kathmandu based UN OrganisationInternational Centre for Integrated Mountain Development (ICIMOD) has found that global warming is having serious impact on the amount of snow and ice in the Himalaya. It has serious implications for downstream ware availability as up to 50 percent of the average annual flows in the rivers are contributed by snow and glacial melting. ICIMOD (2009) clearly pointed out that the warming in the Himalaya has been much more than the global average-for example, 0.6 degrees Celsius per decade in Nepal, compared to the global average of 0.74 degree Celsius (IPCC 2007a). The climate change is real and happening now and it is causing a serious impact on fragile ecosystems like glaciers. Seventy per cent of the worlds freshwater are frozen in glaciers. Glacier melt buffers other ecosystems against climate variability. Very often, it provides the only source of water for humans and the biodiversity during dry seasons. Snow Cover Changes in the Gangotri Glaciers

The potential loss of this water resource from climate change in 21st century has serious impact on environment and India’s national security as well. Sometimes known as “The Third Pole”, the Himalayan glaciers contain the world’s third largest store of freshwater after the Antarctic and Arctic. Since the ecology of the region is so finely balanced, with glacier runoff providing a regular pattern of melt water into the region’s largest rivers and acting as a backup supply of water in the event of monsoon failure. Even minor climate changes can have a devastating environmental effect on

4


the life blood of more than 25% of the world’s population. This source is not inexhaustible and with accelerated melting of Himalayan glaciers the water shortages in the long run would be the cause interstate and intrastate conflicts as millions of lives would be at stake in the Region (http://www.copenhagen. globeinternational.org/ includes/documents/cm_docs). Sea levels threaten to rise higher than previously anticipated. And water supplies are increasingly at risk from both melting glaciers and extreme climate events, such as droughts and floods. The melting of Himalayan glacier due to climate change also poses a complex security challenge in the form of forced migration and resource based conflicts. Thus, the melting of Himalayan glacier due to climate change poses a systemic challenge to India’s security and stability as well. Melting of Himalayan Glaciers: Himalayan glaciers are receding faster today than the world average. In the next decades the melting of the Himalayan glaciers could lead to several problems. Several Asian rivers receive huge amounts of their waters from these glaciers. Regarding an accelerated glacial melt the Ganges for example could be subjected to increasing seasonal influences. This means that the availability of freshwater will change, which has an effect on irrigation and thereby food production for e.g. in the Indo-Ganges area. Causes of Melting of Himalayan Glaciers 1. Higher temperature thaws the glaciers. 2. Global warming changes snow into rain that melts the glaciers. 3. The amount of snowfall has decreased. 4. “Siachin glacier was rapidly melting because of the ongoing military activity at the highest flashpoint of the world, according to the study conducted by Arshad H Abbasi, a consultant for the World Wide Fund for Nature (WWF).” 5. India and china are planning to build a lot of new power plants 6. Countries on both sides of the Himalayas have developed plans for hundreds of new dams, mainly for hydroelectric power 7. Large dams invariably impose large social and environmental costs—harnessing sacred waters, displacing people, affecting river and silt flows, and destroying habitats. 8. China is building a dam on the Yarlung Tsangpo River in Tibet; Beijing will divert this water to the planned South-North Water Diversion Project. As the earth's temperature continues to rise, mountain glaciers are melting throughout the world. Nowhere is this of more concern than in Asia. It is the ice melt from glaciers in the Himalayas and on the Tibetan plateau that sustain the major rivers of India and China, and the irrigation systems that depend on them, during the dry season. “Indeed, the projected melting of the glaciers on which these two countries depend presents the most massive threat to food security humanity has ever faced,” says Lester R Brown, environmentalist and president of the Earth Policy Institute, a non-profit research organisation based out of Washington DC (http://www.dnaindia.com). Lester R. Brown also warned that the way Indian glaciers were melting because of climate change, the Ganga may turn into a “mausmi nadi’’ before the turn of this century as its origin - the Gangotri glacier - was shrinking at an alarming speed (The Tribune, 2008). The IPCC Fourth Assessment Report (IPCC, 2007a; 2007b) states that there is a high measure of confidence that in the coming decades many glaciers in the region will retreat, while smaller glaciers may disappear altogether. Various attempts to model changes in the ice cover and discharge of glacial melt have been made by assuming different climate change scenarios. One concludes that with a 2ºC increase by 2050, 35% of the present glaciers will disappear and runoff will increase, peaking between 2030 and 2050 (Qin, 2002). According to remote sensing observation, it is estimated that above 90% of the glaciers are receding. This is also substantiated by some ground based monitoring. Some glaciers are expanding, particularly in the Karakorum, or at least the terminus positions are advancing. The Indian Space Research Organisation’s Space Applications Centre (SAC) using data from the Indian Remote Sensing satellite (IRS) has observed that the major Himalayan glaciers have shrunk by 21% in the last 40 years (http://www.copenhagen.globeinternational.org/ includes/ documents/cm_docs 2009). The glaciers of the Himalayan region are under a big environmental threat. Recent studies prove clearly the fact that the glaciers are melting away. In 2008 a Chinese research team verified for approximately 20 glaciers in the Himalayan highlands that they had lost roughly more than five percent of their area during the recent 45 years (http://www.boel-india.org/web/index.html). The


5

satellite pictures today show that the famous or rather infamous for being the world’s highest battlefield Siachin glacier which is 70 Km long and 5-10 km wide is shrinking rapidly and showing increasing number of blue lakes within its expanse (http://www.copenhagen.globeinternational.org/ includes/ documents /cm_docs 2009). One of the world’s biggest watersheds is the third pole “The Tibet Plateau’; on which depends more than 25% of the world’s population, which feeds more than 10 rivers that flow out of it (http://www.copenhagen.globeinternational.org/includes/documents/cm_docs 2009). This source is not inexhaustible and with accelerated melting of Himalayan glaciers the water shortages in the long run would be the cause internal and external tensions as millions of lives would be at stake. Both the food and water scarcity issues in these parts have the potential to cause cascading ripple effects all over the globe. The melting of glaciers and global warming would completely change the methods of logistics support to the forces in Siachin and other higher reaches of India. Reduced agricultural productivity and the resultant situation of food insecurity is potentially the most worrying consequence of climate change. If global warming rises to 3°C it is likely that the number of people suffering from hunger will increase by 250 million to 550 million. Rising food prices could potentially push hundreds of millions of people back into poverty. This situation can undermine the economic performance of weak and unstable states, thereby aggravating destabilisation, the collapse of social systems and violent conflicts. The shortfall in the agriculture produce that is bound to be the result would affect not only the respective country but the entire globe. In addition to the glacial melt the rapidly melting Arctic ice and permafrost, is also a cause for concern. The increasing levels of sea is driving the anxiety levels of coastal populace and smaller island nations like Maldives are already looking at the prospect of searching for an alternate country to live. The glaciers on the Tibetan plateau are the source of Asia’s biggest rivers, including the Brahmaputra, the Indus, the Sutlej and several of the northern tributaries of the Ganges that irrigate the subcontinent. Geopolitically the source of most of these rivers, except the main Ganges, lies in China. On the other hand, the melting of the Himalayan glaciers as a result of the rise in the earth’s temperature will first increase the drainage through the major river systems into the ocean, followed by reduction in the their volumes once the glaciers begin to disappear. It is projected that some of the mightiest Himalayan Rivers might end up as seasonal, monsoon-fed rivers like those in southern India. Towards the southern tip of India, the problem of Lakshadweep island loosing land mass is yet another cause for concern. Serious security repercussions of such occurrences are obvious. For example the reduced seasonal flow of Indus River water is fast becoming a hotspot of concern between India and Pakistan. Rising Sea Levels: India is definitely a country facing huge challenges, especially due its rapid demographic development. But also with respect to the environmental context as the outcomes of human economic activity cannot be limited in a singular region. In other words, there will be further obstacles with regards to prospective development caused by global warming. West Bengal, for instance, is a region that is somewhat situated above sea level. In addition, the neighbouring country of Bangladesh will also be affected by rising sea level in the ongoing 21st century. The Fourth Assessment Report of the Intergovernmental Panel on Climate Change (IPCC) clearly established that warming of the climate system was ‘unequivocal’ and if the annual emission of Greenhouse gases remains are today’s levels, by 2050 it will be 550 parts per million. This means a potentially catastrophic mean global temperature increase of 5 degree Celsius. The United Nations’ Intergovernmental Panel on Climate Change (IPCC) estimates that sea-level will rise 9 to 88 cm by the year of 2100 with a 50 per cent probability of sea-level rising to 45 cm (Thomas, 1991). That would imply seas rising and submerging half of Bangladesh. Glaciers would melt, leading first to floods and then droughts as river run dry. There would be more dengue, more malaria, and more diarrhea (Narottam, 2003). The rise in global sea levels—due to the melting of polar ice caps and glaciers around the world—is expected to result in the submergence of low lying areas: including river deltas, coastlines and small islands. These places highly populated regional cities like Karachi, Dhaka, Mumbai, Kochi and Mangalore at risk. The entire country of Maldives could disappear under the Indian Ocean by the middle of the century. In addition, the coastline could advance inland across several heavily populated parts of Bangladesh, Sri Lanka, Myanmar and Pakistan (as indeed, several parts of India). A gradual loss of land in the Ganga-Brahmaputra Delta due to the rising sea is displacing migrants in large

6


numbers leading to illegal migration- yet another area of concern. Climate change could potentially trigger large-scale displacement and migration from one region to another. The 2001 World Disasters Report estimated that there were currently 25 million “environmental refugees.” It is estimated by IPCC that by 2050, 150 million people could become climate refugees, being displaced by sea level rise (SLR), desertification, increasing water scarcity, floods and storms, etc. The potential for large-scale migrations of people–both within countries and across borders– has been described as ‘perhaps the most worrisome problems associated with rising temperatures and sea levels which could easily trigger major security concerns and spike regional tension (Kurt, et al, 2007).’ On the other hand the local politicians got an opportunity to strengthen their vote banks by sympathizing with these so called migrants for their short term gains ignoring the long term damage that would be caused to the already poverty stricken country. Indian Governments during their successive tenures also turned a blind eye to this brewing up problem which ultimately was eating up into its resources, employment opportunities, health, literacy and above all acting as the gravest internal security threat. Extreme Weather and Water Resources: Global warming is causing the melting of glaciers in the Himalayas. In the short term, this means increased risk of flooding, erosion, mudslides and GLOF in Nepal, Bangladesh, Pakistan, and north India during the wet season. Because the melting of snow coincides with the summer monsoon season, any intensification of the monsoon and/or increase in melting is likely to contribute to flood disasters in Himalayan catchments. In the longer term, global warming could lead to a rise in the snowline and disappearance of many glaciers causing serious impacts on the populations relying on the 7 main rivers in Asia fed by melt water from the Himalayas. Throughout Asia one billion people could face water shortage leading to drought and land degradation by the 2050 (Christensen et al., 2007; Cruz et al., (2007). As the supply of water shrinks due to glacial melting, overuse of rivers, and the increase of droughts, “competition for limited supplies can lead nations to seek access to water as a matter of national security” (http://www.jstor.org/pss/2539033). International water shortages have the possibility of raising international conflicts driven by intensifying demand over the decreasing availability of water due to loss of glaciers, overuse of rivers, and the increase of droughts. Due to glacial melting, changing weather patterns, droughts, decreased rainfall, and over-consumption of water supplies, water shortages will likely occur in many regions of the world in the near future (www.greenpeace.org/.../climate-change/.../health_food_water). Climate change worsens water quality and availability in regions with water scarcity. Currently, 1.1 billion people are without access to safe drinking water. 120 million to 1.2 billion will experience increased water stress by the 2020s in South and South East Asia. More than 3.5 million people die each year from water-related disease; 84% of them are children. Nearly all deaths -- 98% -are in the developing world. This crisis may in turn fuel existing internal or inter-state conflicts and social conflict and it is feared that unresolved water issues could trigger Indo-Pak conflict, which would have unpredictable consequences internationally (http://www.thedailystar.net/newDesign/ news- details.php? nid=198040). The impact of climate change on water resources and livelihoods in the greater Himalayas is very worrisome. Rising temperatures lead to less precipitation in the form of snow. This reduces the snow cap and also in a longer-term causes reduction in the size of glaciers. This in turn influences very seriously the discharge of water in the pre monsoon period. The rivers carry less water. More water in summer and less in winter have to be expected. The consequence in the mountains is increased vulnerabilities in the form of flash floods and landslides. Less water in the pre monsoon period will affect the availability of water for irrigation and will affect food security (http://www.countercurrent.org/nazareth220110.htm). Mumbai and the backwaters of Kerala are threatened by rising sea level. Last-mentioned region (backwaters of Kerala) is a huge producer of crops thereby any land loss would have fatal effects on food security in this region (http://www.boelindia.org/web/index.html). In South Asia, hundreds of millions of people depend on perennial rivers such as the Indus, Ganges, and Brahmaputra – all fed by the unique water reservoir formed by the 16,000 Himalayan glaciers. The current trends in glacial melt suggest that the low flow will become substantially reduced as a consequence of climate change (IPCC 2007a). The effect of this on, for example, food production and economic growth is likely to be unfavourable. The situation may appear to be normal


7

in the region for several decades to come, and even with increased amounts of water available to satisfy dry season demands. However, when the shortage arrives, it may happen abruptly, with water systems going from plenty to scarce in perhaps a few decades or less. Some of the most populated areas of the world may “run out of water during the dry season if the current warming and glacial melting trends continue for several more decades” Flooding may also arise as a major development issue. It is projected that more variable, and increasingly direct, rainfall runoff will also lead to more downstream flooding. It is estimated that the retreat of glaciers will affect the water supply of roughly 750 million people across South Asia. According to Wendy Barnaby, editor of People and Science magazine, the United Nations issued a warning that climate change harbors the potential for serious conflicts over water. Therefore, climate change will likely:  Decrease natural water storage capacity from glacier and snowcap melting, and subsequently reduce long-term water availability for more than one-sixth of the world’s population that lives in glacier- or snowmelt-fed river basins in South Asia.  Increase water scarcity due to changes in precipitation patterns and intensity. In particular, the subtropics and mid-latitudes, where much of the world’s poorest populations live, are expected to become substantially drier, resulting in heightened water scarcity (Meehl et. al., 2007).  Increase the vulnerability of ecosystems due to temperature increases, changes in precipitation patterns, frequent severe weather events, and prolonged droughts. This will further diminish the ability of natural systems to filter water and create buffers to flooding.  Affect the capacity and reliability of water supply infrastructure due to flooding, extreme weather, and sea level rise. Most existing water treatment plants and distribution systems were not built to withstand expected sea level rise and increased frequency of severe weather due to climate change (Corinne et al., 2008).  Furthermore, climate change will concentrate snowmelt and precipitation into shorter time frames, making both water releases more extreme and drought events more sustained. Current infrastructure often does not have the capacity to fully capture this larger volume of water, and therefore will not be able to meet water demands in times of sustained drought. These scenarios have the potential, to degenerate into an international conflict though the timelines cannot be predicted with any certainty. With worsening of water, land and food situation, and its impact upon the vulnerable populations of weak nations, not only affect the neighbouring states but even the far off countries of the West would face the heat of climate change induced large scale migrations from Bangladesh and Maldives etc. The river sharing agreements between nations is already under tremendous stress, in addition wherever the fault lines exists these stresses are further concentrated forcing countries to approach the World Bank seeking intervention on sharing of river waters. At this juncture, it is crucially important to recognise that climate change is pervasive and has more security implications than any other threat today. Climate-induced challenges should be placed at the core of security considerations in a rapidly changing world. Hence, effective international cooperation, as advanced by the UN Security Council, should be formed to address the unpredictable security consequences of climate change. Water Issues: Conflict or Cooperation: Water is a symbol of life. It is crucial for maintaining environment and ecosystem conducive to sustaining all forms of life. Humanity is facing “water bankruptcy” as a result of a crisis even greater than the financial meltdown now destabilising the global economy. Rapid population and economic growth in India in the last 50 years have placed significant pressure on the country’s fragile environment and water resources. The world’s freshwater supply is finite. Most of the world’s water about 97.5 percent exists as salt water in the oceans and seas. Of the world’s 2.5 percent of freshwater, roughly 99 percent is either trapped in glaciers and ice caps, held as soil moisture, or located in water tables too deep to access. Thus, only about one percent of the world’s total freshwater supply is readily available for consumption by humans, animals and for irrigation. With regard to water supplies, experts currently distinguish between the problems of water stress and water scarcity. Water stress occurs when a country’s annual water supplies drop below 1,700 cubic meters per person. When these levels reach between 1,700 and 1,000 cubic meters per person, occasional water shortages are likely to occur. However, when water supplies drop below

8


1,000 cubic meters per person, the country faces water scarcity which can threaten food production, undermine economic development, and harm ecosystems (Solutions for a Water-Short World, 1998). Nepal, India and Bangladesh have seen their total water resources and water availability drop steadily over the last few decades. In the next two to four decades, these numbers are expected to fall further, reaching dangerous and potentially unsustainable levels in some of the countries. All the three countries of South Asia will face depletion of freshwater resources on account of climate change, disruptive precipitation and other natural factors, without considering pollution and demand management inefficiency. At the same time, they will witness growth of their population. Today, more than 31 countries around the world, representing about 8% of the world population, are facing chronic freshwater shortages (thus reaching the scarcity stage), and this number will likely grow to 45 countries by the year 2025. India’s population is expected to grow further, from 1.14 billion in 2008 to 1.4 billion by 2024. Increasing urban and industrial demands for water now compete with the already high water requirements of the agricultural sector, while deteriorating quality constrains stretched water supplies. There is fierce competition for water at many levels in India—between and within regions, between and among sectors of the economy, and permutations of the two.

In the geopolitical framework of resource security and insecurity, water is taken as a ‘good’ and conceptualised under the model of resource scarcity (The scarcity-conflict model is fast becoming conventional wisdom in foreign policy, 1999). The 'geo-politicisation of water' is associated with the ‘instrumentalisation of water’ and therefore the common usage of the term “water wars” (Water wars are a much hyped alliteration. Prediction of water wars seems to be sensationalist and alarmist.). Water thus becomes a resource (If water is seen as a 'source' (a source of life and without which nothing survives) then the entire perception changes from one of hostility over it to one of cooperation and sharing.) of contention and conflict is generally reduced to the question of who has the 'good' and how much, who needs and how much (or how much is needed), and thus what the affordable cost of 'procurement' of such a 'good' would be in economic, political or military terms. From an inter-state perspective, an analysis of water security would essentially entail an investigation as to why and when states choose to cooperate over water or why and when states tend to use water as a 'bargaining tool' and an 'instrument of politics'.


9

THE WORLD’S WATER RESOURCES

Saturday, October 15, 2016

12

Indeed, “Water in a Changing World” (The theme was introduced in the World Water Forum in Istanbul, 2009), will assume greater salience and as it does, the drivers impacting water resources, whether climate variability and security issues or electricity generation and migration, will need to be factored in and solutions searched for. A considerable amount of technical and scientific knowledge developed in the recent year’s points towards the potential of water scarcity becoming a key driver of tension and conflict within societies and states. The possibility of inter-state wars arising from waterrelated issues have been much talked and written about (In the early 1980s, Boutros-Boutros Ghali as Egyptian minister of state for foreign affairs said, “The next war in our region will be over the waters of the Nile.” In 1991, a few months before being appointed as the Secretary General of the United Nations, he reiterated, “the next war in the Middle East will be fought over water, not politics.” Thereon, 'water wars' as a dramatic alliteration was used in the article by Joyce Starr. In 1995, World Bank vice-president Ismail Serageldin made a much-quoted prediction about the future of war, “If the wars of this century were fought over oil, the wars of the next century will be fought over water.”). One can dispute such an alarmist prognosis. History tells us that the only recorded water war was some 4,500 years ago, when the two Mesopotamian city-states, Lagash and Umma, went to war. History also shows that, between 805 AD till now, countries have signed more than 3,600 waterrelated treaties (Transboundary Freshwater Dispute Database, Oregon University. http://www.transboundarywaters.orst.edu/database/ interfreshtreatdata.html). There thus seems to be more active cooperation over water than actual war. Those concerned with the water crisis and its future are divided essentially into two schools. One school indicates that water, as a source of conflict is more likely to be the case within countries than between them. It focuses on water as a source of cooperation and as an impetus for scientists and political leaders to use modern science and advanced technology to create new solutions and seek suitable alternatives (Aaron, 1998). The other school argues that water scarcity, as a source of conflict, will increasingly be inter-state in nature and examines one of the seven sutras requiring special makes it clear that “water resources have rarely been the sole cause of conflict” but should be viewed as a “function of the relationships among social, political, and economic factors, including economic development (Peter, 1993).” This school also evaluates the role of water as a tool and weapon (both political and military) in conflicts caused by other factors. Security practitioners need to take water issues into account as part of their arsenal of tools, and explore two primary questions: What role do water issues play in stimulating international conflict and cooperation? Are conflicts over water sharing likely to be more 'within' (intra-state) or

10


'between' states (inter-state)? The divide in terms of scope and focus is of obvious policy importance, particularly since threats emanating from water scarcity feature regularly in policy reports. Suggestions 1. Reducing Scientific Uncertainty Develop Scientific Programmes for Climate Change Monitoring: Credible, up-to-date scientific knowledge is essential for the development of a climate change policy, including adaptation and mitigation measures. It is essential to develop a scientific basis, in collaboration with government agencies and academia. Remote sensing allows for regular and repeated monitoring of snow cover, which can be carried out by countries of South Asian Region. Studies need to include both groundbased and satellite-based monitoring. Well-equipped stations and long-term monitoring, networking, and cooperation within and outside the region are essential. Local communities can play a role in determining adaptation practices based on local information and knowledge. School science programmes can be developed and introduced in local communities. 2. Mitigation Measures: With rapid regional economic growth, China and India, in particular, should accept equal, albeit differentiated, responsibility to developed countries for controlling increasing carbon emissions. Countries should jointly develop a regional action plan for the control of emissions. Participation of all countries has to be achieved by allowing them to interpret the mandates of international agreements according to their national interests and priorities. a) Land-use Management for Carbon Sinks and Reduced Emissions: Many countries in the Himalayas have experienced forest recovery (or transition), through policy intervention and the participation of local communities in forest management. b) Payment for Ecosystem Services (PES): The Mountains of the greater Himalayas provide abundant services to the downstream population in terms of water for household purposes, agriculture, hydropower, tourism, spiritual values, and transport. There is a heavy responsibility leaning on the shoulders of upstream land and water managers to ensure reliable provision of good quality water downstream. PES schemes can be developed at different scales, from local to national to regional, and involve local communities, governments, and the private sector. So far, the opportunities to establish PES schemes in the Himalayas to ensure safe provision of good quality water remain largely unexplored. However, land and water managers, as well as policy and decision makers, should be encouraged to look for win-win solutions in this context. c) Development of Alternative Technologies: Novel and affordable technologies and energy resources that do not emit greenhouse gases are needed. Notable examples in the region include the diffusion of hydropower in Bhutan, solar energy and biogas in China, bio-diesel and wind energy in India, and biogas and micro-hydropower in Nepal. 3. Adaptation Measures a) Disaster Risk Reduction and Flood Forecasting: Floods are the main natural disaster aggravating poverty in the Himalayas and downstream. Technical advances in flood forecasting and management offer an opportunity for regional cooperation in disaster management. Regional cooperation in trans-boundary disaster risk management should become a political agenda. Preparedness for disasters is essential. b) Supporting Community-led Adaptation: One approach to vulnerability and local level adaptation is ‘bottom-up’ community-led processes has built on local knowledge, innovations, and practices. The focus should be on empowering communities to adapt to a changing climate and environment based on their own decision-making processes and participatory technology development with support from outsiders c) National Adaptation Plans of Action (NAPAs): NAPAs are currently being prepared by countries under the initiative of the UN Framework Convention on Climate Change. They are expected (a) to identify the most vulnerable sectors to climate change and (b) to priorities activities for adaptation measures in those sectors. NAPAs need to pay more attention to sectors such as water, agriculture, health, disaster reduction, and forestry, as well as the most vulnerable groups. d) Integrated Water Resources Management: Disaster preparedness and risk reduction should be seen as an integral part of water resources management. Integrated water resources management (IWRM) should have include future climate change scenarios and are scaled up from watersheds


11

to river basins. Water allocation for households, agriculture, and ecosystems deserves particular attention. Water storage, based on local practices, should be encouraged in mountain regions. 4. Public Awareness and Engagement a) Full Disclosure and Prior Information for Grassroots Societies: Indigenous and local communities should be fully informed about the impacts of climate change. They have a right to information and materials in their own languages and ways of communicating. b) Engagement of the Media and Academia: Awareness and knowledge among stakeholders generally about the impacts of global warming and the threat to the ecosystem, communities, and infrastructure are inadequate. The media and academia together can play a significant role in public education, awareness building, and trend projection. c) Facilitation of International Policy Dialogue and Cooperation: Regional and international cooperation needs to advance in order to address the ecological, socioeconomic, and cultural implications of climate change in the Himalayas. The international community, including donors, decision-makers, and the private and public sectors, need to be involved in regional cooperation ventures. This is of particular importance for achieving sustainable and efficient management of trans-boundary Rivers. Conclusion: Humanity is facing “water bankruptcy” as a result of a crisis even greater than the financial meltdown now destabilising the global economy. Only cooperation among the countries of South Asia can reduce the imminent natural disasters and the consequent man made conflicts. The threat of climate change is not one that can be met or managed through traditional military security. Armies cannot be amassed, barriers cannot be built and weapons cannot be deployed against a threat that is indiscriminate and global in its scope. We need to move towards the idea of ‘sustainable security’. We owe it to the world’s poor and to future generations to act with resolve and urgency to stop dangerous climate change. The good news is that it is not too late. You have a choice to SAVE THE EARTH to “take a pledge today to adopt the strategies to reduce climate change and let’s all join in the effort to make the earth smile again”. Thus, there needs to be recognition that water insecurity (in the form of water stress or water scarcity) is not an isolated problem. Its effects can extend to human, national, regional and international security. Consequently, governments in the South Asian region should encourage and promote more effective conservation efforts, greater environmental awareness, and the recognition that all people have a basic need and right to clean freshwater. References Aaron Wolf. (1998). Conflict and Cooperation along International Waterways, Water Policy, 1(2), , pp. 252-65; Alsom Sandra Postel and Aaron Wolf, (2001) “Dehydrating Conflict”, Foreign Policy, September/October, pp. 60-67.Wolf coordinates the Transboundary Freshwater Dispute Database, Oregon University, which includes a computer database of over 400 water related treaties, negotiating notes and background material on 14 case-studies of conflict resolution, news files on cases of acute water-related conflict, and assessments of indigenous/traditional methods of water conflict resolution. Brahma Chellaney. (2007). Climate Change and Security in Southern Asia: Understanding the National Security Implications, RUSI Journal, April, Vol. 152, No. 2, available at http://chellaney.spaces.live.com/blog/cns! 4913C7C8A2EA4A30! 254. entry, accessed on 6 April 2008) Christensen, et al. (2007). Cruz, et al. (2007). http://unfccc.int/resource/docs/publications/impacts.pdf Christensen, J.H., B. Hewitson, et al. (2007). Regional Climate Projections, Climate Change: The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change [Solomon, S., D. Qin, M. Manning, Z. Chen, M. Marquis, K.B. Averyt, M. Tignor and H.L. Miller (eds.)]. Cambridge University Press, Cambridge, United Kingdom and New York, USA, Pp. 854 Corinne J. Shuster-Wallace, et al. (2008). Safe Water as the Key to Global Health, United Nations University , International Network on Water, Environment and Health, http://assets.panda.org/downloads/himalayaglaciersreport2005.pdf http://www.boel-india.org/web/index.html http://www.boel-india.org/web/index.html http://www.copenhagen.globeinternational.org/includes/documents/cm_docs http://www.copenhagen.globeinternational.org/includes/documents/cm_docs 2009 http://www.copenhagen.globeinternational.org/includes/documents/cm_docs 2009 http://www.countercurrent.org/nazareth220110.htm http://www.dnaindia.com

12


http://www.jstor.org/pss/2539033 http://www.thedailystar.net/newDesign/news-details.php?nid=198040 http://www.thedailystar.net/newDesign/news-details.php?nid=198040 ICIMOD. (2009). The Changing Mats Eriksson, Xu Jianchu, Arun Bhakta Shrestha, Ramesh Ananda Vaidya, Santosh Nepal, Klas Sandström, Kathmandu, Nepal. IPCC, Climate Change. (2007). Synthesis Report. Contribution of Working Groups I, II and III to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change [Core Writing Team, Pachauri, R.K and Reisinger, A. (eds.)], IPCC, Geneva, Switzerland. IPCC. (2007a). Climate Change 2007: The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change [Solomon, S; Qin, D; Manning, M; Chen, Z; Marquis, M; Averyt, KB; Tignor, M; Miller, HL (eds)]. Cambridge and New York: Cambridge University Press. Kaul, M.K. (1999). Inventory of Himalayan Glaciers, Geological Survey of India, Spl. Pub. 34. Kurt, M., Campbell, et al. (2007). The Age of Consequences: The Foreign Policy and National Security Implications of Global Climate Change (Washington DC: Centre for Strategic and International Studies/Centre for a New American Security, p.8 Mathews, J. T. (1989). Redefining Security, Foreign Affairs 68: 2, 162–77; M. A. Levy, (1995) ‘Is the Environment a National Security Issue?’, International Security 20, 35–62. Meehl, et. al. (2007). Climate Change 2007: The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. Narottam Gann. (2003). Environmental Security: An Appendage to Geo-political World Order of the United States. BIISS Journal (Dhaka), vol. 24, 3, 428. Peter Glieck. (1993). Water and Conflict: Fresh Water Resources and International Security, International Studies, 1, p. 92, also “Water, War and Peace in Middle East”, Environment, 36, 1994. Glieck heads the Pacific Institute for Studies in Development, Environment and Security, Oakland, California. See http://www.pacinst.org/ Qin, DH (2002) Glacier inventory of China (maps). Xi’an: Xi’an Cartographic Publishing House. Report of Center for Naval Analysis USA (C N A) April, 2007 Solutions for a Water-Short World (1998). Population Reports, vol. 26, no. 1. The scarcity-conflict model is fast becoming conventional wisdom in foreign policy, population and environment circles, structured by the likes of Stephan Liviszevski and Homer-Dixon and popularised and sensationalised by writers like Michael Renner, (1999) “Ending Violent Conflict”, World Watch Paper 146, and Robert Kaplan, (1994) “The Coming Anarchy”, Atlantic Monthly, February, pp. 44-76. Kaplan proclaimed the environment as the most important national security issue of the 21st century. The theme was introduced in the World Water Forum in Istanbul, March 2009 The Tribune, November11, 2008 Thomas F. Homer-Dixon. (1991). On Threshold: Environmental Changes as Causes of Acute Conflict, International Security, Vol.16, no.2, p.77. Thomas F. Homer-Dixon. (1991). On Threshold: Environmental Changes as causes of Acute Conflict, International Security, 16, no.2, p.109. Transboundary Freshwater Dispute Database, Oregon University. http://www.transboundarywaters.orst.edu/ database/interfreshtreatdata.html Vohra, C.P. (1978). Glacier Resources of the Himalaya and their Importance to Environment Studies, Proc. Nat. Sem. on Resources Development and Environment in Himalaya Region, DST, pp441-460. www.greenpeace.org/.../climate-change/.../health_food_water

CLIMATE CHANGE: IMPLICATION, ADAPTATION AND MITIGATION ON AGRICULTURE V. K. Verma, Gaurav, Abhishek Singh, Shudhanshu Verma Department of Agronomy, Instititute of Agricultural Sciences, Banaras Hindu University Varanasi- 221 005 (U.P.) India, Email: [email protected], Corresponding Author: V. K. Verma

A

changing climate will affect agro-ecosystems in heterogeneous ways, with either benefits or negative consequences dominating in different agricultural regions (Fig. 1). However, the factors that prevail regionally may change over time, as gradual and possibly abrupt climate changes develop in this century. Rising atmospheric CO2 concentration, higher temperature, changing patterns of precipitation, and altered frequencies of extreme events will have significant effects on crop production, with associated consequences for water resources and pest/disease distributions. Fig. 1 Agro-ecosystem processes and a changing climate (from: Bongaarts 1994) 856 Mitigation Adaptation Strat Global Change (2007) 12:855–873

Today’s agriculture is at a crossroads. Climate change is already calculated to be having a negative impact on food production in some areas of the world (Lobell, 2011) while there are expectations for the sector to meet a rise in demand by 70 to 100% (FAO, 2011) within the next 40 years.Climate change refers to any significant change in the measurement of climate lasting for an extended period of time. Over the past century, human activities have released large amounts of carbon dioxide (CO2) and other greenhouse gases into the atmosphere. Major greenhouse gases are generated from burning fossil fuels. Deforestation, industrial processes, and some agricultural practices also emit gases into the atmosphere. As a result, average global temperatures increased by 0.74ºC during 1906 – 2005, and a further increase of 0.2ºC to 0.4ºC in the next 20 years is expected (IPCC). Small changes in the average temperature of the planet can translate to large and potentially dangerous shifts in climate and weather. Many places have seen variations in rainfall - resulting in more droughts or intense rain and more floods, as well as more frequent and severe heat waves (IPCC Reports). Climate change refers to a change in the state of the climate that can be identified (using statistical tests) by changes in the mean and/or the variability of its properties, which persist for an extended period, typically decades or longer.The world’s climate is changing, and the changes will have an enormous impact on people, ecosystems, and energy use. According to the latest report of the Intergovernmental Panel on Climate Change (IPCC), average global temperature is likely to rise by another 2 to 8.6 degrees F by 2100. Further UNEP (2015) reported that there is alarming evidence that important tipping points, leading to irreversible changes in major ecosystems and the planetary climate system, may already have been reached or passed. It is a growing crisis with economic, health and safety, food production, security, and other dimensions. The shifting weather pattern has threatened food production and food security on the globe. At the end of this century, different locations will experience different levels of increases in temperature, with the greatest impact toward the North Pole and the least increase toward the South Pole and in the tropics.Many potential agricultural adaptation options have been suggested, representing measures or practices that might be adopted to alleviate expected adverse impacts. They encompass a wide range of forms (technical, financial, managerial), scales (global, regional, local) and participants (governments, industries, farmers) (Smithers and Smit 1997; Skinner et al. 2001)

14


Table 1: Predicted effects of climate change on agriculture over the next 50 years Climatic Expected changes by 2050's Confidence in element prediction CO2 Increase from 360 ppm to 450 - 600 ppm Very high (2005 levels now at 379 ppm) Mean Sea level Rise by 10 -15 cm Increased in south and Very high rise offset in north by natural subsistence/rebound Temperature Rise by 1-2oC. Winters warming more High than summers. Increased frequency of heat waves Precipitation

Storminess Variability

Effects on agriculture

Good for crops: increased photosynthesis; reduced water use Loss of land, coastal erosion, flooding, salinization of groundwater Faster, shorter, earlier growing seasons, range moving north and to higher altitudes, heat stress risk, increased evapotranspiration Seasonal changes by ± 10% Low Impacts on drought risk' soil workability, water logging irrigation supply, transpiration Increased wind speeds, especially in north. Very low Lodging, soil erosion, reduced More intense rainfall events. infiltration of rainfall Increases across most climatic variables. Very low Changing risk of damaging events Predictions uncertain (heat waves, frost, droughts floods) which effect crops and timing of farm operations Source: Climate change and Agriculture, MAFF (2000)

Current projections, from the 4th assessment reported by the IPCC published in 2007, suggest that global temperatures will rise between 1.80C and 4.0 0C (best estimate) by 2100 depending on emissions of greenhouse gases and that global sea levels are likely to rise from anywhere between 180mm and 590 mm. India’s agriculture is more dependent on monsoon from the ancient periods. Any change in monsoon trend drastically affects agriculture. Even the increasing temperature is affecting the Indian agriculture. In the Indo-Gangetic Plain, these pre-monsoon changes will primarily affect the wheat crop (>0.5oC increase in time slice 2010-2039; IPCC 2007). In the states of Jharkhand, Odisha and Chhattisgarh alone, rice production losses during severe droughts (about one year in five) average about 40% of total production, with an estimated value of $800 million (Pandey, 2007). Increase in CO2 to 550 ppm increases yields of rice, wheat, legumes and oilseeds by 10-20%. Crop Response to Changing Climate: Plant response to climate change is dictated by a complex set of interactions to CO2, temperature, solar radiation, and precipitation. Each crop species has a given set of temperature thresholds that define the upper and lower boundaries for growth and reproduction, along with optimum temperatures for each developmental phase. Plants are currently grown in areas in which they are exposed to temperatures that match their threshold values. As temperatures increase over the next century, shifts may occur in crop production areas because temperatures will no longer occur within the range, or during the critical time period for optimal growth and yield of grain or fruit. For example, one critical period of exposure to temperatures is the pollination stage, when pollen is released to fertilize the plant and trigger development of reproductive organs, for fruit, grain, or fibre. Such thresholds are typically cooler for each crop than the thresholds and optima for growth. Pollination is one of the most sensitive stages to temperatures, and exposure to high temperatures during this period can greatly reduce crop yields and increase the risk of total crop failure. Plants exposed to warm nighttime temperatures during grain, fibre, or fruit production also experience lower productivity and reduced quality. Increasing temperatures cause plants to mature and complete their stages of development faster, which may alter the feasibility and profitability of regional crop rotations and field management options, including double-cropping and use of cover crops. Faster growth may create smaller plants, because soil may not be able to supply water or nutrients at required rates, thereby reducing grain, forage, fruit, or fibre production. Increasing temperatures also increase the rate of water use by plants, causing more water stress in areas with variable precipitation. Estimated reductions in solar radiation in agricultural areas over the last 60 years are projected to continue due to increased cloud cover and radiative scattering caused by atmospheric aerosols. Such reductions may partially offset the temperature-induced acceleration of plant growth. For vegetables, exposure to temperatures in the range of 1°C to 4°C above optimal for biomass growth moderately reduces yield, and exposure to temperatures more than 5°C to 7°C above optimal often leads to severe, if not total, production losses.

Climate Change: Implication, Adaptation and Mitigation on Agriculture

15

Climate Change on Soil and Water: Climate change effects on agriculture also include the effects of changing climate conditions on resources of key importance to agricultural production, such as soil and water. Seasonal precipitation affects the potential amount of water available for crop production, but the actual amount of water available to plants also depends upon soil type, soil water holding capacity, and infiltration rate. Healthy soils have characteristics that include appropriate levels of nutrients necessary for the production of healthy plants, moderately high levels of organic matter, a soil structure with good aggregation of the primary soil particles and macro-porosity, moderate pH levels, thickness sufficient to store adequate water for plants, a healthy microbial community, and absence of elements or compounds in concentrations toxic for plant, animal, and microbial life. Several processes act to degrade soils including, erosion, compaction acidification, salinization, toxification, and net loss of organic matter. Several of these processes are sensitive to changing climate conditions. Changes to the rate of soil organic matter accumulation will be affected by climate through soil temperature, soil water availability, and the amount of organic matter input from plants. Erosion is of particular concern. Changing climate will contribute to the erosivity from rainfall, snowmelt, and wind. Rainfall’s erosive power will increase if increases in rainfall amount are accompanied by increases of intensity. Shifts of rainfall intensity have begun to occur in the United States with more extreme events expected for the future. Although there is a general lack of knowledge about the rates of soil erosion associated with snowmelt or rain-on-thawing-soil erosion, if decreased days of snowfall translate to increased days of rainfall, erosion by storm runoff is likely to increase. Climate Change and its Implication on Agricultural Productivity Changes in Mean Climate: The nature of agriculture and farming practices in any particular location are strongly influenced by the long-term mean climate state—the experience and infrastructure of local farming communities are generally appropriate to particular types of farming and to a particular group of crops which are known to be productive under the current climate. Changes in the mean climate away from current states may require adjustments to current practices in order to maintain productivity, and in some cases the optimum type of farming may change. Higher growing season temperatures can significantly impact agricultural productivity, farm incomes and food security (Battisti& Naylor 2009). In mid and high latitudes, the suitability and productivity of crops are projected to increase and extend northwards, especially for cereals and cool season seed crops (Maracchi et al. 2005; Tuck et al. 2006; Olesen et al. 2007). Impacts on Crops

Despite technological improvements that increase corn yields, extreme weather event have caused significant yield reduction in some years. Source: USGCRP (2009) For any particular crop, the effect of increased temperature will depend on the crop's optimal temperature for growth and reproduction (Hatfield et al. 2014). In some areas, warming may benefit the types of crops that are typically planted there, or allow farmers to shift to crops that are currently grown in warmer areas. Conversely, if the higher temperature exceeds a crop's optimum temperature, yields will decline. Higher CO2 levels can affect crop yields. Some laboratory experiments suggest that elevated CO2 levels can increase plant growth. However, other factors, such as changing temperatures, ozone, and water and nutrient constraints, may counteract these potential increases in yield. For example, if temperature exceeds a crop's optimal level, if sufficient water and nutrients are not available, yield increases may be reduced or reversed. Elevated CO2 has been associated with

16


reduced protein and nitrogen content in alfalfa and soybean plants, resulting in a loss of quality.Though rising CO2 can stimulate plant growth, it also reduces the nutritional value of most food crops. Rising levels of atmospheric carbon dioxide reduce the concentrations of protein and essential minerals in most plant species, including wheat, soybeans, and rice. This direct effect of rising CO2 on the nutritional value of crops represents a potential threat to human health. Human health is also threatened by increased pesticide use due to increased pest pressures and reductions in the efficacy of pesticides.Dealing with drought could become a challenge in areas where rising summer temperatures cause soils to become drier. Although increased irrigation might be possible in some places, in other places water supplies may also be reduced, leaving less water available for irrigation when more is needed. Impacts on Fisheries: The ranges of many fish and shellfish species may change. In waters off the north-eastern United States, several economically important species have shifted northward since the late 1960s. The three species(American lobster, red hake, and black sea bass) have moved northward by an average of 119 milesUS EPA (2016). Many aquatic species can find colder areas of streams and lakes or move north along the coast or in the ocean. Some marine disease outbreaks have been linked with changing climate. Higher water temperatures and higher estuarine salinities have enabled an oyster parasite to spread farther north along the Atlantic coast. Winter warming in the Arctic is contributing to salmon diseases in the Bering Sea and a resulting reduction in the Yukon Chinook Salmon, Finally, warmer temperatures have caused disease outbreaks in coral, eelgrass, and abalone.Changes in temperature and seasons can affect the timing of reproduction and migration. Many steps within an aquatic animal's lifecycle are controlled by temperature and the changing of the seasons. For example, in the Northwest warmer water temperatures may affect the lifecycle of salmon and increase the likelihood of disease. Combined with other climate impacts, these effects are projected to lead to large declines in salmon populations CCSP (2008). In addition to warming, the world's oceans are gradually becoming more acidic due to increases in atmospheric carbon dioxide (CO2). Increasing acidity could harm shellfish by weakening shells, which are created by removing calcium from seawater. Acidification also threatens the structures of sensitive ecosystems upon which some fish and shellfish rely, US EPA (2015). Climate Variability and Extreme Weather Events: While change in long-term mean climate will have significance for global food production and may requireongoing adaptation, greater risks to food security may be posed by changes in year-to-year variabilityand extreme weather events. Historically, many of the largest falls in crop productivity have been attributedto anomalously low precipitation events (Kumar et al. 2004; Sivakumaret al. 2005). However, evensmall changes in mean annual rainfall can impact on productivity. Extreme Temperatures: Recent increases in climate variability may have affected crop yields in countries across Europe sincearound the mid-1980s (Porter & Semenov 2005) causinghigher interannual variability in wheat yields. Thisstudy suggested that such changes in annual yield variability would make wheat a high-risk crop in Spain. Even mid-latitude crops could suffer at very high temperatures in the absence of adaptation. In 1972, extremely high summer averaged temperature in the former Soviet Union (USSR) contributed towidespread disruptions in world cereal markets andfood security (Battisti& Naylor 2009).Changes in short-term temperature extremes can be critical, especially if they coincide with key stages ofdevelopment. Only a few days of extreme temperature(greater that 328C) at the flowering stage of many crops can drastically reduce yield (Wheeler et al.2000). Crop responses to changes in growing conditionscan be nonlinear, exhibit threshold responsesand are subject to combinations of stress factors thataffect their growth, development and eventual yield. Crop physiological processes related to growth suchas photosynthesis and respiration show continuousand nonlinear responses to temperature, while ratesof crop development often show a linear response totemperature to a certain level. Both growth and developmentalprocesses, however, exhibit temperatureoptima. In the short-term high temperatures canaffect enzyme reactions and gene expression. In thelonger term these will impact on carbon assimilationand thus growth rates and eventual yield. The impactof high temperatures on final yield can depend onthe stage of crop development. Drought: There are a number of definitions of drought, whichgenerally reflect different perspectives. Holton et al.(2003) point out that ‘the importance of drought liesin its impacts. Thus definitions


17

should be regionspecificand impact- or application-specific in order to be used in an operational mode by decision makers.’It is common to distinguish between meteorological drought (broadly defined by low precipitation), agriculturaldrought (deficiency in soil moisture, increased plant water stress), hydrological drought (reducedstreamflow) and socio-economic drought (balance ofsupply and demand of water to society; Holton et al.2003). Heavy Rainfall and Flooding: Food production can also be impacted by too much water. Heavy rainfall events leading to flooding can wipe out entire crops over wide areas, and excess water can also lead to other impacts including soil water logging, anaerobicity and reduced plant growth. Indirect impacts include delayed farmingoperations (Falloon& Betts in press) The proportion of total rain falling in heavy rainfall events appears to be increasing, and this trend is expected to continueas the climate continues to warm. A doubling of CO2 is projected to lead to an increase in intense rainfallover much of Europe. Other impact on agriculture productivity by climate change Increase Pests and Diseases: Rising atmospheric CO2 and climate change may alsoimpact indirectly on crops through effects on pests anddisease. These interactions are complex and as yet thefull implications in terms of crop yield are uncertain. Indications suggest that pests, such as aphids (Newman 2004) and weevil larvae (Staley & Johnson2008). Over the next 10–20 years, disease affecting oilseed rapecould increase in severity within its existing range as well as spread to more northern regions where atpresent it is not observed (Evans et al. 2008). Changesin climate variability may also be significant, affectingthe predictability and amplitude of outbreaks. Mean Sea-level Rise: Sea-level rise is an inevitable consequence of a warming climate owing to a combination of thermalexpansion of the existing mass of ocean water and addition of extra water owing to the melting of landice. This can be expected to eventually cause inundation of coastal land, especially where the capacity forintroduction or modification of sea defences is relatively low or nonexistent. Regarding cropproductivity, vulnerability is clearly greatest where large sea-level rise occurs in conjunction withlow-lying coastal agriculture. Many major river deltas provide important agricultural land owing to the fertility of alluvial soils, and many small island states are also lowlying. Increases in mean sea level threaten to inundateagricultural lands and salinize groundwater in the coming decades to centuries, although the largestimpacts may not be seen for many centuries owing to the time required to melt large ice sheets and forwarming to penetrate into the deep ocean. Adapting to Climate Change: Adapting agricultural systems to climate change is urgent because its impact is already evident and the trends will continue even if emissions of GHG emissions are stabilized at current levels. Adaptation can substantially reduce the adverse economic impact. Farmers are already adapting. According to recent survey data from 11 African countries, they are planting different varieties of the same crop, changing planting dates, and adapting practices to a shorter growing season. 8 But in some countries more than a third of all households that perceive greater climate variability or higher temperatures report no change in their agricultural practices. Barriers to adaptation vary by country, but for many the main reported barrier is the lack of credit or savings. Farmers in Ethiopia, Kenya, and Senegal also point to the lack of access to water. In countries with severe resource constraints, farmers will not be able to adapt to climate change without outside help. And the poor will need additional help in adapting, especially where costs are higher. The public sector can facilitate adaptation through such measures as crop and livestock insurance, safety nets, and research on and dissemination of flood-, heat-, and drought resistant crops. New irrigation schemes in dryland farming areas are likely to be particularly effective, especially when combined with complementary reforms and better market access for high-value products. But greater variability of rainfall and surface flows needs to be taken into account in the design of new irrigation schemes and the retrofitting of existing ones. The cost of modifying irrigation schemes, especially when those depend on glacial melt (as in the Andes, Nepal, and parts of China) or regulation of water flow by high-altitude wetlands, could run into millions if not billions of dollars. Better climate information is another potentially cost-effective way of adapting to climate change. The greater uncertainty from climate change can be best addressed through contingency planning across sectors. Many of the Least Developed Countries are preparing. National Adaptation Action Plans to identify immediate priorities to improve preparedness for climate change. Mainstreaming climate change in the broader economic agenda, rather than taking a narrow agricultural perspective, will be crucial in implementing these plans. The costs of adapting to climate

18


change—estimated at tens of billions of dollars in developing countries far exceed resources available, requiring significant transfers from industrial countries. Contributions to existing adaptation funds are $150 to $300 million a year. The international community needs to devise new mechanisms to provide a range of global public goods, including climate information and forecasting, research and development of crops adapted to new weather patterns, and techniques to reduce land degradation. Many of these measures are win-win, such as developing drought- and flood-tolerant varieties, improving climate information, or planning for hydrological variability in new irrigation investments. Because of the long time lag between the development of technologies and information systems and their adoption in the field, investments to support adaptation need to be developed now. Carbon taxes based on the polluter pays principle could be a major source of revenue for this. Actions Needed to Facilitate Adaptation Responses Climate Monitoring Efforts and Communication of Information: essential to convince farmers that climate changes projections are real and require response actions. Information services should include surveillance of pests, diseases and other factors of importance to production systems. Policies that Support Research, Systems Analysis, Extension Capacity, Industry and Regional Networks: need to be strengthened in order to provide managers with understanding, strategic and technical capacity to protect their enterprises. Investment in New Technical or Management Strategies: required so that, where existing technical options are inadequate, options necessary to respond to the projected changes become available. These include improved crop, forage, livestock, forest and fisheries germplasm. Training for New Jobs Based on New Land Uses, Industry Relocation and Human Migration: needed where climate impacts lead to major land use changes. This may be achieved through direct financial and material support, alternative livelihood options with reduced dependence on agriculture, community partnerships for food and forage banks, development of new social capital and information sharing, ensuring food aid and employment for the more vulnerable, and development of contingency plans. New Infrastructure, Policies and Institutions: may be needed to support the new management and land-use arrangements, such as investment in irrigation infrastructure and efficient water-use technologies, appropriate transport and storage infrastructure, revising land tenure arrangements and property rights, and establishing accessible, efficient markets for products, financial services including insurance, and inputs including seed, fertilizer and labour. Policy must maintain the capacity to make continuing adjustments and improvements in adaptation through “learning by doing” with targeted monitoring of adaptations to climate change and their costs, benefits and effects. Climate Change Mitigation–the Concept: IPCC (2007) defines Mitigation as the technological change and substitution that reduce resource inputs and emissions perunit of output. Although several social, economic and technological policies would produce an emission reduction, with respectto climate change, mitigation meansimplementing policies to reduce GHGemissions and enhance sinks. Barriers to Mitigation Maximum Storage: Carbon sequestration in soils or terrestrial biomass may saturate after 15 to 60 years, depending on management practice, management history and the system being modified. Reversibility: A subsequent change in management can reverse the gains made in carbon sequestration over a similar period of time. However, many agricultural mitigation options are not reversible, such as reduction in N2O and CH4 emissions, avoided emissions as a result of agricultural energy efficiency gains or substitution of fossil fuels by bioenergy. Uncertainty: Uncertainty about the complex biological and ecological processes in agricultural systems makes investors more wary of land-based mitigation options compared to more clear-cut industrial mitigation activities. This barrier can be reduced by investment in research. In addition, high variability at the farm level can be reduced by increasing the geographical extent and duration of the project. Unclear Leakage: Adopting certain agricultural mitigation practices may reduce production within implementing regions, leading to increased production and emissions outside the project region. Transaction Costs: Under an incentive-based system such as a carbon market, the amount of money farmers receive is not the market price, but the market price less brokerage cost. This may be


19

substantial and a serious entry barrier for smallholders. Pooling many activities together can serve to lower transaction costs of participating farmers. Measurement and Monitoring Costs: Measurement costs per carbon credit sold decrease as the quantity of carbon sequestered and area sampled increase. Methodological advances in measuring soil carbon may reduce costs and increase the sensitivity of change detection. Development of remote sensing may offer opportunities to reduce costs. Property Rights: Property rights, landholdings and the lack of clear single-party land ownership in certain areas may inhibit implementation of management changes. Other Barriers: Other barriers include availability of capital, rate of capital stock turnover, rate of technological development, risk attitudes, need for research and outreach, consistency with traditional practices, pressure for competing uses of agricultural land and water, demand for agricultural products, high costs for certain enabling technologies. Key Mitigation Technologies in Agriculture  Improved crop and grazing land management to increase soil carbon storage;  Restoration of cultivated peaty soils and degraded lands;  Improved rice cultivation techniques and livestock and manure management to reduce CH4 emissions;  Improved nitrogen fertilizer application techniques to reduce N2O emissions;  Dedicated energy crops to replace fossil fuel use;  Improved energy efficiency  A large proportion of the mitigation potential of agriculture(excluding bio-energy) arises from soil carbon sequestration, which has strong synergies with sustainable agriculture and generally reduces vulnerability to climate change  Considerable mitigation potential is also available from reductions in methane and nitrous oxide emissions in some agricultural systems  Biomass from agricultural residues and dedicated energy crops can be an important bio-energy feedstock, but current concerns with food prices make this aquestionable alternative. Key Mitigation Technologies–Carbon Sinks in Forests  About 65% of the total mitigation potential (up to 100US$/tCO2-eq) is located in the tropics and about 50% of the total could be achieved by reducing emissions from deforestation.  Forest-related mitigation options can be designed and implemented to be compatible with adaptation, and can have substantial co-benefits in terms of employment, income generation, biodiversity and water shed conservation, renewable energy supply and poverty alleviation. Carbon Financing can Support Mitigation: The emerging market for trading carbon emissions offers new possibilities for agriculture to benefit from land uses that sequester carbon. The main obstacle to realizing broader benefits from the main mechanism for these payments—the Clean Development Mechanism (CDM) of the Kyoto Protocol—is its limited coverage of afforestation and reforestation. No incentives were included in the protocol for developing countries to preserve forests, despite the fact that deforestation contributes close to a fifth of global GHG emissions, largely through agricultural encroachment. Negotiations for the period after 2012 should correct this major fl aw. They could also explore credits for sequestration of carbon in soils (for example, through conservation tillage), for “green” bio fuels, and for agro forestry in agricultural landscapes. Incentives are also needed for investment in science and technology for low-emission technologies, such as cattle breeds that emit less methane. Remote satellite sensing to monitor results on the ground is a promising new approach. Conclusions  Climate change is widely considered to bone of the greatest challenges to modern human civilization that has profound socio economic and environmental impacts.  It is essential to develop a portfolio of strategies that includes adaptation, mitigation, technological development and research (climate science, impacts, adaptation and mitigation) to combat climate change  It is imperative on countries to take aproactive role in planning national andregional programmes on adaptation toclimate variability and climate change.

20




Integration of mitigation and adaptation frameworks into sustainable development planning is an urgent need, especially in the developing countries. References Battisti, D. S. & Naylor, R. L. (2009). Historical warnings offuture food insecurity with unprecedented seasonal heat. Science, 323: 240–244. CCSP. (2008). Preliminary Review of Adaptation Options for Climate-Sensitive Ecosystems and Resources. A Report by the U.S. Climate Change Science Program and the Subcommittee on Global Change Research.Chapter 3. Julius, S.H., J.M. West (eds.), J.S. Baron, B. Griffith, L.A. Joyce, P. Kareiva, B.D. Keller, M.A. Palmer, C.H. Peterson, and J.M. Scott (authors). U.S. Environmental Protection Agency, Washington, DC, USA. Clim. Change, 70: 31–72. Evans, N., Baierl, A., Semenov, M. A., Gladders, P. & Fitt, B. D. L. (2008). Range and severity of a plant diseaseincreased by global warming. J. R. Soc. Interface, 5: 525–531. Food and Agriculture Organization of the United Nations. (2011). The State of Food and Agriculture 2010– 2011. Available at http://www.fao.org/publications/sofa/en/. Hatfield, J., Takle, G., Grotjahn, R., Holden, P., Izaurralde, R. C., Mader, T., Marshall, E. and Liverman, D. (2014). Ch. 6: Agriculture. Climate Change Impacts in the United States: The Third National Climate Assessment, J. M. Melillo, Terese (T.C.) Richmond, and G. W. Yohe, Eds., U.S. Global Change Research Program, 150-174. Holton, J. R., Curry, J. A. & Pyle, J. A. (2003). Encyclopediaofatmospheric sciences. New York, NY: Academic Press. IPCC. (2007). Climate change 2007: the physical science basis.Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge, UK: Cambridge University Press. Kumar, K. K., Kumar, K. R., Ashrit, R. G., Deshpande, N. R. & Hansen, J. W. (2004). Climate impacts on Indianagriculture. Int. J. Climatol., 24, 1375–1393. Lobell, D.B.,W. Schlenker and J. Costa-Roberts. (2011). Climate Trends and Global Crop Production since 1980. Science, 333:616–620. Newman, J. A. (2004). Climate change and cereal aphids: the relative effects of increasing CO2 and temperature onaphid population dynamics. Global Change Biol., 10, 5–15. Porter, J. R. & Semenov, M. A. (2005). Crop responses to climaticvariation. Phil. Trans. R. Soc. B., 360: 2021– 2035. Sivakumar, M. V. K., Das, H. P. & Brunini, O. (2005). Impactsof present and future climate variability and change onagriculture and forestry in the arid and semi-arid tropics. Skinner, M.W., Smit, B., Dolan, A.H., Bradshaw, B. and Bryant, C.R. (2001). Adaptation Options to Climate Change in Canadian Agriculture: An Inventory and Typology, (Department of Geography Occasional paper No. 25.). Guelph: University of Guelph, 36 pp. Smithers, J. and Smit, B. (1997). Agricultural system response to environmental stress, in B. Ilbery, Q. Chiotti and T. Rickard (eds.), Agricultural Restructuring and Sustainability: A geographical perspective, Wallingford, CAB International, pp. 167–183 Staley, J. T. & Johnson, S. N. (2008). Climate change impactson root herbivores. In Root Feeders: an ecosystem perspective(eds S. N. Johnson & P. J. Murray). Wallingford, UK: CABI. US EPA. (2015). Climate Change in the United States: Benefits of Global Action: Shellfish. US EPA. (2016). Climate Change Indicators in the United States: A Closer Look: Marine Species Distribution. Wheeler, T. R., Craufurd, P. Q., Ellis, R. H., Porter, J. R. & Prasad, P. V. V. (2000). Temperature variability and the yieldof annual crops. Agric. Ecosyst. Environ., 82: 159–167.

PROTECTING FOOD SECURITY THROUGH MITIGATION OF CLIMATE CHANGE Sudhanshu Verma, Abhishek Singh, Swati Swayamprbha Pradhan, V.K. Verma, Shani Singh and S. B. Maurya Department of Agronomy, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi, India 221005, E-mail: [email protected], Corresponding Author: Sudhanshu Verma

C

limate change will affect all four dimensions of food security: food availability, food accessibility, food utilization and food systems stability. It will have an impact on human health, livelihood assets, food production and distribution channels, as well as changing purchasing power and market flows. Its impacts will be both short term, resulting from more frequent and more intense extreme weather events, and long term, caused by changing temperatures and precipitation patterns. In the long term, mitigating climate change will be critical to avoiding future breakdowns in food and livelihood systems and sharp increases in the number of food-insecure people worldwide. But food systems have enormous potential to mitigate climate change, however, particularly at the production end of the food chain. Investing in wider adoption of best practices for mitigation in the food and agriculture sector could therefore have multiple payoffs for food security, including contributing to the stability of global food markets and providing new employment opportunities in the commercial agriculture sector, as well enhancing the sustainability of vulnerable livelihood systems. Such practices include: reducing emissions of CO2, such as through reduction in the rate of land conversion and deforestation, better control of wildfires, adoption of alternatives to the burning of crop residues after harvest, reduction of emissions from commercial fishing operations, and more efficient energy use by forest dwellers, commercial agriculture and agro-industries; reducing emissions of methane and nitrous oxide, such as through improved nutrition for ruminant livestock, more efficient management of livestock waste and of irrigation water on rice paddies, more efficient applications of nitrogen fertilizer on cultivated fields, and reclamation of treated municipal wastewater for aquifer recharge and irrigation; sequestering carbon, such as through improved management of soil organic matter, with conservation agriculture involving permanent organic soil cover, minimum mechanical soil disturbance and crop rotation (which also saves on fossil fuel usage); improved management of pastures and grazing practices on natural grasslands, including by optimizing stock numbers and rotational grazing; introduction of integrated agroforestry systems: use of degraded, marginal lands for productive planted forests or other cellulose biomass for alternative fuels; and carbon sink tree plantings. According to the most recent data released by IPCC, clearing of forested area for agriculture accounted for 17.4 percent of total greenhouse gas emissions in 2000, with emissions from intensive crop and livestock production contributing another 13.5 percent. By contrast, studies carried out by the World Resources Institute (WRI) indicate that energy sector emissions attributable to agricultural and food processing use of fossil fuels account for only 2.4 percent of greenhouse gas emissions (WRI, 2006). In the United Kingdom, the Carbon Trust, established in 2001 with government funding, has promoted the concept of the “carbon footprint”. By undertaking a carbon investigation of their supply chains, all businesses can minimize the carbon emitted at every stage of a product’s life cycle, from source to shelf, consumption and disposal. The total amount of carbon emitted to arrive at a final product is that product’s carbon footprint (Carbon Trust). The carbon footprint of food processing and transport is negligible compared with the emissions generated by production processes in the food system. Therefore, although there are opportunities for reducing the carbon footprint of food at all stages of the food chain, the focus of mitigation efforts in the food system should be on introducing agricultural production practices that reduce emissions or increase carbon sequestration. 1. Reducing Emissions: Good options exist for reducing the current level of agriculture-related emissions and, in the process, introducing more sustainable farming practices that strengthen ecosystem resilience and provide more security for agriculture-based livelihoods in the face of increased climatic variability. These are discussed in the following sections.

22


A. Reducing Agricultural and Forestry Emissions of Carbon Dioxide: The primary source of carbon emissions in the food and agriculture sector is land conversion from forested area to cultivated or grazing land. Carbon emissions can be reduced through more efficient energy use by mechanized agriculture and agro-industries, and through adoption of alternatives to the common practice of burning crop residues after harvest. However, the amounts involved are minor compared with the potential contribution that reducing the rate of deforestation could make. Reduction in global forested area caused by land clearing and unsustainable logging (in which cut trees are not replaced with new plantings) has reduced the capacity of the world’s forests to store carbon. Evidence shows that Amazon deforestation, related to agricultural expansion for livestock grazing and the production of livestock feed and biofuel crops, already contributes substantially to global anthropogenic CO2 emissions (Carvalho et al., 2004). Continued intensification of the global livestock industry and growing demand for liquid biofuel crops will create additional pressure to clear tropical forests worldwide unless policies are put in place to manage the process sustainably. UNFCCC and the Kyoto Protocol recognize the potential role of forests in providing a variety of adaptive ecosystem services in addition to mitigating climate change through carbon sequestration. These services include biodiversity preservation, watershed protection on mountain slopes, control of desertification, and maintenance of the environmental integrity of fragile coastal zones. However, current rates of forest degradation and deforestation are threatening the capacity of the world’s forests to perform these multiple roles. The natural burning of trees and other organic matter releases CO2 into the atmosphere, while the decay of dead plants produces methane. These emissions of greenhouse gases are normally compensated for by the process of photosynthesis in living plants, especially the new vegetation that springs up on cleared land and needs CO2 in order to grow. In recent times, however, a still largely uncontrolled process of deforestation resulting from human activity has been altering this natural balance. Forests’ capacity to play their natural role in maintaining climatic stability is closely linked to food systems’ response to the challenge of climate change. The actions required include creating economic alternatives to reduce the incentive for clearing forests or using forest resources unsustainably, promoting second-generation biofuels to avoid land clearing for biofuel crops, and enforcing more strictly the regulations that discourage potential investors from setting wildfires to clear land for commercial development. Controlling frontier expansion in tropical rain forests can make an important contribution to climate change mitigation, but often the sole option for preserving forested area is through intensifying agricultural production on the better land. It has been demonstrated that when intensification involves increased fertilizer inputs, the related emission increases are far less than the avoided emissions of organic carbon from the forests that have been preserved (Vlek, Rodriguez-Kuhl and Sommer, 2004). Use of carbon offset schemes to pay rural households for sustainable management of the forested areas that they rely on for fuel and other forest products can provide the incentive to stop them cutting wood to sell as timber, fuelwood or charcoal. To be effective, however, this approach needs to be accompanied by public or private sector investment in alternative sources of timber and cooking fuel to meet the growing demand. B. Reducing Agricultural Emissions of Methane and Nitrous Oxide: Digestive processes and wastes from ruminant livestock that eat a great deal of fibrous material are an important source of methane, especially in intensive production units, where large numbers of animals are concentrated in relatively small spaces. Through the process of enteric fermentation, which is unique to ruminant animals such as cattle, sheep and goats, unused carbon is released in the form of methane during the digestion of fibrous materials in the diet. Methane emissions from animal manure are also considerable, and increasing rapidly. These two sources account for 60 percent of agricultural emissions of methane and about 30 percent of total anthropogenic methane emissions. The other main source of agricultural methane is rice, accounting for almost 40 percent of agricultural methane emissions and about 20 percent of all human-caused methane emissions (GHG Online a). Although nitrous oxide is a relatively less important greenhouse gas in terms of share, it is highly potent, and derives almost entirely from manure, cultivated soils that have been fertilized with organic matter or inorganic compounds containing nitrogen, and nitrogenfixing legumes. C. Reducing Methane Emissions from Ruminant Livestock: Methane emissions per animal and per unit of livestock product are high when the animals’ diet is poor (EPA Online). Range-fed beef cows are the most important source of methane compared with dairy cows; their diets, consisting mainly of forages of varying quality, are generally poorer than those in the dairy or feedlot sectors;

Protecting Food Security through Mitigation of Climate Change

23

the level of management is usually not as good; and the beef cow population is very large. Better grazing management and dietary supplementation have been identified as the most effective ways of reducing emissions from this sector because they improve animal nutrition and reproductive efficiency. The basic principle for methane reduction is to increase the digestibility of feedstuffs, by either modifying feed or manipulating the digestive process. Technically, these diets are relatively easy to improve through the use of feed additives or supplements. However, such techniques are often beyond the reach of smallholder livestock producers, who lack the capital, and sometimes the knowledge, to implement changes. Another approach is to increase the level of starch or rapidly fermentable carbohydrates in the diet, thereby reducing excess hydrogen and the subsequent formation of methane. Livestock fed on improved diets produce more milk and meat per animal. This increased production efficiency reduces the amount of methane emitted per unit of production and the size of the herd required to produce a given level of product. Because many developing countries are striving to increase production from ruminant animals (primarily milk and meat), improvements in production efficiency are urgently needed to meet goals while avoiding increase methane emissions. Technically speaking, the potential for efficiency gains – and therefore for methane reductions – is even larger for beef and other ruminant meat production, which is typically based on poorer management, including inferior diets. Relying more on non-ruminant sources of animal protein (pigs, poultry, fish) in the diet can mitigate emissions from enteric fermentation and contribute to food security by improving the livelihoods of livestock-dependent households and adding diversity to the diet. Most of the increase in demand for animal protein to 2030 and beyond is projected to occur in emerging developing countries in Asia, where pig and poultry meat is preferred, so the relative share of beef in total animal protein consumption is likely to decline over time. D. Reducing Methane Emissions from Rice: At between 50 and 100 million tonnes of methane a year, rice agriculture is a large source of atmospheric methane, possibly the greatest of the humanincurred methane sources. The warm, waterlogged soil of rice paddies provides ideal conditions for methanogenesis, and although some of the methane produced is usually oxidized by methanotrophs in the shallow overlying water, the vast majority is released into the atmosphere (GHG Online b). As the world population increases, reducing rice agriculture remains largely untenable as a strategy for reducing methane emissions from paddy rice fields. However, substantial reductions are possible through a more integrated approach to rice paddy irrigation and varietal selection. Many rice varieties can be grown under much drier conditions than those traditionally employed, with large reductions in methane emission without any loss in yield. Intermittent and/or alternating dry-wet irrigation of rice fields can be employed with these varieties. Applying the principles of conservation agriculture to crops such as irrigated rice would provide chances for reducing the water consumption of this cropping system and, by changing the soil environment from mostly anaerobic to aerobic, could also make it easier to fine-tune the irrigation pattern to reduce the emission of methane. The addition of compounds that favour the activity of other microbial groups over that of the methanogens, such as ammonium sulphate, has proved successful under some conditions. E. Reducing Methane Emissions from Manure: Although manure is the residue from animals’ digestive processes–so is a waste product – it contains important amounts of nitrogen, phosphates and potassium that provide valuable soil nutrients when applied to farmers’ fields. Poor manure management can increase the loss of pollutants to the environment, however. Nitrogen in manures can be lost as nitrate, nitrous oxide (a greenhouse gas) or ammonia (a constituent of acid rain and a cause of terrestrial eutrophication). Phosphorus-rich manure particles can be washed into watercourses, and can raise soil phosphorus contents to levels where phosphorus leaching begins. There are options for managing manure in ways that do not contribute to greenhouse gas accumulation. Methane is not released when manure is managed as a solid substance through composting and drying, or is applied and worked into the fields without being left to stand. Moving away from intensive rearing methods to increased grazing time for animals, so greater dispersal of their manure, also increases aerobic rather than anaerobic decomposition and reduces the rate of methane production. The temperature at which manure is stored can have a significant effect on methane production. In farming systems where manure is stored in stables, such as in pig farms where effluents are stored in a pit in the cellar of the stable, emissions can be higher than when manure is

24


stored outside at lower ambient temperatures. Greenhouse gas production can also be reduced through deep cooling of manure. Cooling of pig slurry can reduce indoor methane and nitrous oxide emissions by 21 percent (Sommer, Peterson and Møller, 2004). Trapping the methane released by livestock manure, for example in slurry tanks, has already proved very successful in reducing methane emissions to the atmosphere. The recovered methane, often called “biogas”, can be flared off as CO2 or used as a fuel. Biogas is typically made up of 65 percent methane and 35 percent CO2, so the combustion of methane releases CO2, but this is 23 times less noxious in terms of global warming impact than methane is. A further mitigation dividend is obtained when combustion provides an energy source to replace the use of fossil fuels. There are various storage systems for exploiting this huge potential, including covered lagoons and other structures for liquid storage, such as pits and tanks. Covered lagoons and biogas systems produce a slurry that reduces methane emission when applied to rice fields, instead of untreated dung (Mendis and Openshaw. 2004). In warmer climates, where methane emissions from liquid slurry are estimated to be more than three times as high (IPCC, 2007b), a reduction potential of 75 percent is considered reasonable. F. Reducing Nitrous Oxide Emissions from Agricultural Soils: A major direct source of nitrous oxide from agricultural soils is the widespread increase in the use of synthetic nitrate-based fertilizers, driven by the need for greater crop yields and by more intensive farming practices. Where large applications of these fertilizers are combined with irrigation practices that saturate soils, the resulting lack of oxygen in the soil produces conditions that are favourable to anaerobic conversion of solid nitrates and nitrites into nitrogen-containing gases (denitrification) and release of large amounts of nitrous oxide into the atmosphere. The widespread and often poorly controlled use of animal waste as fertilizer can also lead to substantial emissions of nitrous oxide from agricultural soils. The ammonia in urea-based fertilizers and manures vaporizes when exposed to the air. Some additional nitrous oxide is thought to arise from agricultural soils through the planting of leguminous crops that fix nitrogen, but the importance of this source is not yet clear. Nitrogen leaching and runoff from agricultural soils is another source of nitrous oxide emissions. Net nitrogen use in farming affects climate change, because it is linked to nitrous oxide emissions, and water pollution, because nitrates pollute soil, fresh and marine waters. The net climate change impact is calculated by deducting the sequestration of greenhouse gases absorbed by the additional plant growth caused by fertilizer use from the temperature-forcing impacts of nitrogen fertilizers. The best way to manage human interference in the nitrogen cycle is to maximize the efficiency of nitrogen uses. Better targeting of fertilizer applications, in both space and time, can significantly reduce releases of nitrous oxides from agricultural soils. Rapid incorporation and shallow injection of livestock wastes reduce nitrogen loss to the atmosphere by at least 50 percent, and deep injection into the soil essentially eliminates the loss. Crop rotations that efficiently recycles these nutrients, and fertilizer applications near to when they are needed by crops reduce the potential for further loss. RICMS uses a variety of these methods to increase the efficiency of nitrogen fertilizer in rice production. Options for reducing emissions from grazing systems are also important. Adding nitrification inhibitors to urea or ammonium fertilizer compounds before application can substantially reduce emissions of nitrous oxide (Monteny, Bannink and Chadwick, 2006). On pastures, this technology inhibits the production of nitrous oxide from animal urine. Balanced feeding is also important; for example, feed that is high in nitrogen will produce manure with high nitrogen content, which emits greater levels of nitrous oxide than manure with low nitrogen content does. The compacting of soil by traffic, tillage and grazing livestock can reduce its oxygen content and enhance conditions for denitrification. Reducing soil wetness through better drainage can increase oxygen content and may reduce nitrous oxide emission significantly, especially in more humid environments. 2. Sequestering Carbon: Although it can take much longer for carbon to be released from the atmosphere than it takes for it to get there (Doney and Schimel, 2007), carbon capture and sequestration can slow global warming significantly, even if emissions continue to increase. What matters is the amount of carbon that is added to the atmosphere per year, compared with the carbon sequestered in addition to the historical average per year. The global terrestrial carbon sequestration potential is about 4.5 to 5 billion tonnes per year, compared with net releases into the atmosphere of about 3.5 billion tonnes per year for the period 1980 to 1989 (UNEP-GRID-Arendal). In response to this imbalance, land is being set aside for the creation of carbon sinks in new-growth forests, grasslands are being rehabilitated and conservation agriculture on cultivated soils is being promoted


25

as important climate mitigation measures. Because the creation of sinks involves changes in land and forest management practices and difficult land-use policy decisions, the food and agriculture sector will be critical for the success or failure of many carbon sink initiatives. Carbon sequestration involves increasing the carbon storage in terrestrial systems, above or below ground. The main thrust of efforts to use agriculture to manage greenhouse gases has so far been to increase above-ground sequestration, primarily through planting trees, which allows large perhectare amounts of carbon to be sequestered. New-growth forests are an especially important form of carbon sink, because of the amount of carbon dioxide that they absorb. Recent studies have shown that well-managed grasslands and conservation agriculture can work as well or better as techniques for sequestering carbon. If the carbon stock in soils has been depleted as a consequence of past landuse changes and agricultural activities, changes in soil management practices can trigger a process of carbon accumulation below ground, over time. Eventually, the system reaches a new carbon stock equilibrium or saturation point, and no new carbon is absorbed, but until then carbon sequestration is low-cost and can be readily implemented. Practices that increase carbon sequestration have additional benefits, including increased root biomass, soil organic matter, water and nutrient retention capacity and, hence, land productivity. Investments in improved land management leading to increased soil fertility and carbon sequestration can often be justified by their contributions to agronomic productivity, national economic growth, food security and biodiversity conservation (FAO, 2004a). This section explores four feasible options for carbon sequestration: reforestation and afforestation, rehabilitating degraded grasslands, rehabilitating cultivated soils, and promoting conservation agriculture. Enhancing carbon sequestration in degraded drylands and mountain slopes by any of these methods could have direct environmental, economic and social benefits for local people, with consequent improvement in their food security status. 3. Reforestation and Afforestation: Reforestation involves planting new trees in existing forested areas where old treess have been cut or burned; afforestation involves planting stands of trees on land that is not currently classified as forest. Sustainable forest management requires that a new tree be planted for every tree cut down by logging, fuelwood gathering or land clearing activities. At the global level, however, meaningful carbon sequestration through reforestation and afforestation would require that more new trees be planted each year than were lost to deforestation in the previous year. Farmers, commercial logging companies, industrial roundwood producers and fuelwood plantation managers all have the possibility to plant large numbers of new trees as part of their normal operations. Public sector programmes to replant forested areas that have been destroyed by wildfires or arson can also be managed so that they add to the global carbon sink reserve. Areas that have been intentionally converted from forest to other land uses need to be transformed into stable agricultural areas as quickly as possible, so they are not left in the vulnerable transition period for too long. Cleared land is at high risk of erosion and loss of soil moisture, so fast-growing cover crops should be planted as soon as possible after clearing, even if they are subsequently replaced by something else. In addition to reducing the risk of erosion, these crops will absorb some CO2 and can later be ploughed under to enhance the fertility and water-retention capacity of the soil. Increasing the extent of protected areas and natural parks is another way of augmenting carbon stores. Preserving forests is therefore a vital part of any strategy to mitigate climate change. Forest-dependent people and vulnerable people living on degraded land can provide forest related environmental services with carbon sequestration potential, as long as appropriate compensation is paid. Such services include the incorporation of reforestation and afforestation in sustainable upper watershed management schemes, and the introduction of integrated agroforestry farming systems that include planting fast-maturing tree crops and woodlots to prevent soil erosion, restore the soil’s water retention capacity and contribute to farm income, as well as sequestering carbon. Grasslands cover about 25 percent of the world’s surface and contribute to the livelihoods of more than 800 million people, including many poor smallholders and pastoralists. Grasslands are particularly adapted for grazing livestock, and pastoral farming systems are important, especially in more arid parts. With better management, these grasslands can produce feed stocks for manufacturing biofuel for local markets, give their inhabitants more secure and sustainable livelihoods that will be resilient in variable and uncertain weather conditions, and provide carbon sequestration services to the world. Several aspects of dryland soils work in favour of carbon sequestration in arid regions. Dry soils are less likely to lose carbon than wet soils, as lack of water limits soil mineralization and therefore the flux of carbon into the atmosphere.

26


As a result, carbon’s residence time in dryland soils is long. Although carbon sequestration in these regions occurs at low rates, it may be cost-effective, particularly taking into account all the sidebenefits resulting from soil improvement and restoration (FAO, 2004a). Among the many other technical options are fire management, protection of land and set-asides, and enhancement of grassland production, such as through fertilization and the introduction of deep-rooted/legume species. Models can indicate the respective effects of these practices in a particular situation. More severely degraded land requires landscape rehabilitation and erosion control. This is more difficult, particularly from an economic perspective. In many situations, improved pasture management and integrated agroforestry systems are effective in conserving the environment and mitigating climate change, while providing more diversified and secure livelihoods for inhabitants. The real potential for terrestrial soil carbon sequestration is uncertain, because data are lacking and there is insufficient understanding of the dynamics of soil organic carbon at all levels, including the molecular, the landscape, the regional and the global. Lal estimates the ecotechnological scope for soil carbon sequestration in dryland ecosystems to be about 1 billion tonnes of carbon per year, but realization of this potential would require a “vigorous and a coordinated effort at a global scale towards desertification control, restoration of degraded ecosystems, conversion to appropriate land uses, and adoption of recommended management practices on cropland and grazing land” (Lal, 2004b). Dryland conditions offer very few economic incentives to invest in land rehabilitation for agricultural production. Compensation for carbon sequestration may tip the balance in some situations, but significant local obstacles would need to be overcome before carbon credit schemes can be used to realize grasslands’ potential for mitigating climate change and securing more adequate and sustainable livelihoods for pastoral peoples. These obstacles include the following:  Pastoral areas usually have less infrastructure and much lower population density than other rural areas.  Carbon credit schemes require communication among groups that are often distant from one another; cultural values will be both a constraint and an opportunity in pastoral lands.  The payment required to motivate pastoralists to change their grazing practices may be higher than the market can bear.  The government institutions required to implement such schemes often have insufficient strength and ability. 4. Rehabilitating Cultivated Soils: The relatively low CO2 emissions from arable land leave little scope for mitigation, but there is great potential for net sequestration of carbon in cultivated soils. According to Lal, the carbon sink capacity of the world’s agricultural and degraded soils is 50 to 66 percent of the total carbon loss since 1850 (Lal, 2004b). Under conventional cultivation practices, the conversion of natural systems to cultivated agriculture results in soil organic carbon losses of about 20 to 50 percent compared with precultivation stocks in the surface metre. Non-conventional cultivation practices allow soil quality to improve and soil organic carbon levels to increase. Such practices can be grouped into three classes: agricultural intensification, conservation agriculture and erosion reduction. Sustainable intensification practices include improved cultivars, well-managed irrigation, organic and inorganic fertilization, management of soil acidity, green manure and cover crops in rotations, integrated pest management, double cropping and crop rotation. Increased crop yields result in more carbon accumulation in crop biomass, or alteration of the harvest index. The higher residue inputs associated with higher yields favour enhanced soil carbon storage. IPCC provides an indication of the “carbon gain rate” that can be obtained from some of the practices (IPCC, 2007b). There are some conventional soil management practices that can be replaced by improved practice to restore soil quality and sequester carbon. Although Farmers’ adoption of the practices brings onfarm benefits as increased crop yields, these benefits must result in an overall net improvement to farmers’ livelihoods, otherwise the improved practices will not be widely accepted. 5. Promoting Conservation Agriculture: Conventional tillage involves the use of mechanical implements to break up the soil. The simplest such implement is the hand hoe. Mechanized soil tillage allows higher working depths and speeds and involves the use of such implements as tractor-drawn ploughs, disk harrows and rotary cultivators. This initially increases fertility because it mineralizes soil nutrients and makes it easier for plants to absorb them through their roots. In the long term, however, repeated ploughing and mechanical cultivation breaks down the soil structure and leads to


27

reduced soil organic matter and loss of soil nutrients. This structural degradation of soils results in compaction and the formation of crusts, leading to soil erosion. This process is dramatic under tropical climatic situations, but can also be noticed all over the world. The logical approach to this is to reduce tillage. Movements promoting conservation tillage, especially zero-tillage, first emerged in southern Brazil, North America, New Zealand and Australia. Over the last two decades, the technologies have been improved and adapted for nearly all farm sizes, soils, crop types and climatic zones. Conservation agriculture is based on enhancing natural biological processes above and below ground. Interventions such as mechanical soil tillage are reduced to an absolute minimum, and external inputs such as agrochemicals and nutrients of mineral or organic origin are applied at optimum levels and in ways and quantities that do not interfere with or disrupt biological processes. Intensive cultivation with tractors and ploughs is a major cause of soil erosion and land degradation in many developing countries, especially where the topsoil is thin. As well as reducing tillage, the farmers who adopt conservation agriculture also keep a protective soil cover of leaves, stems and stalks from the previous crop, which shields the soil surface from heat, wind and rain, keeps soils cooler and reduces moisture losses by evaporation. Less tillage also means lower fuel and labour costs, and farmers need to spend less on heavy machinery. In zero-tillage agriculture, the soil is never turned over, and soil quality is maintained entirely by the continuous presence of a cover crop. Crop rotation over several seasons is essential to minimize the outbreak of pests and diseases (Europa World, 2001). Conservation agriculture increases soil organic matter and this in turn increases the amount of carbon stored in the soil. Under conventional tillage, this carbon is metabolized by soil microorganisms into CO2. Experiences with conservation agriculture so far show that the increase in soil organic matter continues for about 30 years, before levelling out to a new equilibrium, which generally corresponds to the organic matter content of the virgin soil, before it was taken under cultivation. In some cases however, the organic matter content can exceed this original level, where other land amelioration techniques have improved the production potential of the land compared with the virgin soil. The global application of conservation agriculture could result in a total sequestration of up to 3 billion tonnes of carbon per year, for about 30 years; this is nearly the equivalent of the atmospheric net increase in CO2 of anthropogenic origin. Soil carbon sequestration can be increased further when cover crops are used in combination with conservation tillage, but because many of these cover crops are nitrogen fixers, the additional nitrous oxide that they release is obviously detrimental. Overall, FAO projections suggest that the global area of rainfed land under zerotillage/conservation agriculture could increase considerably. If these projections materialize – although it is by no means certain that they will – the results would be such benefits as reduced soil erosion, smaller losses of plant nutrients, higher rainfall infiltration and better soil moisture-building capacity, making a significant contribution to mitigating the impacts of climate change (FAO, 2003b: 344). Similar conclusions have been reached by other scientific research teams engaged in projecting the impact of climate change on agriculture, notably those of the International Food Policy Research Institute (IFPRI) (Scherer and Yadav, 1996). References Carbon Trust. About the carbon trust. Available at: www.carbontrust.co.uk/about/. Carvalho, C.J.R., Vasconcelos, S.S., Zarin, D.J., Capanna, M., Littell, R., Davidson, E.A., Ishida, F.Y., Santos, E.B., Araujo, M.M., Angelo, D.V., Rangel-Vasconcelos, L.G.T., Oliveira, F.A. & McDowell, W.H. (2004). Moisture and substrate availability constrain soil trace gas fluxes in an Eastern Amazonian regrowth forest. Global Biogeochemical Cycles, 18. Doney, S.C. & Schimel, D.S. (2007). Carbon and climate system coupling on timescales from the Precambrian to the Anthropocene. In Annual review of environment and resources. Available at: www.globalcarbonproject.org/global/pdf/doney_annurev_energy_2007.pdf. ESSP Online: www.essp.org/. Europa World. (2001). Conservation agriculture can benefit the planet, says FAO. Available at: www.europaworld.org/issue51/conservation51001.htm. FAO. (2003b). World agriculture: Toward 2015/2030, Chapter 13. Rome, Earthscan. FAO. (2004a). Carbon sequestration in dryland soils. World Soil Resources Reports No. 102. Rome. Available at: ftp://ftp.fao.org/agl/agll/docs/wsrr102.pdf. GHG Online a. About methane. Available at: www.ghgonline.org/aboutmethane.htm GHG Online b. Methane sources–rice paddiers. Available at: www.ghgonline.org/methanerice.htm.

28


IPCC. (2007b). Climate Change 2007 - mitigation of climate change. Contribution of Working Group III to the Fourth Assessment Report of IPCC. Cambridge. UK. Cambridge University Press. Lal, R. (2004b). Soil carbon impacts on global climate change and food security. Science, 304(5677): 16231627. Mendis, M. & Openshaw, K. (2004). The clean development mechanism: making it operational. Environment, Development and Sustainability, 6(1-2): 183–211. Monteny, G.J., Bannink, A. & Chadwick, D. (2006). Greenhouse gas abatement strategies for animal husbandry. Agriculture, Ecosystems and Environment, 112: 163–170. Scherr, S.J. & Yadav, S. 1996. Land degradation in the developing world, issues and policy options for 2020. Washington, DC, IFPRI. Sommer, S.G., Petersen, S.O. & Møller, H.B. (2004). Algorithms for calculating methane and nitrous oxide emissions from manure management. Nutrient Cycling in Agroecosystems, 69: 143–154. Vlek, P.L.G., Rodriguez-Kuhl, G. & Sommer, R. (2004). Energy use and CO2 production in tropical agriculture and means and strategies for reduction or mitigation. Environment, Development and Sustainability, 6(1-2): 213-233. WRI. (2006). Greenhouse gases and where they come from, by T. Herzog. Available at:www.wri.org/ climate/ topic_content.cfm?cid=4177

ROLE OF PLANT BIOTECHNOLOGY IN CROP IMPROVEMENT FOR ADOPTATION IN CHANGING CLIMATIC CONDITIONS Mohd. Zahid Rizvi Department of Botany, Shia Post Graduate College, Sitapur Road, Lucknow-226020, Uttar Pradesh, India, Email: [email protected]

C

limate change is a phenomenon which will affect in future agriculture and humans which depend on agriculture to a large extent for their food security. Some reasons which are responsible for climate change are, prescence of high concentration of some gases in the atmosphere and anthropogenic influences including agricultural activities. Agricultural activities also contribute to increase in earth’s average temperature over years called global warming. Some gases called green house gases (GHGs) absorb part of the solar radiation reflected by the earth’s surface and stop the radiation from being reflected back into space therefore leading to warming of the atmosphere. This is called as Green House Effect (IPCC 2007). Industrialization and other activities causing release and accumulation of carbon dioxide, methane, nitrous oxide, hydroflurocarbons (HFCs), perflurocarbons (PFCs) and sulfur hexafluoride (SF6) cause GHGs emission. Burning of fossil fuels mainly due to automobiles and anthropogenic activities, and reduction in forest cover also led to increase in concentration of GHGs in atmosphere and therefore undesirable change in global climate. Increase in the average temperature of the earth’s atmosphere caused melting of glaciers, unpredictable rainfall patterns, and extreme weather events like rising intensity of storms, droughts, flooding and heat waves. Due to these events, there will be changes in temperature, precipitation, emergence of new species/varieties of insect pests and pathogens, weeds, change in water quality/quantity, soil quality and soil erosion. The human population of world is increasing at an evergrowing rate and expected to reach over 10 billion in the year 2050 thus increasing the food needs of the world population to almost double by 2050, while annual growth rate of agricultural productivity is slow at the rate of about 1.8 %. (Barrett, 2010). Further, the salination and desertification phenomenon resulting from climate change have resulted in shrinkage of land for agricultural use. Therefore food security of the global population is in danger due to these events. Therefore increasing the agricultural productivity is the need of the present time. Biotechnology can play an important role in adopting and as a remedial measure for adverse effects of climate change through reduction in green house gases, and producing varieties of crops adapted to various stresses like drought, flood, increase in temperature and emergence of new pathogens etc. The conventional agricultural biotechnology methods include energy-efficient farming, use of biofertilizers, tissue culture and conventional breeding for producing varieties adapted to climate change, may contribute to carbon sequestration initiatives thus reducing global warming. On the other hand, the adoption of modern methods of biotechnology producing genetically modified stresstolerant, and high-yielding transgenic crops, can also help in coping with the adverse effects of climate change. Transgenics can be developed through manipulation of individual genes and through transfer of genes between related species. Employing transgenic technology, genes can be manipulated from diverse sources, and can be transferred into microorganisms and crops to confer resistance to pests and diseases, tolerance to herbicides, and abiotic stresses like drought, salinity etc. Transgenic technology can result in development of new varieties of crops which can produce higher crop yields in drought and salinity conditions with limited agricultural resources. Furthermore, polluted regions can be cleaned through phytoremediation. Propagation and conservation of stresstolerant plant species will also help in maintaining biodiversity. Crops, varieties, and traits that are resistant to pests and diseases will increase otherwise dwindling agricultural productivity. Therefore both conventional and modern agricultural biotechnologies will significantly contribute to the current and future worldwide climate change adaptation and mitigation efforts and thus add towards food security of growing world population. This paper reviews different conventional and modern biotechnology methods that can be used to address efforts of climate change adaptation and mitigation for improved crop productivity and food security and also contributing to the reduction of the greenhouse gases.

30


Biotechnological Methods Used to Address the Problems of Climate Change: Different conventional and modern biotechnological methods that can be employed for adaptation and mitigation of problems arising due to climate change are discussed below (Table 1, 2): Reduction of Green House Gases: Agricultural practices such as deforestation, inorganic fertilizer use and overgrazing by cattle are responsible for emission of about 25% of green house gases (CO2, CH4 and N2O) (Treasury, 2009). Use of biofuels, carbon sequestration and reduction in use of artificial fertilizers are some of conventional measures that can help in decreasing green house gases and thus reducing adverse effects of global warming and climate change (Treasury, 2009). Use of Biofuels: Automobile emission and agricultural practices are two main reasons for adverse effects on climate including global warming. Production of biofuels, both from traditional and genetically modified (GMO) crops such as sugarcane, oilseed, rapeseed, and jatropha can reduce the CO2 emission by the transport sector and thus its negative effects on climate (Sarin et al., 2007; Treasury, 2009; Mtui, 2011). Adoption of energy efficient farming will employ machines that use bioethanol and biodiesel instead of the conventional fossil fuels or mix biofuels with fossil fuels thereby decreasing use of fossil fuels to some extent. (Jain and Sharma 2010; Lybbert and Summer 2010). Therefore use of bio-fuels can help in solving problem of climate change due to use of fossil fuels leading to emission of gases especially CO2. While ethanol production from crops such as corn may be a substitute for fossil fuels, they also compete with corn grown as a food crop and thus lead to increase in their prices. The solution of this problem may be use of non-food plants for biofuel production. Switchgrass a non food crop and algae are examples of plant sources which can produces fuel less expensively than either petroleum or food crop corn (Bouton, 2007; Beer et al., 2009). Less Fuel Consumption: Organic farming methods like compost and mulching techniques use less fuel and additionally due to reduced ploughing result in less use of weeds and herbicides (Maeder et al., 2002). Irrigation is a fuel consuming process therefore by employing efficient irrigation practices, fuel consumption can be reduced, which will subsequently reduce the amount of CO2 released into the atmosphere (Mtui, 2011). Using modern biotechnological methods, GMO crops are produced which result in less fuel usage by reducing frequency of spraying and reducing tillage or excluding the tillage practice. For example, insect-resistant GM crops reduce fuel usage and CO2 production by reducing insecticides application. Reduction of fuel usage employing biotechnology resulted in savings of about 962 million kg of CO2 emitted in 2005, while the adoption of reduced tillage or no tillage practices led to a reduction of 40.43 kg/ha or 89.44 kg/ha CO2 emissions due to less fuel usage respectively (Brookes and Barfoot, 2006, 2008). Table 1. Adaptation and mitigation of climate changes employing conventional agricultural biotechnology approaches (Mtui 2011) Measure Biotechnological Application Reference(s) Approach Climate change mitigation No-till practices Coffee and banana and West and Post 2002; Johnsona horticultural farming et al. 2007; Powlson et al. 2011 Reduced use of artificial fertilizers Biofertilizers Employing animal manure Treasury 2009; Powlson et al. and composting 2011 Carbon sequestration Agroforestry Mycorestoration; symbiotic Franche et al. 1998; Zahran association of mycorrhizal 2001 and actinorrhizal species Afforestation Lin et al. 2008 Biofuels Bioethanol from sugarcane Lybert and Summer 2010 Biodiesel from jatropha, Sarin et al. 2007; Lua et al. palm oil 2009; Jain and Sharma 2010 Climate change adaptation Mulching Horticlutural practices Johnsona et al. 2007 Adaptation to biotic and abiotic Tissue culture Drought tolerant sorghum, Apse and Blumwald 2002 stresses millet, sunflower Cross breeding Drought resistant pearl millet Ruane et al. 2008 Agroforestry Shading management in Franche et al. 1998; Saikia and coffee and banana crops Jain 2007 Improved agricultural productivity Increased crop yield per Crop rotation, traditional Edgerton 2009; Treasury 2009 unit area of land pesticides.

Carbon Sequestration: The capture or uptake of carbon containing substances, especially carbon dioxide (CO2), is often called carbon sequestration (Mtui, 2011). Carbon sequestration removes carbon, in the form of CO2, either directly from the atmosphere or from the combustion and industrial processes. Soil carbon sequestration can be employed to mitigate the elevated concentration of

Role of Plant Biotechnology in Crop Improvement for Adoptation……………

31

atmospheric CO2. Soil erosion can be prevented through conservation practices that may also sequester soil carbon and enhance methane (CH4) consumption (Johnsona et al., 2007). Herbicide tolerant genetically engineered crops such as soybean and canola facilitate zero or no-till, which reduces the loss of soil carbon (carbon sequestration) and CO2 emissions, reduce fuel use, and soil erosion. Genetically modified crops such as Roundup Ready TM (herbicide resistant) soybean caused sequestration of 63,859 million tones of CO2 (Brimner et al., 2004; Kleter et al., 2008). Genetically engineered plants can be designed to take more carbon from atmosphere and convert it to oxygen. Soil fertility can be increased with the help of mixing microbes in the soil. Reduced Use of Artificial Fertilizers: The environment has been contaminated with toxic agricultural chemicals especially inorganic fertilizers used to increase agricultural productivity, which subsequently affect the biogeochemical cycle and climate (Ogunseitan, 2003). Formation and release of greenhouse gases (particularly N2O) from the soil to the atmosphere chiefly occurs due to the use of inorganic nitrogenous fertilizers especially ammonium sulphate, ammonium chloride, ammonium phosphates (Brookes and Barfoot, 2009). The artificial fertilizers are produced from fossil fuels, therefore they add towards further reduction of an already dwindling fuel resource. One way to cope with the adverse effects of artificial fertilizers on climate is to reduce the use of artificial fertilizers, on the other hand we can use some alternative source such as biofertlizers. Minimizing artificial fertilizers use can also help in reduced nitrogen pollution of ground and surface waters. Besides biofertilizers, other organic farming technologies employing crop rotation and intercropping with leguminous plants with nitrogen-fixing abilities are some of the conventional biotechnological methods for reducing artificial fertilizer use. Biofertilizers can be produced through conventional biotechnological methods employing composted humus and animal manure. On the hand, employing modern genetic engineering techniques, nitrogen-fixing characteristics of Rhizobium inoculants were improved (Zahran, 2001). Besides leguminous plants, attempts were also made for inducing nodular structures on the roots of non-leguminous cereal crops such as rice and wheat for enabling them also to fix nitrogen in the soil and increase soil fertility (Saikia and Jain, 2007; Yan et al., 2008). Cultivation of nitrogen-efficient genetically modified canola has prevented to significant extent the loss of nitrogen fertilizer into the atmosphere or leaching into soil. Biotechnology for Biotic and Abiotic Stress Tolerance Biotic Stress: Development of genetically engineered plant strains that are resistant to biotic stresses such as insects, fungi, bacteria and viruses could reduce crop loss. Bacillus thuringiensis (Bt) gene which gives resistance to insects, pests such as the European corn borer, but has apparently no harmful effect on humans and environment has been introduced into corn, cotton, and soybeans, thus reducing damage to these crops. Therefore, GM crops can play important role in integrated pest management (IPM). Herbicide tolerance trait has also been introduced into corn, soybeans, and canola. Genetically modified potatoes, cassava and other crops that are resistant to biotic stresses are in development and some of these are already been commercialized (Barrows et al., 2014). Abiotic Stress: Salinity, drought, extreme temperatures, oxidative stress are some of the abiotic stresses which affect agricultural productivity and climate. Plant biotechnological methods in combination with conventional breeding techniques is an important approach for imparting abiotic stress tolerance in crops. These approaches include selection and growing of drought tolerant crops thus allowing their growth in harsh environmental conditions on otherwise non-agriculture lands (Kumar et. al., 2015). By employing modern biotechnological approaches such as genetic engineering, useful genes or alleles imparting resistance to various stresses can be transferred across different species from the animal or plant kingdoms. In this way, crops tolerant to various abiotic stresses have been developed in response to climatic changes (Laksmi et al., 2015). In Australia, field trials of 1,161 lines of genetically modified (GM) wheat and 1,179 lines of GM barley modified to contain one of 35 genes to enhance tolerance to a range of abiotic stresses including drought, cold, salt and low phosphorous obtained from wheat, barley, maize, moss or yeasts were done. Field trials of Sugarcane that contains transcription factor (OsDREB1A) were also done (Tammisola, 2010). More than a dozen of other genes influencing salt tolerance have been reported in various plants, some of which can be employed in developing salt tolerance in sugarcane, rice, barley, wheat (Wang et al., 2003), tomato (Moghaieb et al., 2011), and soybean. Structural genes (key enzymes for osmolyte biosynthesis, such as proline, glycine/ betaine, mannitol and trehalose, redox

32


proteins and detoxifying enzymes, stress-induced LEA proteins) and regulatory genes, including dehydration–responsive, element-binding Table 2. Climate change mitigation through modern plant biotechnology approaches (Mtui 2011) Measure Biotechnological Application Reference(s) Approach Development of GM soy beans Fawcett and Towery 2003; Brimner Mitigation of climate change herbicide resistant GM canola et al. 2004; Kleter et al. 2008 transgenic plants to reduce herbicide spraying Consumption of less fuel Development of insect Bt maize, cotton and May et al. 2005; Bonny 2008; Zhe resistant transgenic eggplant and Mithcell 2011 plants to reduce insecticide spraying Reduction in use of artificial Genetic Engineering of Genetic improvement of Kennedy and Tchan 1992; Saikia nitrogen fixation Rhizobium; inducing N- and Jain 2007; Yan et al. 2008 fertilizers fixation in non-leguminous plants Biotechnological Herbicide resistant GM soy Fawcett and Towery 2003; Kleter Carbon sequestration approaches to help No- beans, canola et al. 2008 till farming

Climate change adaptation

Adaptation to biotic and abiotic stresses

Green energy GM crops having nitrogen efficiency Molecular marker assisted breeding for stress resistance Genetically engineered drought tolerant plants Engineering tolerance

Enhanced agricultural productivity per unit area of land

salt

Genetically engineered heat tolerant plants Increased crop yield per unit area of land

GM energy crops N-efficient GM canola

Lybbert and Summer 2010 Johnsona et al. 2007

Drought resistant wheat hybrids

Wang et al. 2001, 2003

maize,

GM Arabidopsis, tobacco, maize, wheat, cotton, soybean GM tomato, rice

Jaglo et al. 2001; Yamanouchi et al. 2002; Manavalan et al. 2009

GM Arabidopsis, GM Brassica sp. GM cassava, potatoes, bananas, maize and canola crops resistant to fungal, bacterial and viral diseases

Jaglo et al. 2001; Zhu 2001

Hsieh et al. 2002; Zhang and Blumwald 2002

Van Camp 2005; Gomez-Barbero et al. 2008

(DREB) factors, zinc finger proteins, and NAC transcription factor genes, are being employed. Transgenic crops carrying different drought tolerant genes are being developed in rice, wheat, maize, sugarcane, tobacco, Arabidopsis, groundnut, tomato, potato and papaya. Marker-free transgenic wheat using a transcription factor, AtDREB1A has been developed imparting tolerance to moisture stress (Kasirajan et al., 2014). Heat shock proteins (HSPs) help in recovery of plants under extreme heat conditions and, even during drought. HSPs provide stability to proteins denatured during stress conditions, and prevent protein aggregation. In GM chrysanthemum having the DREB1A gene from Arabidopsis thaliana, the transgene and other heat responsive genes such as the heat shock protein 70 (HSP70) were highly expressed during heat treatment. The transgenic plants maintained higher photosynthetic capacity and increased levels of photosynthesis-related enzymes. Recently, a gene encoding aquaporin (NtAQP1) was identified in tobacco (Nicotiana tabacum) which was observed to provide protection against salinity stress in transgenic tomatoes (Solanum lycopersicum); (Hu, 2006). NtAQP1 has an important role in preventing root/shoot hydraulic failure, enhancing water use efficiency and thereby improving salt tolerance. Nutritionally Enhanced Foods: Nutritional enhancement of the food crops which are diet of majority of world’s population can solve the hunger and malnutrition problem of world’s population especially poor people. By producing biofortified (nutritionally enriched) rice, wheat and corn having increased mineral and vitamin content, the nutritional status in the diet of majority of world’s population can be improved especially in scenerio of decreasing food supply in changing climatic conditions. By increasing the vitamin A content of rice and other staple crops, the cases of blindness in malnourished children due to deficiency of vitamin A content in their diet, can be reduced (Mayer, 2007). Other examples of biofortification approaches to improve nutritional status include zinc and iron enriched corn, cassava and rice, or calcium-enriched carrots and tomatoes (Cockell, 2007; Morris et al., 2008; Naqvi et al., 2009). Vitamin A-enriched ‘Golden Rice’ is a good example of biofortified


33

crop produced through genetically altered biosynthetic pathways, Other approaches include modifying the general physiology of the plant so that it is capable of extracting more micro-nutrients from the soil, such as iron-enriched wheat. The incorporation of biofortified foods into the dietary habits of the rural poor people of developing countries can help them in coping with harmful effects on their lives due to climate change (Hotz and McClafferty, 2007; Zhu et al., 2007; Jeong and Guerinot, 2008). Phytoremediation to Increase Fertile Agriculture Land Area: Pollutants such as heavy metals, released into the soil and water due to industrial and other activities have reduced the fertile agriculture land. Some plant species have the capacity to uptake heavy metals through their root systems and accumulate them in their foliage or other tissues. These plants can then be harvested to rid the land of pollutants (phytoremediation), thus providing an increase in valuable, fertile agriculture land area (Wu et al., 2007; Memon and Schröder, 2009). Mycorestoration and other Agroecological Methods for Mitigating Effects of Climate Change: In many tropical regions, modified temperature and precipitation patterns due to global climate change are having adverse effects on agriculture (Mtui, 2011). Practices like shade management in crop systems, can potentially help in coping the effects of high temperature and precipitation due to extreme climatic conditions (Lin et al., 2008). Mycobiotechnology, a branch of biotechnology involving fungi is being used to solve environmental problems and restore degraded ecosystems (Cheung and Chang, 2009). Mycorestoration employs some saprophytic and mycorrhizal fungi for repairing or restoring ecologically degraded habitats. Many non-legume woody plants such as casuarinas (Casuartna sp.) and alders (Alnus sp.) can fix nitrogen in symbiotic association with actinomycete bacteria (Frankia sp.), thus helping forestry and agroforesty (Franche et al., 1998). Both endo- and ectomycorrhizal symbiotic fungi together with actinomycetes have been used in recovery of degraded forests (Saikia and Jain, 2007) and increasing soil fertility and water uptake by plants (Ruane et al., 2008). Afforestation would indirectly contribute to improved agricultural productivity and food security because forests create microclimates that improve rainfall availability. Forests act as carbon sinks therefore adding towards carbon sequestration and thus reducing greenhouse effect. Alternative Approaches to Farming for Addressing Effects of Climate Change: Some alternative methods are also being applied to cope with adverse effects of climate change one such approach is precision agriculture, in which resources and inputs e.g. water and fertilizers are optimized. In precision agriculture, complex devices such as global positioning system (GPS) are employed to identify factors ranging from moisture and nutrient content of soils to pest infestation of a given crop. Based upon the exact information provided by this system, optimal inputs can be applied to a specific region of a given crop only at the time of their requirement thus reducing unnecessary and untimely use of water, ferlitilizers, pesticides, herbicides etc (earthobservatory.nasa.gov, www.ghcc.msfc. nasa.gov). In a much simple practice, called drip irrigation, small amounts of water are applied to plant root systems by a network of irrigation pipes. This technique has been very helpful for crops growing in drought-infested areas. In another technique, small amounts of fertilizers are applied to the roots of crops at specific times in the growing season. These simple agricultural practices have enabled farmers who have poor access to water or artificial fertilizers to optimize their crop yield with minimum inputs (Mara Hvistendahl, 2010). Conclusions: The role of plant biotechnology in adaptation to climatic changes has been discussed in this review. Various conventional and modern biotechnological methods as measures for climate change adaptation and mitigation have been taken into account. These include reduction of CO2 emissions, carbon sequestration, reduced consumption of conventional fossil fuels, use of biofuels, less use of artificial fertilizers, precision farming, phytoremediation, nutritionally enhanced foods and adaptation for biotic and abiotic stress tolerance in plants through genetic engineering to cope with various insects, pests, drought, heat and salinity stresses encountered due to climate change. These approaches integrating both conventional and modern biotechnological methods may solve food security problems of evergrowing human population by increasing agricultural productivity and may also be helpful in adapting our environment to various adverse effects of climate change. Acknowledgement: Suggestions and help provided by the colleagues and friends are acknowledged. References Apse, M.P., Blumwald, E. (2002). Engineering salt tolerance in plants. Curr. Op. Biotechnol., 13: 146-150. Barrett, C.B. (2010). Measuring Food Insecurity. Science, 12:825-828.

34


Barrows, G, Sexton, S. and Zilberman, D. (2014). Agricultural Biotechnology: The Promise and Prospects of Genetically Modified Crops. J. Econ. Perspectives, 28 (1):99-120. Beer, L.L., Boyd, E.S., Peters, J.W. and Posewitz, M.C. (2009). Engineering algae for biohydrogen and biofuel production. Current Opinions in Biotechnology, 20(3):264-71.Review. Bonny, S. (2008). Genetically modified gyphosate-tolerant soybean in USA: Adoption factors, impacts and prospects. A review. Agro. Sustain. Dev., 28: 21-32. Bouton, J.H. (2007). Molecular breeding of switchgrass for use as a biofuel crop. Current Opinion Genet. Develop., 17(6):553-558.Review. Brimner, T.A., Gallivan, G.J., Stephenson, G.R. (2004). Influence of herbicide-resistant canola on the environmental impact of weed management. Pest Manag. Sci., 61(1):47-52. Brookes, G., Barfoot, P. (2006). GM Crops: The first ten years–Global socio-economic and environmental impacts in the first ten years of commercial use. J. AgBio. Forum, 9(3):139-151. Brookes, G., Barfoot, P. (2008). GM Crops: Global socio-economic and environmental impacts 1996-2006. J. AgBio Forum, 11(1):21-38. Brookes, G., Barfoot, P. (2009). Global impact of biotech crops: Income and production effects, 1996-2007. J. AgBio Forum, 12(2):184-208. Cheung, P.C.K., Chang, S.T. (2009). Overview of mushroom cultivation and utilization as functional foods. Cheung PCK (Ed). John Willey & Sons Inc. (http://onlinelibrary.wiley.com/doi/10 1002/9780470367285.ch1). Cockell, K.A. (2007). An overview of methods for assessment of iron bioavailability from foods nutritionally enhanced through biotechnology. The J. of AOAC International 90(5):1480-1491. Edgerton, M.D. (2009). Increasing crop productivity to meet global needs for feed, food and fuel. Plant Physiol., 149: 7-13. Fawcett, R., Towery, D. (2003). Conservation tillage and plant biotechnology: How new technologies can improve the environment by reducing the need to plow: CT Information Center, USA (http://www.ctic.purdue.edu/CTIC/Biotech.html). Franche, C., Laplaze, L., Duhoux, E., Bogusz, D. (1998). Actinomycorhizal symbioses: Recent advances in plant molecular and genetic transformation studies. Crit. Rev. Plant Sci., 17(1):1-28. Gomez-Barbero, G., Berbel, J., Rodriguez-Cerezo, E. (2008). BT corn in Spain - the performance of the EU s first GM crop. Nature Biotechnol., 26: 384-386. Hotz, C., McClafferty, B. (2007). From harvest to health: challenges for developing biofortified staple foods and determining their impact on micronutrient status. Food Nutritional Bulletin 28(2 Suppl):S271-9. Hsieh, T.H., Lee, J.T., Yang, P.T., Chiu, L.H., Charng, Y.Y., Wang, Y.C., Chan, M.T. (2002). Heterogy expression of Arabidopsis C-repeat/dehydration response element binding factor I gene confers elevated tolerance to chilling and oxidative stresses in transgenic tomato. Plant Physiol., 129: 1086-1094. Hu, H. (2006). Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proc Natl Acad Sci, U.S.A. 103:12987-12992. IPCC. (2007). Climate Change 2007. Impacts, adaptation and vulnerability. Working Group II Contribution to the IPCC Fourth Assessment Report. Summary to Policymakers. Available online: (http://www.ipcc.ch). Jaglo, K.R., Kleff, S., Amunsen, K.L., Zhang, X., Haake, V., Zhang, J.Z., Deits, T., Thomashow, M.F. (2001). Components of Arabidopsis C-repeat/dehydration response element binding factor or cold-response pathway are conserved in Brasicca napus and other plant species. Plant Physiol., 127: 910-917. Jain, S., Sharma, M.P. (2010). Prospects of biodiesel from Jatropha in India: A review. Renewable and sustainable Energy Rev., 14(2):763-771. Jeong, J. and Guerinot, M.L. (2008). Biofortified and bioavailable: The gold standard for plantbased diets. Proc. Natl. Acad. Sci., U.S.A. 12; 105(6): 1777–1778. Johnsona, J.M.F., Franzluebbersb, A.J., Weyersa, S.L., Reicoskya, D.C. (2007). Agricultural opportunities to mitigate greenhouse gas emissions. Environ. Poll., 150(1):107-124. Kasirajan, L., Boomiraj, K., Bansal, K.C. (2014). Mature embryo-derived wheat transformation for tolerance to moisture stress. Biotechnol. Lett., 36: 1037-1041. Kleter, G.A., Harris, C., Stephenson, G., Unsworth, J. (2008). Comparison of herbicide regimes and the associated potential environmental effects of glyphosate-resistant crops versus what they replace in Europe. Pest Manage. Sci., 64:479-488. Kumar, S., Bansode, R., Malav, M.K., Malav, L. (2015). Role of Agricultural Biotechnology in climate change mitigation. International J. of Applied and Pure Sci. and Agric., 1(4):48-53. Lakshmi, K., Anuradha, C., Boomiraj, K. and Kalaivani, A. (2015). Applications of Biotechnological Tools to Overcome Climate Change and its Effects on Agriculture. Research News For U, 20: 218-222. Lin, B.B., Perfecto, I., Vandermeer, S. (2008). Synergies between agricultural intensification and climate change could create surprising vulnerabilities from crops. BioSci., 58(9): 847-854.


35

Lua, H., Liua, Y., Zhoua, H., Yanga, Y., Chena, M., Liang, B. (2009). Production of biodiesel from Jatropha curcas L. oil. Comp. Chem. Eng., 33 (5):1091-1096. Lybbert, T., Sumner, D. (2010). Agricultural technologies for climate change mitigation and adaptation in developing countries: Policy options for innovation and technology diffusion. ICTSD-IPC Platform on Climate Change, ATS Policy Brief 6 (http://ictsd.org/i/publications /77118/). Maeder, P., Filessbach, A., Dubois, D., Gunst, L., Fried, P. Niggli, U. (2002). Soil fertility and biodiversity in organic farming. Sci., 296(5573):1694-1697. Manavalan, L.P., Guttikonda, S.C., Tran, L.P., Nguyen, H.T. (2009). Physiological and molecular approached to improve drought resistance in soybean. Plant cell Physiol., 50(7):1260-1276. Mara Hvistendahl, M. (2010). China's Push to Add by Subtracting Fertilizer. Science, 327(5967): 801. May, M.J., Gillian Champion, G.T., Dewar, A.M., Qi, A., Pidgeon, J.D. (2005). Management of genetically modified herbicide-tolerant sugar beets for spring and autumn environmental benefit. Proc. Biol. Sci., 272(1559):111-119. Mayer, J.E. (2007). Delivering golden rice to developing countries. The J. of AOAC International 90(5):14451449. Memon, A.R., Schröder, P. (2009). Implications of metal accumulation mechanisms to phytoremediation. Environ. Sci. Pollution Res. International., 16(2):162-175. Review. Moghaieb, R.E., Nakamura, A., Saneoka, H., Fujita, K. (2011). Evaluation of salt tolerance in ectoine-transgenic tomato plants (Lycopersicon esculentum) in terms of photosynthesis, osmotic adjustment, and carbon partitioning. GM Crops, 2(1):58-65. Morris, J. Keli, M., Hawthorne, K.M., Hotze, T., Abrams, S.A. and Hirschi, K.D. (2008). Nutritional impact of elevated calcium transport activity in carrots. Proc. Natl. Acad. Sci., 105:1431-1435. Mtui, G.Y.S. (2011). Involvement of biotechnology in climate change adaptation and mitigation: Improving agricultural yield and food security. International J. Biotechnol. and Mol. Bio. Res., 2(13):222-231. Naqvi, S., Zhu, C., Farre, G., Ramessar, K., Bassie, L., Breitenbach, J., Perez, Conesa, D., Ros. G., Sandmann, G., Capell, T., Christou, P. (2009). Transgenic multivitamin corn through biofortification of endosperm with three vitamins representing three distinct metabolic pathways. Proc. Natl. Acad. Sci., U.S.A. 106(19):7762-7767. Ogunseitan, O.A. (2003). Biotechnology and industrial ecology: New challenges for a changing global environment. Afr. J. Biotechnol., 2(12):593-601. Powlson, D.S., Whitmore, A.P., Goulding, K.W.T. (2011). Soil carbon sequestration to mitigate climate change: A critical re-examination to identify the true and false. Eur. J. Soil Sci., 62: 42-55. Ruane, J., Sonnino, F., Steduro, R., Deane, C. (2008). Coping with water scarcity in developing countries: What role for agricultural biotechnologies? Land and water Discussion Paper No. 7. Food and Agricultural organization (FAO). p. 33. Ruane, J., Sonnino, F., Steduro, R., Deane, C. (2008). Coping with water scarcity in developing countries: What role for agricultural biotechnologies? Land and water Discussion Paper No. 7. Food and Agricultural organization (FAO). p. 33. Saikia, S.P., Jain, V. (2007). Biological nitrogen fixation with non-legumes: An achievable target or a dogma? Curr. Sci., 93(3):317-322. Sarin, R., Sharma, M., Sinharay, S., Malhotra, R.K. (2007). Jatropha-palm biodiesel blends: An optimum mix for Asia. Fuel, 86(10-11):1365-1371. Tammisola, J. (2010). Towards much more efficient biofuel crops-Can sugarcane pave the way? GM Crops 14: 181-198. Treasury, H.M. (2009). Green biotechnology and climate change. Euro Bio. 12. Available online at http://www.docstoc.com/docs/15021072/Green-Biotechnology-and-Climate-Change. Van Camp, W. (2005). Yield enhancing genes: seeds for growth. Curr. Opin. Biotechnol., 16: 147-153. Wang, W., Vinocur, B., Altman, A. (2003). Plant responses to drought, salinity and extreme temperatures: Towards genetic engineering for stress tolerance. Planta, 218:1-14. Wang, W., Vinocur, B., Shoseyov, O., Altman, A. (2001). Biotechnology of plant osmotic stress tolerance: Physiological and molecular considerations. Acta Hort., 560:285-292. West, T.O., Post, W.M. (2002). Soil organic carbon sequestration rates by tillage and crop rotation: A global analysis. Soil Sci. Soc. Amer. J., 66: 930-1046. Wu, G., Kang, H., Zhang, X., Shao, H., Chu, L. and Ruan, C.A. (2007). critical review on the bioremoval of hazardous heavy metals from contaminated soils: Issues, progress, eco-environmental concerns and opportunities. J. Hazardous Materials 28. Yamanouchi, U., Yano, M., Lin, H., Ashikari, M., Yamada, K. (2002). A rice spotted leaf gene Sp17 encodes a heat stress transcription factor protein. Proc. Natl. Acad. Sci., USA 99: 7530-7535. Yan, Y., Yang, J., Dou, Y., Chen, M., Ping, S., Peng, J., Lu, W., Zhang, W., Yao, Z., Li, H., Liu, W., He, S., Geng, L., Zhang, X., Yang, F., Yu, H., Zhan, Y., Li, D., Lin, Z., Wang, Y., Elmerich, C., Lin, M., Jin, Q.

36


(2008). Nitrogen fixation island and rhizophere competence traits in the genome of root-associated Pseudomonas stutzeri A1501. Proc. Nat. Acad. Sci., 105 (21):7564-7569. Zahran, H.H. (2001). Rhizobia from wild legumes: Diversity, taxonomy, ecology, nitrogen fixation and biotechnology. J. Biotechnol., 91:143-153. Zhang, H.X., Blumwald, E. (2002). Transgenic salt-tolerant tomato plants accumulate salt in foliage but not in fruit. Nature Biotechnol., 19:765-768. Zhe, D., Mithcell, P.D. (2011). Can conventional crop producers also benefit from Bt technology? Agricultural and Applied Association series. Paper No. 103584. Zhu, C., Naqvi, S., Gomez-Galera, S., Pelacho, A.M., Capell, T., Christou, P. (2007). Transgenic strategies for the nutritional enhancement of plants. Trends Plant Sci., 12(12):548-55. Zhu, K.J. (2001). Plant salt tolerance. Trends in Plant Sci., 6(2):66-71.

CLIMATE CHANGE AND ITS EFFECT ON FOOD SECURITY Ashish Kumar Maurya1, Santosh Kumar2, Vikas Kumar Jain3, Girish Tantuway4, Indra Bahadur Maurya5 and Indrajeet Kumar Mandal6 1&3

Department of Horticulture, 2&4Department of Genetics and Plant Breeding, 5&6Department of SSAC, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi–221 005, Email: [email protected], Corresponding Author: Ashish Kumar Maurya

T

he global temperature is increasing since about 1850 after industrialization, mainly due to the accumulation of various greenhouse gases in the atmosphere. The main causes of this are the burning of fossil fuels to meet increasing energy demand, and spread of intensive agriculture to meet increasing food demand due to population growth, which is often accompanied by deforestation. Though process of global warming shows no signs of abating and is expected to bring about long term changes in weather conditions. These changes will have major impacts on all the four dimensions of food security viz. food availability, food accessibility, food utilization and food system stability. Until about 200 years ago, climate was a critical determinant for food security. After industralization, however, human’s ability to control the forces of nature and manage its own environment has grown enormously. People can now create artificial microclimates, breed plants and animals having desired characters, and control the flow of water. As advances in processing and transport technologies have made food processing and packaging a new area of economic activity. This has allowed food growers, processors, distributors and retailers to develop long-distance marketing chains that enables to move produce and packaged foods throughout the world at high speed and relatively low cost. At the global level, these days food system performance depends more on climate than it did 200 years ago; the possible impacts of climate change on food security have tended to be viewed with most concern in that locations where rainfed agriculture is still the primary source of food and income. Climate and Climate System: Climate refers to the characteristic conditions of the earth’s lower surface atmosphere at a specific location; weather refers to the day-to-day fluctuations in these conditions at the same location. The system of climate is highly complex. Under the influence of the sun’s radiation, it determines the earth’s climate (WMO, 1992) and consists of:  The atmosphere: gaseous matter above the earth’s surface;  The hydrosphere: liquid water on or below the earth’s surface;  The cryosphere: snow and ice on or below the earth’s surface;  The lithosphere: earth’s land surface (e.g., rock, soil and sediment);  The biosphere: earth’s plants and animal life, including humans. Food Security: FAO stressed that “Food security depends more on socio-economic conditions than on agroclimatic ones, and on access to food rather than the production or physical availability of food”. To evaluate the potential impacts of climate change on food security, “it is not enough to assess the impacts on domestic production in food-insecure countries. One also needs to Assess climate change impacts on foreign exchange earnings;  Determine the ability of foodsurplus countries to increase their commercial exports or food aid; and  Analyse how theincomes of the poor will be affected by climate change” (FAO, 2003b). Food System: Food systems encompass (i) activities related to the production, processing, distribution, preparation and consumption of food; and (ii) the outcomes of these activities contributing to food security (food availability, with elements related to production, distribution and exchange; food access, with elements related to affordability, allocation and preference; and food use, with elements related to nutritional value, social value and food safety). The outcomes also contribute to environmental and other securities (e.g. income). Interactions between and within biogeophysical and human environments influence both the activities and the outcomes. Food Chain: The sum of all the processes in a food system is sometimes referred to as a food chain, and often given slogans such as “from plough to plate” or “from farm to fork”. The main conceptual difference between a food system and a food chain is that the system is holistic, comprising a set of

38


simultaneously interacting processes, whereas the chain is linear, containing a sequence of activities that need to occur for people to obtain food. The concept of the food system is useful for scientists investigating cause and effect relationships and feedback loops, and is important for the technical analyses that underpin policy recommendations. A food system comprises multiple food chains operating at the global, national and local levels. Some of these chains are very short and not very complex. Climate is a particularly important driver of food system performance at the farm end of the food chain, affecting the quantities and types of food produced and the adequacy of production-related income. Extreme weather events can damage or destroy transport and distribution infrastructure and affect other non-agricultural parts of the food system adversely. Climate, Agriculture and Food Security: Agriculture is important for food security in two ways: it produces the food people eat; and (perhaps even more important) it provides the primary source of livelihood for 36 percent of the world’s total workforce. In the heavily populated countries of Asia and the Pacific, this share ranges from 40 to 50 percent, and in sub-Saharan Africa, two-thirds of the working population still make their living from agriculture (ILO, 2007). Agriculture, forestry and fisheries are all sensitive to climate. Their production processes are therefore likely to be affected by climate change. In general, impacts are expected to be positive in temperate regions and negative in tropical ones, but there is still uncertainly about how projected changes will play out at the local level, and potential impacts may be altered by the adoption of risk management measures and adaptation strategies that strengthen preparedness and resilience. The food security implications of changes in agricultural production patterns and performance are of two kinds:  Impacts on the production of food will affect food supply at the global and local levels. Globally, higher yields in temperate regions could offset lower yields in tropical regions. However, in many low-income countries with limited financial capacity to trade and high dependence on their own production to cover food requirements, it may not be possible to offset declines in local supply without increasing reliance on food aid.  Impacts on all forms of agricultural production will affect livelihoods and access to food. Producer groups that are less able to deal with climate change, such as the rural poor in developing countries, risk having their safety and welfare compromised. Food Security and Climate Change: A Conceptual Framework: Food systems exist in the biosphere, along with all other manifestations of human activity. some of the significant changes in the biosphere that are expected to result from global warming will occur in the more distant future, as a consequence of changes in average weather conditions. The most likely scenarios of climate change indicate that increases in weather variability and the incidence of extreme weather events will be particularly significant now and in the immediate future. The projected increases in mean temperatures and precipitation will not manifest through constant gradual changes, but will instead be experienced as increased frequency, duration and intensity of hot spells and precipitation events. Whereas the annual occurrence of hot days, and maximum temperatures are expected to increase in all parts of the globe, the mean global increase in precipitation is not expected to be uniformly distributed around the world. In general, it is projected that wet regions will become wetter and dry regions dryer. For this analysis, a conceptual framework on climate change and food security interactions was developed to highlight the variables defining the food and climate systems. Climate change affects food security outcomes for the four components of food security–food availability, food accessibility, food utilization and food system stability–in various direct and indirect ways. Climate change variables influence biophysical factors, such as plant and animal growth, water cycles, biodiversity and nutrient cycling, and the ways in which these are managed through agricultural practices and land use for food production. However, climate variables also have an impact on physical/human capital–such as roads, storage and marketing infrastructure, houses, productive assets, electricity grids, and human health – which indirectly changes the economic and socio-political factors that govern food access and utilization and can threaten the stability of food systems. All of these impacts manifest themselves in the ways in which food system activities are carried out. The framework illustrates how adaptive adjustments to food system activities will be needed all along the food chain to cope with the impacts of climate change. The climate change

Climate Change and its Effect on Food Security

39

variables considered in the CCFS framework are: the CO2 fertilization effect of increased greenhouse gas concentrations in the atmosphere;  Increasing mean, maximum and minimum temperatures;  Gradual changes in precipitation:  Increase in the frequency, duration and intensity of dry spells and droughts;  Changes in the timing, duration, intensity and geographic location of rain and snowfall;  Increase in the frequency and intensity of storms and floods;  Greater seasonal weather variability and changes in start/end of growing seasons. Vulnerability to Climate Change Food system vulnerability: A food system will vulnerable when one or more of the four components of food security i.e. food availability, food accessibility, food utilization and food system stability will uncertain and insecure. 1. Food availability determined by the physical quantities of food that are produced, stored, processed, distributed and exchanged. It is the net amount remaining after production, stocks and imports have been summed and exports deducted for each item included in the food balance sheet. High market prices for food are usually a reflection of inadequate availability; persistently high prices force poor people to reduce consumption below the minimum required for a healthy and active life, and may lead to food riots and social unrest. Growing scarcities of water, land and fuel are likely to put increasing pressure on food prices, even without climate change. Potential Impacts of Climate Change on Food Availability Production: There has been a lot of research on the impacts that climate change might have on agricultural production, particularly cultivated crops. Some 50 percent of total crop production comes from forest and mountain ecosystems, including all tree crops, while crops cultivated on open, arable flat land account for only 13 percent of annual global crop production. Production from both rainfed and irrigated agriculture in dryland ecosystems accounts for approximately 25 percent, and rice produced in coastal ecosystems for about 12 percent (Millennium Ecosystem Assessment, 2005). This is expected to occur primarily in temperate zones, with yields expected to increase by 10 to 25 percent for crops with a lower rate of photosynthetic efficiency (C3 crops), and by 0 to 10 percent for those with a higher rate of photosynthetic efficiency (C4 crops), assuming that CO2 levels in the atmosphere reach 550 parts per million (IPCC, 2007c); these effects are not likely to influence projections of world food supply, however (Tubiello et al., 2007). Mature forests are also not expected to be affected, although the growth of young tree stands will be enhanced (Norby et al., 2005). Moderate warming (increases of 1 to 3 ºC in mean temperature) is expected to benefit crop and pasture yields in temperate regions, while in tropical and seasonally dry regions, it is likely to have negative impacts, particularly for cereal crops. Warming of more than 3 ºC is expected to have negative affects on production in all regions (IPCC, 2007c). Storage, Processing and Distribution: Food production varies spatially, so food needs to be distributed between regions. The major agricultural production regions are characterized by relatively stable climatic conditions, but many food-insecure regions have highly variable climates. The main grain production regions have a largely continental climate, with dry or at least cold weather conditions during harvest time, which allows the bulk handling of harvested grain without special infrastructure for protection or immediate treatment. Depending on the prevailing temperature regime, however, a change in climatic conditions through increased temperatures or unstable, moist weather conditions could result in grain being harvested with more than the 12 to 14 percent moisture required for stable storage. Because of the amounts of grain and general lack of drying facilities in these regions, this could create hazards for food safety, or even cause complete crop losses, resulting from contamination with microorganisms and their metabolic products. It could lead to a rise in food prices if stockists have to invest in new storage technologies to avoid the problem. Distribution depends on the reliability of import capacity, the presence of food stocks and when necessary access to food aid (Maxwell and Slater, 2003). These factors in turn often depend on the ability to store food. Storage is affected by strategies at the national level and by physical infrastructure at the local level. Transport infrastructure limits food distribution in many developing countries. Where infrastructure is affected by climate, through either heat stress on roads or increased

40


frequency of flood events that destroy infrastructure, there are impacts on food distribution, influencing people’s access to markets to sell or purchase food (Abdulai and Crole Rees, 2001). FAO projects that the impact of climate change on global crop production will be slight up to 2030. After that year, however, widespread declines in the extent and potential productivity of cropland could occur, with some of the severest impacts likely to be felt in the currently food-insecure areas of sub-Saharan Africa, which have with the least ability to adapt to climate change or to compensate through greater food imports. 2. Food Accessibility is a measure of the ability to secure entitlements, which are defined as the set of various resources (including economic and social, legal, political,) that an individual requires obtaining access to food. The mere presence of an adequate supply does not ensure that a person can obtain and consume food – that person must first have access to the food through his/her entitlements. The enjoyment of entitlements that determine people’s access to food depends on allocation mechanisms, affordability, and cultural and personal preferences for particular food products. Increased risk exposure resulting from climate change will reduce people’s access to entitlements and undermine their food security. Potential Impacts of Climate Change on Food Access Allocation: Food is allocated through various distribution mechanisms like markets and non-markets. Factors that determine whether people will have access to sufficient food through markets are incomegenerating capacity, amount of remuneration received for products and goods sold or labour and services rendered, and the ratio of the cost of a minimum daily food basket to the average daily income. Non-market mechanisms include production for family consumption, food preparation and allocation practices within the household, and public or charitable food distribution schemes. Rural people who produce a substantial part of their own food, climate change impacts on food production may reduce availability to the point that allocation choices have to be made within the household. In such cases a family might reduce the daily amount of food consumed equally among all household members, or allocate food preferentially to certain members, often the able-bodied male adults, who are assumed to need it the most to stay fit and continue working to maintain the family. Affordability: In most of the county poverty is measured by the ratio of the cost of a minimum daily food basket to the average daily income (World Bank Poverty Net, 2008). When this ratio falls below a certain threshold level, it signifies that food is affordable and people are not impoverished; when it exceeds the established threshold level, then food is not affordable and people are having difficulty in obtaining enough food. This criterion is an indicator of chronic poverty. Income-generating capacity and the remuneration received for products and goods sold or labour and services rendered are the primary determinants of average daily income. The incomes of all farming households depend on what they obtain from selling some or all of their crop product and animals each year. Commercial farmers are usually protected by insurance, but small-scale farmers in developing countries are not protected by insurance, and their incomes can decline sharply if their own crops fail and they have nothing to sell when prices are high. Preference: It determines the kinds of food households will attempt to obtain. Climate change may affect both the physical and the economic availability of certain preferred food items, which might be impossible to meet some preferences. Changes in availability and relative prices for major food items may result in people either changing their food basket, or spending a greater percentage of their income on food when prices of preferred food items increase. 3. Food Utilization refers to the use of food and how a person is able to secure essential nutrients from the food he consumed. It encompasses the nutritional value of the diet, including its composition and preparation methods; the social values of foods, which dictate what kinds of food should be served and eaten at different times of the year and on different occasions. The quality and safety of the food supply can cause loss of nutrients in the food and the spread of food-borne diseases if not of a sufficient standard. Climatic conditions are can bring both negative and positive changes in dietary patterns and new challenges for food safety, which may affect nutritional status in various ways. Potential Impacts on Food Utilization Nutritional Value: Food insecurity is usually associated with malnutrition, because the diets of people who are unable to satisfy all of their food needs usually contain a high proportion of staple foods and lack the variety needed to fulfill nutritional requirements. The main impact of climate

Climate Change and its Effect on Food Security

41

change on nutrition is likely to be felt indirectly, through its effects on income and capacity to purchase a number of foods. The Social and Cultural Values will also be affected by the availability and affordability of food. The social values of foods are important determinants of food preferences, with foods that are accorded high value being preferred, and those accorded low value being avoided. In many traditional cultures, feasts involving the preparation of specific foods mark important seasonal occasions, rites of passage and celebratory events. The increased cost or absolute unavailability of these foods could force cultures to abandon their traditional practices, with unforeseeable secondary impacts on the cohesiveness and sustainability of the cultures themselves. In many cultures, the reciprocal giving of gifts or sharing of food is common. It is often regarded as a social obligation to feed guests, even when they have dropped in unexpectedly. In conditions of chronic food scarcity, households’ ability to honour these obligations is breaking down, and this trend is likely to be reinforced in locations where the impacts of climate change contribute to increasing incidence of food shortages. 3. Food System Stability is determined by the availability of, and access to, food. In long-distance food chains, storage, processing, distribution and marketing processes contain in-built mechanisms that have protected the global food system from instability in recent times. However, if projected increases in weather variability materialize, they are likely to lead to increases in the frequency and magnitude of food emergencies for which neither the global food system nor affected local food systems are adequately prepared. Potential Impacts of Climate Change on Food System Stability Stability of Supply: Many crops which have annual cycles, and their yields fluctuate with climate variability, particularly temperature and rainfall. Therefore it is challenging to maintain the continuous food supply. Droughts and floods are a particular threat to food stability. Both are expected to become more frequent, more intense and less predictable as a consequence of climate change. In rural areas that depend on rainfed agriculture for an important part of their local food supply, changes in the amount and timing of rainfall within the season and an increase in weather variability are likely to aggravate the precariousness of local food systems. Stability of Access: The affordability of food is determined by the relationship between household income and the cost of a typical food basket. Global food markets may exhibit greater price volatility, jeopardizing the stability of returns to farmers and the access to purchased food of both farming and non-farming poor people. Conclusion: Achieving food security means ensuring that an adequate amount of nutritious food is available, accessible, and usable for all people. The universal food security is one of the greatest human development challenges facing the world, despite significant progress in recent decades. There were about 1.01 billion (19% of global population) people who were estimated to be food insecure in 1990–1992. This number has fallen to about 805 million people today, or 11% of the global population. Hence the number of food-insecure people in the world has been reduced by about 20%, but at least 2 billion live with insufficient nutrients and about 2.5 billion are overweight or obese, though not necessarily receiving adequate nutrition. Food insecurity is widely distributed, afflicting urban and rural populations in wealthy and poor nations. Global average temperature is projected to increase by another 1–2°C by 2050 and 1–4°C by 2100, with accompanying increases in precipitation, precipitation intensity, floods, extreme heat events (day and night), droughts, and sea level, as well as changes in precipitation patterns, and decreased soil moisture. Climate change is very likely to affect global, regional, and local food security by disrupting food availability, decreasing access to food, and making utilization more difficult. The potential of climate change to affect global food security is important for food producers and consumers in the world. Climate change risks extend beyond agricultural production to other elements of global food systems that are critical for food security, including the processing, storage, transportation, and consumption of food. Climate risks to food security increase as the magnitude and rate of climate change increases. Higher emissions and concentrations of greenhouse gases are much more likely to have damaging effects than lower emissions and concentrations Effective adaptation can reduce food-system vulnerability to climate change and reduce detrimental climate-change effects on food security, but socioeconomic conditions can impede the adoption of technically feasible adaptation options. The context of climate change allows for the identification of multiple food-

42


security intervention points that are relevant to decision makers at every level. Accurately projecting climate-change risks to food security requires consideration of other large scale changes. References Abdulai, A. & CroleRees, A. (2001). Constraints to income diversification strategies: Evidence from Southern Mali. Food Policy, 26(4): 437-452 FAO. (2003b). World agriculture: Toward 2015/2030, Chapter 13. Rome, Earthscan. ILO. (2007). Chapter 4. Employment by sector. In Key indicators of the labour market (KILM), 5th edition. www.ilo.org/public/english/employment/strat/kilm/download/kilm04.pdf. IPCC. (2007c). Climate Change 2007. the physical science basis. Contribution of Working Group I to the Fourth Assessment Report of IPCC. Cambridge. UK. Cambridge University Press. Maxwell, S. & Slater, R. (2003). Food policy old and new. Development Policy Review, 21(5-6): 531-553. Millennium Ecosystem Assessment. (2005). Ecosystems and human well-being: Synthesis. Washington DC, Island Press for WRI. Norby, R.J., DeLucia, E.H., Gielen, B., Calfapietra, C., Giardina, C.P., King, J.S, Ledford, J., McCarthy, H.R., Moore, D.J.P., Ceulemans, R., De Angelis, P., Finzi, A.C., Karnosky, D.F., Kubiske, M.E., Lukac, M., Pregitzer, K.S., Scarascia-Mugnozza, G.E., Schlesinger, W.H. & Oren, R. (2005). Forest response to elevated CO2 is conserved across a broad range of productivity. Proceedings of the National Academy of Sciences, 102(50): 18052-18056. Tubiello, F.N., Amthor, J.A., Boote, K., Donatelli, M., Easterling, W.E., Fisher, G., Gifford, R., Howden, M., Reilly, J. & Rosenzweig, C. (2007). Crop response to elevated CO2 and world food supply. European Journal of Agronomy, 26: 215-228. WMO. (1992). International meteorological vocabulary, 2nd edition. Publication No. 182. http://meteoterm.wmo.int/meteoterm/ns?a=T_P1.start&u=&direct=yes&relog=yes#expanded. World Bank PovertyNet. (2008). Measuring poverty. Available at: http://go.worldbank.org/VCBLGGE250.

IMPACT OF CLIMATE CHANGE ON WATER RESOURCE POTENTIAL OF INDIA Bhaskar Pratap Singh, V. K Chandola, Dinesh Kumar, Raj Bahadur and Anshu Gangwar Department of Farm Engineering, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi-221005, E-mail: [email protected], Corresponding Author: Bhaskar Pratap Singh

W

ater, is one the most enviable component provided by the almighty for our living and plays important role in present climatic condition. With the earth facing emergent water challenges in various regions, a change in climate will has an adverse effect on future world which can be implicit by looking at the impact of climate change on our most vital natural resource i.e. water resource. The quantity and quality of existing water resources of our planet to meet human, industrial and environmental demands are directly affected by change in climate. Climate change can cause floods and drought both. Rising of sea levels have a serious effect on coastal aquifers, a major source of urban and regional water supply systems. Although the significance of water to sustainable social and economic growth cannot be undervalued as the water requirement to meet needs of agricultural sector, health sector and energy sector is significantly affected by change in climate. The increase in surface temperature contributes in melting of glaciers, thus frightening the water system supplies on which millions of people depend. Adaptation strategies and policies are needed for managing and reducing the adverse impacts of climate change on water resources. According to a study conducted by the U.S. National Aeronautical and Space Agency (NASA), India lost 109 km3 of groundwater from 2002 to 2008 because of random utilization. In the countries like India, rainfall pattern is highly non-uniform both in terms of time and space. Thus water is required to be accumulated and utilized judicially for meeting the demands of different emerging sectors in a developing country like ours. Efficient water management requires sustainable development of the available surface and ground water resources and their optimal utilizations. Water Resources Potential of India: Facts and Figures: Fresh water availability for the world is only 2.7 %. It is a matter of great concern that 70 % freshwater is used for irrigation purpose all over the world , 22% freshwater is used for industrial purpose all over the globe and rest are used for domestic use . India covers about 2.4 % of world’s area and has a population of 17.1 %. India holds 132nd position among 180 countries all over the world for water availability and 122nd rank for water quality. Increasing population together with sustainable developmental has an increasing pressure on available water resources system. The uneven distribution of water resources and their modification through human use and abuse are primary cause of water scarcity in many regions of the world. All these result in intensifying the load on accessible water resources leading to tensions, conflict among users and too much pressure on the environment and our ecological system. Surface Water: The CWC (Central Water Commission) estimated that the total surface water resources potential on an average during a year is 1869 Billon cubic meter (BCM) out of which only 690 BCM is utilisable. The River Basin Ganga-Brahmaputra-Meghna has annual water resources potential of 1111 BCM out of total 1869 BCM in the country. Ground Water: In 2004, Central Ground Water Board (CGWB) estimated the annual replenishable ground water resource for the country to be 433 BCM. The replenishment source includes 67% from rainfall and 33% of replenishment from other sources such as seepage from canal water, return flow of irrigation, seepage through water bodies and artificial recharge due to water conservation techniques. The total estimated static ground water resource on the basis of the depth of availability of ground water and the productivity of deeper aquifers carried out by Central Ground Water Board is 10,812 BCM. CWC in 2009 revealed that the groundwater resources available for irrigation was 369.6 BCM, while for industrial, domestic and other purposes it was 71 BCM. Availability of Water: According to international norms, a condition is said to be water-stressed when per capita availability of water is less than 1700 m3/year while water scarcity is the case when the value of water availability is below 1000 m3/year. The average annual per capita availability of water considering populace of the country as on census 2001, census 2011 and the projected population for the year 2025 and 2050 is as under:

44

Climate Change and its Implications on Crop Production and Food Security Year 2001 2011 2025 2050

Population (in Millions) 1029 (Acc. 2001 census) 1210 (Acc. 2011 census) 1394 ( projected) 1640 (projected )

Per capita availability (in Cubic Meter/Year ) 1816 1545 1340 1140

Assessment and Intimidation of Climate Change: Climate change hinders the net irrigation demand by increasing the evapotranspiration due to a great rise in atmospheric temperature. An increase in atmospheric pressure also reduces the precipitation of the area. The impact of change in climate was established to be more prominent on seasonal water availability rather than annual. A report states that majority of Indian river basins are already water scarce viz. Cauvery, Pennar, Mahi, Sabermati, Tapi, Luni, rivers flowing east between Mahanadi and Pennar and between Pennar and Kanyakumari and West Flowing rivers of Kutch and Saurashtra. By 2025 four more river basins viz. Ganga, Krishna, Subarnarekha and Indus may add to the list of water scarce basins taking while Godavari basin may also faces the water scarce level by that time. Sea-level rise could raise a wide range of issues in coastal areas. TERI, 1996; Mimura and Yokoki, 2004 revealed that the potential impacts of sea-level rise by one metre include flooding of 5,763 km2 in India and and 2,339 km2 in some Japanese cities. Gupta and Deshpande, 2004 have predicted that by 2050 there will be huge go down in per capita availability of water, due to population growth. Kulkarni et al., 2007 based on a study of 466 glaciers in Chenab, Parbati and Baspa, found that overall glacier area reduced to 1628 km2 in 2007 from 2077 km2 in 1962, an overall deglaciation of 21%. Geological Survey of India (GSI) has revealed that glaciers are diminishing at a shocking rate viz. Gangotri by 17.5 m/year, Milam by 13.3 m/year, Pindari by 23.5 m/year and Zemu 13.2 m/year. Report by Intergovernmental Panel on Climate Change (IPCC): The IPCC is the international body for assessing the science related to climate change. The IPCC was set up in 1988 by the World Meteorological Organization (WMO) and United Nations Environment Programme (UNEP) to provide policymakers with regular assessments of the scientific basis of climate change, its impacts and future risks, and options for adaptation and mitigation. The IPPC Fourth Assessment Report (2007) states that "the water availability per capita in India will decline from about 1820 m3/year in 2001 to as low as 1140 m3/year in 2050. India will reach a state of water stress before 2025. The report also mentions that "the fresh water availability usually drops from around 1900 m3 to 1000 m3 by 2025 in response to the combined effects of population growth and climate change of India. The report has also predicted more intense rain, more floods, and increase in drought-affected areas and extreme precipitation events in other areas. Water stored in glaciers and snow covers are very likely to decline, reducing summer and autumn flows in the Himalayan river systems. In the report, the IPCC proposed that by 2099 average temperatures will go up from 1.56 to 5.44°C in south Asia and rainfall will drop by 6 to 16 % in dry season, while in wet season it will increase by 10 to 31 %. A little increase of temperature i.e. from 0.5 to 1.5°C reduces yield for maize and wheat by 2 to 5% in India. Also, net production in cereals for South Asian countries falls down by 4 to 10 %. Over the coming 100 years, average global sea levels are projected to rise at a rate of 2 to 3 mm per year. In India, sea level rise of 100 cm would submerge 5,763 km3 of the nation’s landmass. Indian deltas like the Ganges, the Godavari, the Krishna, and the Mahanadi are designated as "hotspots" of climate change susceptibility by the IPCC. Glaciers of Himalayan range are decaying at very quick rates, shrinking from the present spread of 500,000 km2 to 100,000 km2 by the 2030 IPCC, 2007. IPCC in its recent assessment report i.e. Fifth Report (2013) clears that since the mid of 20th century human being has been the principal reason of the observed warming; it also reveals that warming in the climatic system is obvious and to reduce climate change it will call for reductions of emissions of greenhouse gases. The report also tells that the warming observed from 1951 to 2010 is approximately 0.6°C to 0.7°C. IPCC, 2013 relates the global mean surface warming by the late 21st century and beyond with the cumulative emissions of carbon dioxide (CO2). Some research had concluded that besides the increase in rainfall in some of the river systems, the consequent runoff for these basins has not essentially increased owing to increase in evapotranspiration for increased temperatures. The case study on Damoder basin by Roy et. al., 2003 on the impact assessment of climate change on river water availability concluded that the decreased peak flows would obstruct

Impact of Climate Change on Water Resource Potential of India

45

natural flushing of stream channels leading to loss of carrying capacity and decreased production of crops grown in period other than monsoon. The National Institute of Hydrology (NIH) has performed sensitivity analysis on some of the Himalayan basins i.e. Sutlej, Spiti and Dokriani and found that for warmer climate, there was reduction in melting from the lower part of the basin owing to a reduction in snow covered area and shortening of the summer melting season and, in contrast, an increase in the melt from the glacierized part owing to larger melt and an extended ablation period. Han et al., 1999 concluded that India and her neighbouring countries like China and Bangladesh are especially susceptible to increasing of their groundwater salinity as well as surface water resources, especially along the coast. Coleman et al., 2005 indicated a total loss of 15,845 km2 of deltaic wetlands over the past 14 years according to an analysis of satellite images of the world's major deltas like Mangoky, Huanhe, Yukon, Danube, Indus, Shatt el Arab, McKenzie, Missisippi, Niger, Nile, Volga, Zambezi, Ganges-Brahmaputra and Mahanadi. Strategic Adaption to Climate Change: Adaptation refers to dealing with the impacts of climate change. Mitigation means dealing with the causes of climate change. Practical actions are needed to manage risks from climate impacts, protecting society and fortifying the flexibility of the economy. Promotion of Adaptation Approaches: To reduce the adverse blows of climate change on water assets of the country and accomplishing its sustainable development and management, there are requirements of developing adaptation strategies. Thus, while planning, designing and operation of the water resources schemes and projects due concern is mandatory to be given to the effect of climate change. These would be reflected in proper assessment of water resources, developing suitable hydrological design practices and operational policies for water projects, putting in place effective flood and drought management strategies, developing efficient irrigation practices, etc. Necessary Policy Changes: Firstly, cooperation at the regional level and in between the neighbouring countries in water security is important and this approach will lead to sharing of information and management of water resources. Secondly, decentralization of decision making, this means that while making policies for water security to cope with the climate changes a bottom to top approach is vital for the well being of humanity. National Action Plan on Climate Change (NAPCC): The NAPCC has identified the eight most important approaches to be adopted to face up with climate change. One of the approaches is National Water Mission (NWM) with an aim to ensure integrated water resources management facilitating to preserve water, minimize water wastage and ensure more fair distribution of water. The NWM will ensure that significant share of water demands for urban areas are met through recycling of waste water, and ensuring that the water needs of coastal cities are fulfilled through adoption of proper technologies such as low temperature desalination technique that permit the use of sea water. The NWP will have to optimize the effectiveness of existing irrigation systems, including rehabilitation of systems that have been run down and also expand irrigation system, wherever practicable, with an endeavour to enhance the storage capacity. Incentive structures will be designed to recharging of ground water sources, supporting water neutral and water positive technologies and implementation of large scale irrigation programmes which rely on drip, sprinklers, and ridge and furrow irrigations. Conclusions: Climate change is a global problem and the effect of this issue can be minimized by not only lying on government policies, rules and regulations but we should have to change our living styles, planting more and more trees, minimizing the use of automobiles and vehicles, avoiding pollution and encouraging society for the conservation of natural resources. For managing adaptive strategies on the impact of climate change on various aspects of water availability in India, we must prepare ourselves for adapting the worst to be happened and we need to enhance our knowledge and skills in each and every area that is applicable for better planning and policy making. These would consist of having better knowledge about present day hydrological and climatic changes, past year’s data for drought and flood conditions, analysis of demand and supply of water on a monthly basis for domestic, agricultural and industrial development and climate change impacts on water quality. References Coleman J. M., Huh O. K., Braud Jr. D. H., Roberts H. H. (2005). Major world delta variability and wetland loss. Gulf Coast Association of Geological Societies (GCAGS) Transactions, Vol: 55, pp. 102-131.

46


Gupta S. K. and Deshpande R. D. (2004). Water for India in 2050: first-order assessment of available options. Current Science, Vol: 86, No. 9, 10. Han, M., Zhao, M. H., Li, D. G. and Cao, X. Y. (1999). Relationship between ancient channel and seawater intrusion in the south coastal plain of the Laizhou Bay. Journal of Natural Disasters, 8, 73-80. IPCC. (2007). Special Report on The Regional Impacts of Climate Change: An Assessment of climate change. Intergovernmental Panel on climate change (IPCC). IPCC. (2013). Climate Change 2013: The Physical Science Basis. Contribution of Working Group I. Fifth Assessment Report of the Intergovernmental Panel on Climate Change. Kulkarni, A. V. (2007). Effect of global warming on the Himalayan Cryosphere, Jalvigyan Sameeksha, Vol: 22, pp. 93-108. Mimura, N. and Yokoki, H. (2004). Sea level changes and vulnerability of the coastal region of East Asia in response to global warming. SCOPE/START Monsoon Asia Rapid Assessment Report. Roy, P. K., Roy, D., Mazumdar, A. and Bose, B. (2003). Vulnerability assessment of the lower GangaBrahmaputra-Meghna basins. Published in proceeding of the NATCOMV&A Workshop on Water Resources, Coastal Zones and Human Health held at IIT Delhi, New Delhi, 27-28 June TERI. (1996). Tata Energy Research Institute, New Delhi, Report No 93/GW/52, submitted to the ford foundation.

IMPACT OF GLOBAL WARMING ON INDIAN AGRICULTURE: MITIGATION AND ADAPTATION Gaurav1, V. K. Verma1, S. K. Verma2 and Sunil Kumar1 1

2

Research scholar and Assistant Professor, Department of Agronomy, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi–221 005, Email: [email protected], Corresponding Author: Gaurav

T

he agricultural sector represents 35% of India’s Gross National Product (GNP) and as such plays a crucial role in the country’s development. Food grain production quadrupled during the post-independence era, this growth is projected to continue. The impact of climate change on agriculture could result in problems with food security and may threaten the livelihood activities upon which much of the population depends. Climate change can affect crop yields (both positively and negatively), as well as the types of crops that can be grown in certain areas, by impacting agricultural inputs such as water for irrigation, amounts of solar radiation that affect plant growth, as well as the prevalence of pests. According to the fourth report of UN IPCC (2007) on climate change, it is indisputable that global warming has serious impacts on the earth and it is very likely that the increase in greenhouse gas emission by anthropogenic activities has caused global warming since the mid-20th century. Especially, this report warns us that, if mankind continues its present level of consumption of fossil fuels (e.g., oil and coal), the average temperature of the earth will rise by up to 6.4 oC by the end of the 21st century (2001~2100) and the sea level will rise by 59cm. In fact, the average temperature of the earth has risen 0.74 oC over the past 100 years (19062005) (Korea Meteorological Agency, 2008). Agriculture production is directly dependent on climate change and weather. Possible changes in temperature, precipitation and CO2 concentration are expected to significantly impact crop growth. The overall impact of climate change on worldwide food production is considered to be low to moderate with successful adaptation and adequate irrigation IPCC (1998) Global agricultural production could be increased due to the doubling of CO2 fertilization effect. Agriculture will also be impacted due to climate changes imposed on water resources Gautam and Kumar (2007) India will also begin to experience more seasonal variation in temperature with more warming in the winters than summers Christensen et al. (2007). India has experienced 23 large scale droughts starting from 1891 to 2009 and the frequency of droughts is increasing. Climate change is posing a great threat to agriculture and food security. Water is the most critical agricultural input in India, as 55% of the total cultivated areas do not have irrigation facilities. India is home to 16% of the world population, but only 4% of the world water resources. Agriculture is directly dependent on climate, since temperature, sunlight and water are the main drivers of crop growth Indian agriculture consumes about 80-85% of the nation’s available water Mall et al. (2005). Global Scenario of Climate Change

Source: IPCC 2007

48


Indian Scenario of Climate Change: The warming may be more pronounced in the northern parts of India. The extremes in maximum and minimum temperatures are expected to increase under changing climate, few places are expected to get more rain while some may remain dry. Leaving Punjab and Rajasthan in the North West and Tamil Nadu in the South, which show a slight decrease on an average a 20 per cent rise in all India summer monsoon rainfall over all states are expected. Number of rainy days may come down (e.g. MP) but the intensity is expected to rise at most of the parts of India (e.g. North East). Gross per capita water availability in India will decline from 1820 m3/ yr in 2001 to as low as 1140 m3/yr in 2050. Corals in Indian Ocean will be soon exposed to summer temperatures that will exceed the thermal thresholds observed over the last 20 years. Annual bleaching of corals will become almost a certainty from 2050. Currently the districts of Jagatsinghpur and Kendrapara in Odisha, Nellore and Nagapattinam in Tamilnadu, and Junagadh and Porabandar districts in Gujarat are the most vulnerable to impacts of increased intensity and frequency of cyclones in India (NATCOM, 2004). The past observations on the mean sea level along the Indian coast show a long-term (100 year) rising trend of about 1.0 mm/year. However, the recent data suggests a rising trend of 2.5 mm/year in sea level along Indian coastline. The sea surface temperature adjoining India is likely to warm up by about 1.5–2.0oC by the middle of this century and by about 2.5–3.5oC by the end of the century. A 1 meter sea-level rise is projected to displace approximately 7.1 million people in India and about 5764 sq km of land area will be lost, along with 4200 km of roads (NATCOM, 2004). Impact of Climate Change on Indian Agriculture: Rainfall in India has a direct relationship with the monsoons which originate from the Indian and Arabian Seas. A warmer climate will accelerate the hydrologic cycle, altering rainfall, magnitude and timing of run-off. In arid regions of Rajasthan state an increase of 14.8 per cent in total ET demand has been projected with increase in temperature Goyal (2004). Therefore, change in climate will affect the soil moisture, groundwater recharge, and frequency of flood or drought, and finally groundwater level in different areas Huntington (2003) and. Allen et al.(2004). India’s agriculture is more dependent on monsoon from the ancient periods. Any change in monsoon trend drastically affects agriculture. Even the increasing temperature is affecting the Indian agriculture. In the Indo-Gangetic Plain, these pre-monsoon changes will primarily affect the wheat crop (>0.5oC increase in time slice 2010-2039, IPCC 2007). In the states of Jharkhand, Odisha and Chhattisgarh alone, rice production losses during severe droughts (about one year in five) average about 40% of total production, with an estimated value of $800 million. Increase in CO2 to 550 ppm increases yields of rice, wheat, legumes and oilseeds by 10-20%. A 1oC increase in temperature may reduce yields of wheat, soybean, mustard, groundnut, and potato by 3-7%. Productivity of most crops to decrease only marginally by 2020 but by 10-40% by 2100 due to increases in temperature, rainfall variability, and decreases in irrigation water. The major impacts of climate change will be on rain fed or un-irrigated crops, which is cultivated in nearly 60% of cropland. A temperature rise by 0.5oC in winter temperature is projected to reduce rain fed wheat yield by 0.45 tonnes per hectare in India (Lal et al., 1998). Possibly some improvement in yields of chickpea, rabi maize, sorghum and millets, and coconut in west coast. Less loss in potato, mustard and vegetables in north-western India due to reduced frost damage. Increased droughts and floods are likely to increase production variability. Climatic element CO2 Sea level rise

Expected changes by 2050's Increase from 360 ppm to 450 600 ppm (2005 levels now at 379 ppm) Rise by 10 -15 cm Increased in south and offset in north by natural subsistence/rebound

Temperature

Rise by 1-2oC. Winters warming more than summers. Increased frequency of heat waves

Precipitation

Seasonal changes by ± 10%

Confidence in prediction Very high

Very high

High

Low

Predicted effects of climate change on agriculture over the next 50 years

Effects on agriculture Good for crops: increased photosynthesis, reduced water use Loss of land, coastal erosion, flooding, salinization of groundwater Faster, shorter, earlier growing seasons, range moving north and to higher altitudes, heat stress risk, increased evapotranspiration Impacts on drought risk' soil workability, water logging irrigation supply, transpiration

Impact of Global Warming on Indian Agriculture: Mitigation and Adaptation Storminess

Variability

Increased wind speeds, especially in north. More intense rainfall events. Increases across most climatic variables. Predictions uncertain

49

Very low

Lodging, soil erosion, reduced infiltration of rainfall

Very low

Changing risk of damaging events (heat waves, frost, droughts floods) which effect crops and timing of farm operations

Source: Climate change and Agriculture, MAFF (2000)

Climate Change–Mitigation and Adaptation in Agriculture  An early warning system should be put in place to monitor changes in pest and disease outbreaks. The overall pest control strategy should be based on integrated pest management because it takes care of multiple pests in a given climatic scenario.  Preventive measures for drought that include on-farm reservoirs in medium lands, growing of pulses and oilseeds instead of rice in uplands, ridges and furrow system in cotton crops, growing of intercrops in place of pure crops in uplands, land grading and levelling, stabilization of field bunds by stone and grasses, graded line bunds, contour trenching for runoff collection, conservation furrows, mulching and more application of Farm yard manure (FYM).  Efficient water use such as frequent but shallow irrigation, drip and sprinkler irrigation for high value crops, irrigation at critical stages.  Efficient fertilizer use such as optimum fertilizer dose, split application of nitrogenous and potassium fertilizers, deep placement, use of neem, karanja products and other such nitrification inhibitors, liming of acid soils, use of micronutrients such as zinc and boron, use of sulphur in oilseed crops, integrated nutrient management.  Adopt resource conservation technologies such as no-tillage, laser land levelling, direct seeding of rice and crop diversification which will help in reducing in the global warming potential. Crop diversification can be done by growing non-paddy crops in rain fed uplands to perform better under prolonged soil moisture stress in kharif.  Provide incentives to farmers for resource conservation and efficiency by providing credit to the farmers for transition to adaptation technologies.  Provide technical, institutional and financial support for establishment of community banks of food, forage and seed. Conclusion: Agriculture and human well-being will be negatively affected by climate change. Crop yields will decline, production will be affected, crops and other agricultural commodities prices will increase, and consumption of cereals will fall, leading to reduced calorie intake and increased child malnutrition. By adopting efficient agricultural practices effect of climate change are managed in favour of growth and development of crop as well as minimized risk on natural resources. These stark results suggest the following policy and program recommendations:  Design and implement good overall development policies and programs.  Increase investments in agricultural production.  Reinvigorate national research and extension programs.  Improve global data collection, dissemination, and analysis.  Make agricultural adaptation a key agenda point within the international climate negotiation process.  Recognize that enhanced food security and climate-change adaptation go hand in hand.  Support community-based adaptation strategies. References Allen, D.M., Mackie, D.C. and Wei, M. (2004). Groundwater and climate change: a sensitivity analysis for the ‘Grand Forks’ aquifer, southern British Columbia. Hydrogeol. J. 12: 270-290. Christensen, J.H., Hewitson, B., Busuioc, A., Chen, A. and Gao, X. (2007). Regional Climate Projections. In: climate change: the physical science basis. Cambridge University Press. Cambridge, United Kingdom. Cruz, R.V., Harasawa, H., Lal, M., Wu, S. and Anokhin, Y. (2007). Climate Change: Impacts, Adaptation and Vulnerability. Contribution of working group ii to the fourth assessment report of the intergovernmental panel on climate change. Cambridge University Press, Cambridge, UK. Gautam, H.R. and Kumar, R. (2007). Need for rainwater harvesting in agriculture. J. Kurukshetra 55: 12-15. Goyal RK. 2004. Sensitivity of evapotranspiration to global warming: a case study of arid zone of Rajasthan (India). Agric. Water Manage. 69: 1-11.

50


Huntington, T.G. (2003). Climate warming could reduce runoff significantly in New England. Agric. for Meteorol. 117: 193-201. IPCC. (1998). Principles governing IPCC work, Approved at the 14th session of the IPCC. IPCC. (2007). Climate Change 2007: Synthesis Report. Contribution of Working Group I, II and III to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. Korea Meteorological Agency. (2008). Understanding of Climate Change and Scenario Application. Lal, M., Singh, K. K., Srinivasan, G., Rathore, L. S., and Saseendran, A. S. 1998. “Vulnerability of Rice and Wheat Yields in NW-India to Future Change in Climate,” Agricultural and Forest Meteorology, 89, pp. 101–14. Mall, R.K., Gupta, A., Singh, R., Singh, R.S. and Rathore, L.S. (2005). Water resources and climate change: An Indian perspective. Current Science 90: 1610-1626.

EFFECT OF CLIMATIC CHANGES ON MYCORRHIZA 1

Maneesh Kumar1, Sumit Rai1, Avinash Kumar Rai1, Priyanka Rani2 and Y.V. Singh1

Department of Soil Science & Agricultural Chemistry, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi-221005, (U.P.), India, Email: [email protected] and 2Veer Kunwar Singh College of Agriculture, Dumrao, Buxar-802119, Bihar Agriculture University, Sabour, Baalpur, Corresponding Author: Sumit Rai

M

ycorrhizas may be balanced mutualistic associations in which the fungus and plant exchange commodities required for their mutual survival and growth. However, mycorrhizal fungi also function as endophytes, necrotrophs and antagonists of hosts or non-hosts plants, with roles that vary during the lifespan of their associations. Mycorrhizas also encompass mycoheterotrophic plants, which have exploitative mycorrhizas where transfer processes apparently benefit only plants. Bellgard and Williams (Bellgard et al., 2011) have drawn four hypotheses: (1) mycorrhizal diversity evolved in response to changes in Global Climate Change (GCC) environmental drivers, (2) mycorrhizal diversity will be modified by present changes in GCC environmental drivers, (3) mycorrhizal changes in response to ecological drivers of GCC will in turn modify plant, community, and ecosystem responses to the same, and (4) Mycorrhizas will continue to evolve in response to present and future changes in GCC factors. The drivers of climate change examined here are: CO2 enrichment, temperature rise, altered precipitation, increased N-deposition, habitat fragmentation, and biotic invasion increase. These impact the soil-rhizosphere, plant and fungal physiology and/or ecosystem(s) directly and indirectly. Direct effects include changes in resource availability and change in distribution of mycorrhizas. Indirect effects include changes in below ground allocation of C to roots and changes in plant species distribution. GCC ecological drivers have been partitioned into four putative time frames: (1) Immediate (1–2 years) impacts, associated with ecosystem fragmentation and habitat loss realized through loss of plant-hosts and disturbance of the soil; (2) Short-term (3–10 year) impacts, resultant of biotic invasions of exotic mycorrhizal fungi, plants and pests, diseases and other abiotic perturbations; (3) Intermediate-term (11–20 year) impacts, of cumulative and additive effects of increased N (and S) deposition, soil acidification and other pollutants; and (4) Long-term (21–50+ year) impacts, where increased temperatures and CO2 will destabilize global rainfall patterns, soil properties and plant ecosystem resilience. Due to dependence on their host for C-supply, orchid mycorrhizas and all heterotrophic mycorrhizal groups will be immediately impacted through loss of habitat and plant-hosts. Ectomycorrhizal (ECM) associations will be the principal group subject to short-term impacts, along with Ericoid mycorrhizas occurring in high altitude or high latitude ecosystems. This is due to susceptibility (low buffer capacity of soils) of many of the ECM systems and that GCC is accentuated at high latitudes and altitudes. Vulnerable mycorrhizal types subject to intermediate-term GCC changes include highly specialized ECM species associated with forest ecosystems and finally arbuscular mycorrhizas (AM) associated with grassland ecosystems. Although the soils of grasslands are generally well buffered, the soils of arid lands are highly buffered and will resist even fairly long term GCC impacts, and thus these arid, largely AM systems will be the least affect by GCC. Once there are major perturbations to the global hydrological cycle that change rainfall patterns and seasonal distributions, no aspect of the global mycorrhizal diversity will remain unaffected. Table 1. Functions of mycorrhizal fungi in ecosystem processes (Bellgard et al., 2011; Miller, 1995) Physiological and Metabolic: Plant-Level  Decomposition of organic matter; volatilization of C, H, and O  Elemental release and mineralization of N, P, K, S and other ions  Elemental storage: immobilization of elements  Accumulation of toxic materials  Synthesis of humic materials  Instigation of mutualistic, commensalistic and exploitive symbioses  Increased survivability of seedlings  Protection from root pathogens Ecological: Plant-Community-Level

52


 Facilitation of energy exchange between above- and below-ground systems  Promotion and alteration of niche development  Regulation and successional trajectory and velocity Mediative and Integrative: Plant-Ecosystem/Biome-Level  Facilitation and transport of essential elements and water from soil to plant roots  Facilitation of plant-to-plant movement of essentials elements and carbohydrates  Regulation of water and ion movement through plants  Regulation of photosynthetic rate of primary producers  Regulation of C allocation below ground  Modification of soil permeability and promotion of aggregation  Modification of soil ion exchange and water-holding capacity  Detoxification of soil (degradation, volatilization or sequestration)  Participation in saprotrophic food chains  Production of environmental biochemicals (antibiotics, enzymes and immunosuppressants)

Figure-1. Environmental drivers conceptually impart changes to plants which ultimately influence mycorrhizal associations and mycorrhizal fungi (Bellgard et al., 2011)

The mechanisms that can alter mycorrhizal function can be viewed as either: 1. Direct Effects Changing  The amount of resources available to mycorrhizas (e.g., CO2 and nutrient enrichment; temperature increase; water availability and gas exchange in the rhizosphere), or  The distribution of mycorrhizas and mycorrhizal propagules. 2. Indirect Affects Changing  The below-ground allocation of C to roots and mycorrhizas, or  The host-plant species distribution.  Direct effects of GCC-mediated changes to mycorrhizal function 1. Changes to Resource Availability: Mycorrhizal fungi exist in an environment rich in CO2, both inside the root and in the soil (Fitter et al., 2000). Little information is available on the direct impact of CO2 enrichment on the physiology of the extramatrical hyphae of mycorrhizas. Elevated aboveground CO2 often increases internal root colonization, but this is a result of an increase in plant growth, rather than a direct stimulation of mycorrhizal physiology. 2. Changes to Distribution of Mycorrhizas and Mycorrhizal Propagules: Natural ecosystems are subject to a continuum of disturbance ranging from partial degradation to complete destruction caused by conversion to a new land use (e.g., agriculture or mining). The disturbance of topsoil associated with habitat fragmentation is known to decrease the infective capacity of the extramatrical hyphal network of AM fungi Patterns of mycorrhizal fungal spore dispersal affect gene flow, population structure and fungal community structure (Lilleskov et al., 2005). Sporulation and reproduction of mycorrhizal fungi, like colonization of the root system, are directly affected by seasonal dynamics that govern their growth and reproductive physiology. Indirect Effects of GCC-mediated Changes 3. Change in C-allocation to Roots and Mycorrhizas: Because mycorrhizal fungi acquire most of or all their C directly from living plants, the increase in below-ground allocation of C to roots may mean a concomitant increase in C-supply for all types of mycorrhizas (Norby et al., 1986; O‘Neill,

Effect of Climatic Changes on Mycorrhiza

53

1994). An increase in C supply to the roots will enhance energy-dependent processes in all mycorrhizal types, notably their development and physiological and biochemical activities (Dighton et al., 1991), as C is limiting for the production of fungal biomass. Increased CO2 concentration has been reported to increase both percentage root colonization and growth of the external mycelial network in AM fungi. 4. Change in Host-plant Species Distribution: GCC-mediated shifts in plant species (e.g., advancement of treelines) (Harsch et al., 2009), will mean a concomitant shift in distribution and abundance of mycorrhizal fungi associated with the invading plant species into previously marginal habitats. This is considered to be particularly critical in high latitudes and altitudes where shifts in climatic envelopes are considered to threaten 32% of Europe‘s higher plants by 2050 (Bakkens et al., 2002). The temporal sequence of abiotic and biotic factors [10]

Postulated temporal scale for GCC

Ecological drivers of GCC [11]

*EM at high elevations and high latitudes Figure-2. Impacts of different GCC temporal scenarios on mycorrhizal diversity (Swarts et al., 2009; Tylianakis et al., 2008).

Conclusion: The GCC-induced changes which influence mycorrhizal fungal fitness will principally influence mycorrhizal diversity through ecosystem fragmentation/habitat loss, which can spatially decouple the mycorrhizal fungi from their plant-host. Habitat fragmentation will influence mycorrhizal diversity by selection against highly-specialized, co-evolved fungi which form intimately-linked, mutually-dependent partnerships, biotic invasions of exotic mycorrhizas and non-mycorrhizal plants, which will contribute to the selective pressure on indigenous mycosymbionts and lead to local shifts that may drive out mycorrhizal-dependent hosts, N-fertilization amendments, which may serve to decouple the association by making plants less reliant on mycorrhizas, or selecting for suites of mycorrhizal fungi that do not have the same symbiotic efficacy as the native complement and acidification of soils releasing toxic metals, thus selecting for resistant mycorrhizal types or those with the phenotypic plasticity to tolerate changes in soil chemistry.

54


References Bakkens, M., Alkemade, J.R.M., Ihle, F., Leemans, R., Latour, J.B. (2002). Assessing affects of forecasted climate change on the diversity and distribution of European higher plants. Global Change Biol., 8: 390407. Bellgard, S.E., Williams, S.E. (2011). Response of Mycorrhizal Diversity to Current Climatic Changes. Diversity, 3: 8-90. Dighton, J., Jansen, A. (1991). Atmospheric pollutants and ectomycorrhizas, more questions than answers. Environ. Pollut., 73: 179-204. Fitter, A.H., Heinmeyer, A., Staddon, P.L. (2000). The impact of elevated CO2 and global climate change on arbuscular mycorrhizas: a mycocentric approach. New Phytol. 147: 179-187. Harsch, M.A., Hulme, P.E., McGlone, M.S., Duncan, R.P. (2009). Are treelines advancing? A global metaanalysis of treelines response to climate warming. Ecol. Lett., 12: 1040-1049. Lilleskov, E.A., Bruns, T.B. (2005). Spore dispersal of a resupinate ectomycorrhizal fungus, Tomentella sublilacina, via soil food webs. Mycologia, 97: 762-769. Miller, S.L. (1995). Functional diversity in fungi. Can. J. Bot., 73: S50-S57. Norby, R.J., O‘Neill, E.G., Luxmoore, R.G. (1986). Effects of atmospheric CO2 enrichment on the growth and mineral nutrition of Quercus alba seedlings in nutrient-poor soil. Plant Physiol., 82: 83-89. O‘Neill, E.G. (1994). Responses of soil biota to elevated atmospheric carbon dioxide. Plant Soil, 165: 55-65. Swarts, N.D., Dixon, K.W. (2009). Terrestrial orchid conservation in the age of extinctions. Ann. Bot., 104: 543556. Tylianakis, J.M., Didham, R.K., Bascompte, J., Wardle, D.A. (2008). Global change and species interactions in terrestrial ecosytems. Ecol. Lett., 11: 1351-1363.

ROLE OF AGRICULTURAL EXTENSION TO HARNESSING THE CLIMATE CHANGE VULNERABILITY Renu Gangwar and Amita Yadav Ph.D scholar (Agricultural Extension and Communication), Govind Ballabh Pant University of Agriculture and Technology, Pantnagar, Uttarakhand, Contact No.: 9719199990, Email: [email protected], Corresponding Author: Renu Gangwar

C

limate change describes any change in climate over time, these change may be due to natural variability and result of human activity (Ozor, 2009). According to Intergovernmental Panel on Climate Change (2007) the changes in climate are attributed directly to human activities and the composition of the global atmosphere over comparable time periods. Vulnerability of a system refers to its physical, social and economic aspects. Indian farmers face several challenges economically, politically as well as environmentally. They are increasingly being affected by changes in climatic conditions. Climate change is affecting all aspects of the climate making unpredictable rainfall, changing seasonal patterns, raising sea levels and increasing the severity of extreme weather events like floods, landslides and droughts. Agriculture and climate change are inextricably linked. This sector is most vulnerable to climate change due to its high dependence on climate and weather. In developing nations 11 per cent of arable land could be affected by climate change including a reduction of cereal production in up to 65 countries, about 16 per cent of agricultural GDP (Anon 2005). Most of the farmers believe that about 8 percent attribute climate change primarily to human activity, 33 percent to both human and natural causes and 25 percent to mostly natural hazards. Productivity is being affected by a number of climate change variables. Climate change will not only effect the production of agriculture commodities but also creates the economic steadiness affecting the supply and demand of agriculture produce, profitability and price. Rising Green house gases will affect the agriculture farms in low developing countries as compared to the developed countries (Kurukulasuriya et al., 2006). Developing nations are more climates sensitive where economy relies on labor intensive technologies whereas developed nations can cope up with the climate sensitive technology and better adoption adjustments. Nelson (2009) noted that “Agriculture is most vulnerable to climate change, contributing about 13.5 per cent of annual greenhouse gas emissions (with forestry contributing an additional 19%) compared with 13.1 per cent from transportation. Instead of harmful effects, Agriculture is however also part of the solution towards mitigating the emissions through carbon sequestration, soil and land use management and biomass production. Agriculture accounts for more than 70 per cent of global water use (Anon 2008). According to some estimates there will be increasing challenges in terms of raised water stress and areas suitable for agriculture along the margins of semiarid areas and arid areas are expected to decrease significantly. This paper revealed the role of agricultural extension to analyze and harness the climate change vulnerability associated with agriculture and people’s livelihoods. Agricultural Extension, in the current scenario of rapidly changing world has been recognized as an essential mechanism for delivering knowledge (information) into modern farming (Jones, 1997). The main cause of climate change has been attributed to anthropogenic (human) activities and actions will have both positive and negative effects on agricultural production and consumption. These actions can have positive impact on adaptation and mitigation of climate change and reduce the impact of climate change on agriculture, livelihoods and food security. It can have negative impact if humans follow unsustainable production and consumption practices. Agricultural extension system plays key role in initiating this change because adaptations to climate change require changes in knowledge, skill, attitude and resilience capacities of the people. There is need to strengthen the extension system that can put forward the adaptive strategies to harness the climate effects. The USDA’s National Institute for Food and Agriculture (NIFA) supports global change and climate projects that are addressing critical issues through multi-stakeholder involvement (farmers, research and extension). Global change extension programs focus on technologies and practices to reduce carbon in the atmosphere and risk management practices to anticipate natural and human impacts on agricultural ecosystem dynamics.

56


Role of Extension Agencies: Extension has a major role to play in helping farmers adapt to and mitigate climate change. A key element in supporting agriculture’s role is information. Mitigation efforts will require knowledge, information, education, skills and technology transfer to the farmers. Agricultural extension and advisory services have a major role to play in providing farmers with information and technologies on how to cope with climate change and ways to contribute to GHG mitigation. This support is especially important for resource scarce smallholders who contribute little to climate change and yet will be among the most affected. Support from extension for farmers in dealing with climate change should focus on two areas: adaptation and mitigation. How can Extension Help with Adaptation and Mitigation?: There are several ways that extension systems can help farmers deal with climate change. These include adaptation and contingency measures for what cannot be prevented. Extension can help farmers prepare for greater climate variability and uncertainty, create contingency measures to deal with exponentially increasing risk and alleviate the consequences of climate change by providing advice on how to deal with droughts, floods and so forth. Extension can also help with mitigation of climate change. This assistance may include providing links to new markets (especially carbon), information about new regulatory structures and new government priorities and policies. Discussed below are different ways in which extension can help with adaptation and mitigation related to climate change: Technologies and Management Information: Farmers, extension agents and researchers must work together to prioritize, test and promote new varieties and management techniques. At present farmers will need to analyze factors affecting climate change and adapting risk management. Better and more timely information could also help to forecast impending “slow on set” weather events such as drought more effectively and thereby improve response times and adaptation (Mude et al, 2009). Farmers need to have access to this kind of information be it climatic information, forecasts, adaptive technology innovations or markets through extension and information systems. Extension agents can introduce locally appropriate technologies and management techniques that enable farmers to adapt to climate change. Extension personnel also can share farmer’s knowledge on cropping and management systems that are resilient to changing climate conditions such as agro-forestry, intercropping, sequential cropping and no-till agriculture. Thus, improved information delivery is a critical component for agricultural adaptation to climate change. Capacity Development and Training: Resource poor farmers have to be trained because they are less enlightened and more affected to climate change they are mostly illiterate and neglected from the mainstream of development. These training can be provided by Krishi Vigyan Kendras and have to be based on the principles of ‘training by doing’ and ‘learning by doing’. Capacity development is even more important in light of climate change. Extension is responsible for providing information and using techniques that ranging from radio messages to field demonstrations. Extension activities include farmer field schools already working with farmers on issues of climate change. Climate change adaptation funding should focus on extension systems and programs that incorporate a good understanding of what practices and skills are needed to promote activities that help in the climate change effort and on increasing the capacity of extension agents and farmers where needed. Facilitating and Implementing Policies and Programs: Traditionally the role of extension workforce just to inform the rural people about technology but today the facilitation role has meant linking farmers to transport agents, markets and inputs suppliers among others. With climate change it will be increasingly important for the extension system to link farmers and other people in rural communities directly with voluntary and regulated carbon markets, private and public institutions that disseminate mitigation technologies and funding programs for adaptation investments. Extension agents may also play a role not only in brokering but also in assisting farmers in implementing policies and programs that deal with climate change mitigation. Infrastructures and Institutional Support: Rural institutions especially village cooperatives must function to meet the local needs of inputs-small and marginal farmers cannot afford to spend a lot of time in searching for the inputs. Local institutions and people involved in planning and implementation that needs promotion and strengthening for sustainable rainfed agriculture. Coordination: Agriculture development system presents a complex coordination phenomenon interinstitutional and interdisciplinary. Coordination is important within the disciplines and between institutions and departments and in functional areas like research, extension and training. The old concept of people’s participation and new thrust on participatory research and development bring

Role of Agricultural Extension to Harnessing the Climate Change Vulnerability

57

farmers also in the framework of interactions at all levels. More allied agencies have to be brought together to serve the farmers on the line of farming systems approach. Use of Technology Demonstrations: Extension agents can use various extension teaching approaches including method demonstration, result demonstration, print media and computer and (for example internet, television, cinema, radio, computer, etc) to further inform and educate farmers on various issues of climate change. Farmers learn by doing and practices learnt during a demonstration session could lead to adoption of the technology. Farmers perceive the use of demonstration methods as a significant role of extension in disseminating the coping and adaptive measures that could reduce climate change risks among vulnerable communities. Information and Communication Technology (ICT): The role of ICT to enhance food security and support farming cannot be ignored. Its role in agriculture which includes use of computers, Internet, geographical information systems, mobile phones, radio and television was endorsed at the World Summit on the Information Society 2005. A number of factors influence the decision whether or not to invest in ICT: higher costs, lack of competition, lack of relevant skills for effective use of ICT could be inhibitors. The use of mobile phones has been found to reduce information asymmetries, enabling users to access arbitrage, marketing or trade opportunities (Jensen 2007). Feedback Role to Government on Climate Change Issues: Extension agents work with the people in rural areas. This help them to raise the issues that border on climate change in their areas of coverage From this government and nongovernmental bodies can become aware of climate risk situations in the rural areas and then be able to render assistance, make policies or implement programmes to manage the challenges identified by agents. Similarly traditional and local practices which have helped a particular individual or community to adapt to the effects of climate change can also be reported and advertised thereby creating the avenue for such practice to be replicated and upscaled in other vulnerable areas. Technologies and management information Capacity development and Training

Facilitating and implementing policies

ROLE OF

Role of Information and communication technology

Use of technology demonstrations

AGRIL EXTENSION

Feedback government on climate change issues

Infrastructures and institutional support Interdisciplinary Coordination

Conceptual framework for role of extension in climate change

58


The strategies to harness the climate change vulnerability include training of extension staff about new knowledge and skills in climate risk management, disseminating innovations strategies and technology on best practices, building resilience capacities of vulnerable people, providing feedback to government about various causes of climate change and its effects, organizing seminars, workshops and field days on climate risk management, use of farmer-to-farmer extension strategy to promote awareness and organize farmer field schools to educate and encourage farmers in learning about climate change issues with a view to reduce human causes and improving adaptation options. Conclusion: In the context of climate change, information needs assessment and strategies for strengthening research, extension and farmers linkages are very important. Extension has a major role to play in helping farmers adapt to and mitigate climate change. Traditionally extension has worked to promote new technologies and management techniques, educate and trained farmers and act as a facilitator for rural communities. But now the extension role can bridge the gap between farmers and researchers and create linkages. Close collaboration between meteorological and agricultural services will be necessary for a more effective use of climate forecasts. Extension services need to be strengthened and agents provided with the necessary equipments and logistics so that they can reach farmers more easily with agricultural technologies for adaptation in the face of changing climate. The availability of usable science-based climate prediction information needs to be tailored to farmer needs by matching it with traditional practices and incorporating existing local knowledge. References Davis, K.E. (2009). Agriculture and Climate Change: An Agenda for Negotiation on Copenhagen “The Important Role of Extension Systems”, International Food Policy Research Institute. Washington, D C.USA, Focus 16, Brief 11. Falkenmark, M. (2007). Global warming: water the main mediator. Stockholm International Water Institute (SIWI), Stockholm, Sweden, Stockholm Water Front, No 2, 6-7. IPCC (2007). Contribution of Working Group II to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge University Press, UK. Jones, G.E. (1997). The history, development and the future of Agricultural Extension in Improving Agricultural Extension -A reference manual by Burton E Swanson et.al., FAO, Rome. Lal, R. (2005). Enhancing crop yields in the developing countries through restoration of the soil organic carbon pool in agricultural lands. Land Degradation and Development 17: 197–209. Meera, S.N. (2008). ICTs in Agricultural Extension: Tactical to Practical. Ganga Kaveri Publishing House, Varanasi, India. Pp. 248. Mustapha, S.B, Undiandeye, U. C. and Gwary, M.M. (2012). The Role of Extension in Agricultural Adaptation to Climate Change in the Sahelian Zone of Nigeria. Journal of Environment and Earth Science, 2(6): 48-58. Nelson, G.C. (2009). Agriculture and climate change: an agenda for negotiation in Copenhagen. 2020 Focus No 16, May 2009. Available online on http://www.ifpri.org/2020/ focus/focus16. Ozor, N. (2009). Understanding climate change: Implications for Nigerian Agriculture, Policy and Extension. A paper presented at the National Conference on “Climate change and the Nigerian Environment”: held at the University of Nigeria, Nsukka. Singh, I. and Grover, J. (2013). Role of extension agencies in climate change related adaptation strategies. International Journal of Farm Sciences, 3(1):144-155. Shakoor, U., Saboor, A., Ali, I. and Mohsin, A.Q. (2011). Impact of climate change on agriculture: empirical Evidence from arid region. Pakistan Journal of Agricultural Sciences, 48(4): 327-333.

CLIMATE CHANGES AND POTENTIAL IMPACTS ON POSTHARVEST QUALITY OF HORTICULTURAL CROPS Sandeep Kumar Mauriya, Akhilesh Kumar Pal and Kulveer Singh Yadav Department of Horticulture, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi (UP), E-mail: [email protected], Corresponding Author: Sandeep Kumar Mauriya

C

limate change is one of the most important global environmental challenges in the history of mankind. It is mainly caused by increasing concentration of Green House Gases (GHGs) in the atmosphere. In 1980s, scientific evidences linking GHGs emission due to human activities causing global climate change, started to concern everybody. Subsequently, United Nations General Assembly in 1992 formed Intergovernmental Negotiating Committee for Framework Convention on Climate Change (UNFCCC) which finally adopted the framework for addressing climate change concerns. The Intergovernmental Panel on Climate Change (IPCC) has been publishing periodic assessment reports on atmospheric carbon concentration and its likely impact on the environment. The IPCC in its 4th Assessment Report states that emission of global GHGs has increased since pre-industrial times, with an increase of 70% between 1970 and 2004. The big challenge before the international community is to limit the emission of green house gases by 2050 and measurably by 2020. Horticultural crops which form a significant part of total agricultural produce in the country comprising of fruits, vegetables, root and tuber crops, flowers and other ornamentals, medicinal and aromatic plants, spices, condiments, plantation crops and mushrooms. Though, these crops occupy hardly 8% of the cropped area in India, and approximately 30% contribution in agricultural GDP. Cultivation of these crops is labour intensive and as such they generate lot of employment opportunities for the rural population. Fruits and vegetables are also rich source of vitamins, minerals, proteins, carbohydrates etc. which are essential in human nutrition. Hence, these are referred to as protective foods and assumed great India with more than 28.2 million tonnes of fruits and 66 million tonnes of vegetables is the second largest producer of fruits and vegetables in the world next only to China. However, per capita consumption of fruits and vegetables in India is only around 46kg and 130g against a minimum of about 92g and 300g respectively recommended by Indian Council of Medical Research and National Institute of Nutrition, Hyderabad. Vegetable production is threatened by increasing soil salinity particularly in irrigated croplands which provide 40% of the world’s food. Fruits, vegetables, flowers, medicinal plants and tubers are grown from tropical to temperate, some horticultural crops like spices and plantation crops are location specific. In order to sustain our horticultural production with present day challenges we have to have packages to manage abiotic stresses. Harvest and Postharvest: Harvest of fruit and vegetable crops occurs in different times of the year depending on cultivar climate conditions, pest control, cultural practices, exposure to direct sunlight, temperature management and maturity index, among other important pre-harvest factors. After crops are harvested, respiration is the major process to be controlled. Postharvest technology comprises different methods of harvesting, packaging, rapid cooling, storage under refrigeration as well as modified (MA) and controlled (CA) atmospheres and transportation under controlled conditions, among other important technologies. Most of the temperature effects on plants are mediated by their effects on plant biochemistry. That is, of course, for well water supplied plants, for which the Q10 for growth is very high. For plants that are subjected to water deficit, temperature is a physical facilitator for balancing sensible and latent heat exchange at the shoot, which is modulated by relative humidity and by wind .Most of the physiological processes go on normally in temperatures ranging from 0 °C to 40 °C. However, cardinal temperatures for the development of fruit and vegetable crops are much narrower and, depending on the species and ecological origin, it can be pushed towards 0 °C for temperate species from cold regions, such as carrots and lettuce. On the other hand, they can reach 40 °C in species from tropical regions, such as many cucurbits and cactus species (Went, 1953).Temperature is of paramount importance in the establishment of a harvest index. The higher the temperature during the growing season, the sooner the crop will mature. Reported that lettuce, celery, cauliflower and kiwi grown under higher temperatures matured earlier that the same crops grown

60


under lower temperatures. Minimally processed vegetables are ready to use products developed to respond to the consumer demand for both convenience and high quality aspects (M. A. Del Nobile & et al., 2012). Production and consumption of minimally processed lettuce has increased dramatically in many countries in recent years (M. Oliveira & et al., 2010). Rapid Cooling: Fruit and vegetable crops are generally cooled after harvest and before packing operations. Cooling techniques have been used since the 1920s to remove field heat from fresh produce, based on the principle that shelf-life is extended 2- to 3-fold for each 10 °C decrease in pulp temperature. Rapid cooling optimizes this process by cooling the product to the lowest safe storage temperature within hours of harvest. By reducing the respiration rate and enzyme activity, produce quality is extended as evidenced by slower ripening/senescence, maintenance of firmness, inhibition of pathogenic microbial growth and minimal water loss .Rapid cooling methods such as forced-air cooling, hydro cooling and vacuum cooling demand considerable amounts of energy (Thompson, 2002). Therefore, it is anticipated that under warmer climatic conditions, fruit and vegetable crops will be harvested with higher pulp temperatures, which will Fruit ripening Tomato ripening occurred normally in terms of colour development, ethylene evolution, and respiratory climacteric after three days at temperatures above 36 °C. However, ripening was slower than freshly harvested fruit. Quality Parameters: Extensive work has been carried out for more than three decades focusing quality properties of fruit and vegetable crops exposed to high temperatures during growth and development. Flavor is affected by high temperatures. Apple fruits exposed to direct sunlight had a higher sugar content compared to those fruits grown on shaded sides Grapes also had higher sugar content and lower levels of tartaric acid when grown under high temperatures that a 10 °C increase in growth temperature caused a 50% reduction in tartaric acid content. Verified that malic acid synthesis was more sensitive to high temperature exposure during growth than was the synthesis of tartaric acid. Fruit firmness is also affected by high temperature conditions during growth .Dry matter content is used as a harvest indicator for avocados due to its direct correlation with oil content, a key quality component. Antioxidant Activity: Antioxidants in fruit and vegetable crops can also be altered by exposure to high temperatures during the growing season. Temperature conditions significantly increased the levels of flavonoids and, consequently, antioxidant capacity. They verified that higher temperatures tended to reduce vitamin content in fruit and vegetable crops. Exposure of fruit and vegetable crops to high temperatures can result in physiological disorders and other associated internal and external symptoms. Table 1. Symptoms of heat and solar injury of fruit and vegetable crops. Crop Symptoms Snap bean Brown and reddish spots on the pod; spots can coalesce to form a water-soaked area Bell pepper Sunburn: yellowing and, in some cases, a slight wilting Avocado Skin and flesh browning; increased decay susceptibility Lime Juice vesicle rupture; formation of brown spots on fruit surface Pineapple Flesh with scattered water-soaked areas; translucent fruit flesh Tomato Sunburn: disruption of lycopene synthesis; appearance of yellow areas in the affected tissues Cabbage Outer leaves showing a bleached, papery appearance; damaged leaves are more susceptible to decay

Consequences: The rapid change are - global warming, change of seasonal pattern, excessive rain, melting of ice cap, flood, rising sea level, drought, etc. leading to extremity of all kinds. Decrease in potential yields is likely to be caused by shortening of the growing period, decrease in water availability and poor vernalization. Vulnerability, rarity and rapid extinction of plant species will be among the other consequences. Plains of India will face similar kind of problems. Farmers have to explore options of changing crops suitable to weather. He also pointed out that climatic changes could lead to major food security issues for a country like India. 1. Production timing will change due to rise in temperature. Due to rise in temperature, photoperiods may not show much variation. As a result, photosensitive crop will mature faster. 2 Pollination will be affected adversely because of higher temperature. Floral abortions, flower and fruit drop will be occurred frequently. 3. The requirement of annual irrigation will increase and heat unit requirement will be achieved in much lesser time. 4. Higher temperatures will reduce tuber initiation process in potato, reduced quality in tomatoes and pollination in many crops. In case of crucifers, it may lead to bolting; anthocyanin production

Climate Changes and Potential Impacts on Postharvest Quality of Horticultural Crops

61

may be affected in apples and capsicum. Tip burn and blossom end rot will be the common phenomenonin tomatoes. Effect of Fruit Crop: India is the second largest producer of Fruits after China, with a production of 44.04million tonnes of fruits from an area of 3.72 million hectares. A large variety of fruits are grown in India, of which mango, banana, citrus, guava, grape, pineapple and apple are the major ones. Due to rise in temperature, crops will develop more rapidly and mature earlier. For example, Citrus, grapes, melons etc. High temperature and moisture stress also increase sunburn and cracking in apples, apricot and cherries and increase in temperature at maturity will lead to fruit cracking and burning in litchi (Kumar and Kumar 2007). Air pollution also significantly reduced the yield of several horticultural crops and increase the intensity of certain physiological disorders like black tip of mango which is induced by coal fume gases, sulphur dioxide, ethylene, carbon mono oxide and fluoride. Chilling symptoms on leaves are not seen immediately but it may take 2 to 4 days to appear. Table 1. List of some variety tolerant abiotic stress of fruit crops. S.N. Crop Variety 1 Pomegrante Ruby 2 Annona Arka Sahan 3 Fig Deanna and Excel 4 Grape (rootstock) Dogridge 5 Mango Bappakai 6 Lime Rangpur lime Source: Bose and Mitra (1996)

Tolerant Drought tolerant Drought tolerant Drought tolerant Salinity tolerant Salinity tolerant Salinity tolerant

Effect of Vegetables Crop: India is the second largest producer of vegetables in the world after China and accounts for about 15% of the world’s production of vegetables Climatic changes will influence the severity of environmental stress imposed on vegetable crops. The response of plants to environmental stresses depends on the plant developmental stage and the length and severity of the stress .Plant sensitivity to salt stress is reflected in loss of turgor, growth reduction, wilting, leaf curling and epinasty, leaf abscission, decreased photosynthesis, respiratory changes, loss of cellular integrity, tissue necrosis, and potentially death of the plant. Table 2. List of some abiotic stresses vegetable crops S.N. Tolerant 1 Drought tolerant 2 Heat tolerant 3 Salinity tolerant 3 Flooding/ excess moisture tolerant Source: Hazra and Som (1999) and Rai and Yadav (2005)

Crop Chilli, melons, tomato, onion Peas, tomato, beans, Capsicum melons, peas, onion tomato, onion, chilli

Effect on Plantation Crops: Studies conducted on “Impact of climate change in cashew” at Directorate of Cashew Research, Puttur , India indicated that the rain fed cashew crop is highly sensitive to changes in climate and weather vagaries, particularly during reproductive phase. Cashew requires relatively dry atmosphere and mild winter (15-200C) coupled with moderate dew during night for profuse flowering. High temperature (>34.4 0C) and low relative humidity ( 5 cmday-1), have increased in intensity and are projected to increase infrequency. It is the rates of change and wide swings in weather that are of chief concern, as ice core records indicate that increased variability may be associated with rapid climate change events and changes in the ocean thermohaline circulation (Paul Meyewski, UNH, personal communication). Together, warming and more extreme weather have begun to alter marine life and the weather patterns that impact infectious diseases, their vectors and hosts .All infections involve an agent (or pathogen), host(s)and the environment. Some pathogens are carried by vectors or require intermediate hosts to complete their lifecycle. Climate can influence pathogens, vectors, host defences and habitat (Harvell et al., 1999). Diseases carried by mosquito vectors are particularly sensitive to meteorological conditions. These relationships were described in the 1920s and quantified in the 1950’s. Excessive heat kills mosquitoes, but within their survivable range, warmer temperatures increase their reproduction and biting activity and the rate at which pathogens mature within them. At 20°C falciparum malarial protozoa take 26 days to incubate, but at 25 °C, they develop in Anopheles mosquitoes (carriers of malaria) live only several weeks. Thus warmer temperatures permit parasites to mature in time for the mosquito to transfer the infection. Injudicious use of insecticides and pesticides also contribute to pollution which leads to climate change. The phenomenon of insecticide-induced resurgence of arthropod pests has long been known to occur in response to a reduction in natural enemy populations, releasing the pest population from regulation. However studies of resurgent populations infrequently examine other mechanisms, although numerous alternative mechanisms such as physiological enhancement of pest fecundity, reduction in herbivore-herbivore competition, changes in pest behaviour, altered host-plant nutrition, or increased attractiveness may also cause or enhance the probability of resurgence (Bade and Ghorpade, 2009).

68


Resurgence may be defined as an increase in target arthropod ‘pest’ species abundance to a level which exceeds that of a control or untreated population (Figure I) following the application of an insecticide (acaricide).Some definitions and reported occurrences of resurgence include an initial decline in pest abundance immediately following insecticide application (Figure 2). This decline is typically followed by an increase in the pest population to a level higher than before application. A secondary pest outbreak is closely related to, and often confused with, resurgence. In fact, Metcalf (1986) defined secondary pest outbreak as ‘type II resurgence’. For clarity, we define secondary pest outbreak (SPO) as the increase, after insecticide application, of an on-target species. The presumption underlying SPO is that before insecticide application the non-target species had been regulated, excluded, or otherwise maintained at sub-economic levels. Despite the obvious differences between resurgence and SPO, the causal mechanisms responsible for both phenomena may be similar. Resurgence: An Ecological or Evolutionary Process?: The distinction between ecological and evolutionary processes is important, not only in the types of mechanisms involved, but also in the implications each process has for population dynamics and pest management (Arora and Dhaliwal, 1996). It is important to realize that resurgence is necessarily an ecological phenomenon, occurring as a result of insecticide application, and not an evolutionary process. The ranges of infectious diseases and vectors are changing in altitude, along with shifts in plant communities and the retreat of alpine glaciers. Additionally, extreme weather event create conditions conducive to ’clusters’ of insect-, rodent- and water-borne diseases. Accelerating climate change carries profound threats for public health and society. Climate Change and Biological Responses: Northern latitude ecosystems are subjected to regularly occurring seasonal changes. But prolonged extremes and wide fluctuations in weather may overwhelm ecological resilience, just as they may undermine human defences. Repeated winter thawing and refreezing depresses forest defences, increasing vulnerability to pest infestations (Awmack et al., 1997). And sequential extremes and shifting seasonal rhythms can alter synchronies among predators, competitors and prey releasing opportunists from natural biological controls. Several aspects of climate change are particularly important to the responses of biological systems. First, global warming is not uniform. Warming is occurring disproportionately at high latitudes, just above Earth’s surface and during winter and night-time. The Antarctic Peninsula has warmed about 2°C over the last century, while temperatures within the Arctic Circle increased 5°C (Bale et al., 2002). Since 1950, northern hemispheric springs have been surfacing earlier, and fall appears later. While inadequately studied in the US, warm winters have been demonstrated to facilitate over wintering, thus northern migration of the ticks that carry tick-borne encephalitis and Lyme disease. Agricultural zones are shifting northward, but not as swiftly as are key pests, pathogens and weeds that, in today’s climate, consume 52% of the growing and stored crops worldwide .An accelerated hydrological (water) cycle is demanding significant adjustments from biological systems along with ocean warming . Communities of marine species have shifted. A warmer atmosphere also holds more water vapour (6% for each 1°C warming) and insulates escaping heat and enhances greenhouse warming. More evaporation also fuels more intense, tropical-like downpours, while warming and parching of Earth’s surface intensifies the pressure gradients that draw in winds (e.g., winter tornadoes) and large weather systems. Elevated humidity and lack of night-time relief during heat waves directly challenge human (and livestock) health. These conditions also favour mosquitoes. Climate Change Impacts on Pest Animals and Weeds Key Facts  Producers are likely to have time to adapt their pest animal and weed management strategies to climate change.  Pests will generally extend southwards and to higher altitudes as a result of Warming trends.  Increased pest surveillance is crucial to prevention and management.  With greater climatic variation, strategic pest management will become more important (Atwal and Dhaliwal, 2009).  Weeds with efficient seed dispersal systems (e.g. wind, water, birds) will invade faster than weeds that rely on vegetative dispersal.  Extreme events such as cyclones can help to spread weeds.

Impact of Climate Change on Pest Incidence

69

 Disturbed habitats may be more easily colonised by pest animals and weeds (for example, after a drought).  Herbicides may become less effective under warmer and drier conditions.  Producers may need to adjust the timing of pest control as pest life cycles respond to climate change. Climate and the Ecology of Animals and Plants: Temperature and rainfall determine where each species can live and reproduce. Climate change will directly affect:  The geographic range of species  The timing of species’ life cycles  The population dynamics of species  The location of natural habitats (some species will have to move with their host habitats)  The structure and composition of ecosystems (i.e. the decline and extinction of some species and the invasion of other species) While warmer temperatures will force some species to relocate, adapt or perish, some pests will be better able to survive winter, and species that are active in summer will develop faster. Animals and plants have already begun to spread to higher altitudes in response to climate change (Chapman and Allen, 1948). As the climate warms, temperature-sensitive species are being restricted to higher altitudes. In relatively flat areas, this effect on range is magnified because, without the ability to avoid higher temperatures by moving to higher ground in their local area, species must relocate further afield. To adapt to climate change, animals and plants will have to either develop tolerances to warmer temperatures and drier soil conditions or relocate to a habitat that suits their current climatic tolerances i.e. shift their range. Weeds with efficient dispersal mechanisms such as water, wind or birds are better equipped to shift their range, while species with short generation times are better equipped to evolve, and increase their tolerance of warmer temperatures. Each species will cope and adapt in different ways, so their ranges are likely to expand and contract at different rates, which will affect competition between species. Weeds are usually very competitive and often find an opportunity to establish new populations when natural or desirable plant species decline. The projected increase in fire and drought will favour the establishment of some weeds. Climate change may also favour some native plants to the extent that they may become weeds. List of insect pests likely to become serious due to changes in ecosystems and habitats Insect pest Scientific name Crop(s) S.N. Pest Scientific Name Crop 1 American bollworm Helicoverpa armigera (Hubner) Cotton, chickpea, pigeon pea, sunflower, tomato 2 Whitefly Bemisia tabaci (Gennadius) Cotton, tobacco 3 Brown plant hopper Nilaparvata lugens Rice 4 Green leafhopper Nephotettix spp. Rice 5 Serpentine leaf miner Liriomyza trifolii (Burgess) Cotton, tomato, cucurbits, several other vegetables 6 Fruit fly Bactrocera spp. Fruits and vegetables 7 Mealy bugs Several species Several field and horticultural crops 8 Thrips Thrips spp. Groundnut, cotton, chillies, roses, grapes, citrus and pomegranate 9 Wheat aphid Macrosiphum miscanthi (Takahashi) Wheat, barley, oats 10 Pink stem borer Sesamia inferens (Walker) Wheat 11 Gall midge Orseolia oryzae Rice 12 Diamondback moth Plutella xylostella (Linnaeus) (Ahmed et Cabbage al., 2009) 13 Pyrilla Pyrilla perpusilla (Walker) Sugarcane or rice at times Source: Modified from Puri and Ramamurthy (2009)

Climate and the Physiology of Animals and Plants: Higher levels of carbon dioxide could stimulate the growth of some weed species, especially summer-active weeds in higher rainfall zones. However, the decline in rainfall predicted for southern Australia may counteract this. Woody weeds will benefit from increased carbon dioxide more than grasses. Many plant species respond to accumulated day degrees—the cumulative sum of daily temperatures—to ‘read’ the season and trigger critical development stages such as stem elongation and flowering. Warmer temperatures will accelerate the rate at which day degrees accumulate, so the life cycles of some plant species may accelerate. Because plants are host to many pest animals, the life cycle of some pest species, such as Red Legged Earth Mite, aphids and rabbits, will respond to their plant hosts and change their feeding and reproductive patterns accordingly. Warmer temperatures will directly affect the ability of animals to maintain their body temperature and avoid heat stress. Increased levels of carbon dioxide can affect the carbon-to-nitrogen ratio of plant material, thereby reducing the nitrogen available to plant-eating animals and insects. Insects that need lower temperatures to

70


activate dormancy may have shorter overwintering periods. Warmer temperatures may reduce the production of dew which is an important source of moisture for many insects and smaller vertebrate species. Implications for Producers  Pest control strategies will change.  Pest populations will change.  Pests will migrate.  Effectiveness of pest control will change. Opportunities for Producers: Producers are likely to have time to adapt their pest management strategies to climate change. Continued strategic implementation of pest control measures coordinated across jurisdictions will help protect agriculture from the full impact of climate change over the medium term. Climate change will offer opportunities to control traditional pests; for example, producer scan learn from strategies used in the north to control southward-moving pests. Producers can take advantage of the natural stress conditions that traditional pest species will face, by reducing population numbers and host species whenever economically feasible and encouraging the adaptation of desirable species. Climate change may help to control some pests, such as rabbits, blackberries, serrated tussock, gorse and lice. Rabbits may struggle with the longer periods of dry feed, higher temperatures and expected increased effectiveness of calicivirus under drier conditions Pest Management under Climate Change Scenario: Weather based pest forewarning systems are decision support tools that help growers to assess the risk of outbreaks of economically damaging crop pests at present and future climate change scenario. Using information about weather, crop, and/or insects, warning systems advice growers or other crop managers when they need to take an action - usually to apply a insecticidal spray to prevent pest outbreaks and avoid economic losses. Pest-warning systems are key elements of Integrated Pest Management (IPM) efforts to reduce excessive use of chemical pesticides. There are several potential incentives for growers to adopt pest warning systems. By substituting risk assessment based spray timing for traditional calendar based pesticide spraying, growers can reduce spray frequency, limiting the health and environmental hazards of pesticide use while presenting an environmentally friendly image to customers. The five components of an IPM programme are prevention, monitoring, correct disease and pest diagnosis, development and use of acceptable thresholds, and optimum selection of management tools. The management strategies available include genetic control, cultural control, biological control, and chemical control. What management strategy is most relevant depends impart on the particular pest. Pest management strategy coupled with weather based pest forewarning system forms the ‘Expert System’ or ‘decision Support System’ for pest management. Need for these systems will be felt increasingly in the future. References Ahmed, T., Ansari, M. and Ali, H. (2009). Outbreak of diamondbackmoth,Plutella xylostella in Aligarh, India. Trends Biosci. 2(1):10-12. Arora, R. and Dhaliwal, G.S. (1996). Agro-ecological changes and insect pest problems in Indian agriculture. Indian J. Ecol. 21(2): 109-122. Atwal, A.S. and Dhaliwal, G.S. (2009). Agricultural Pests of South Asia and their Management. Kalyani Publishers, New Delhi. Awmack, C.S., Woodcock, C.M. and Harrington, R. (1997). Climate change may increase vulnerability of aphids to natural enemies. Ecol. Entomol.22: 366-368. Bade, B.A. and Ghorpade, S.A. (2009). Life fecundity tables of sugarcane woolly aphid, Ceratovacuna lanigera Zehntner. J.Insect Sci.22(4): 402-405. Bale, J.S., Masters, G.L. and Hodkinson, I.D. (2002). Herbivory in global climate change research: Direct effect of risising temperature on insect herbivorous. Global climate change Biol. 8: 1-16. Canadel, G.L., Uitenhuis, E.T., Ciais, P., Conway, T.J.,Gillett, N.P., Houghton, R.A., J. Le Quéré, C.,Raupach, M.R., Field, C.B. and Bmarland, G. (2007). Contributions to accelerating atmospheric CO2 growth from economic activity, carbon intensity, and efficiency of natural sinks. Proceedings of the National Academy of Sciences, 104:1866-18870. Chapman, R. K. and Allen, T. C. (1948). Stimulation and suppression of some vegetable plants by DDT. J. Econ. Entomol. 41, 616-623. Harvell, C.D., Kim, K., Burkholder, J.M., Colwell, R.R., Epstein, P.R., Grimes, J., Hofmann, E.E., Lipp, E., Osterhaus, A.D.M.E., Overstreet, R., Porter, J.W., Smith, G.W., Vasta, G. (1999). Diseases in the ocean: emerging pathogens, climate links, and anthropogenic factors, Science, 285: 1505–1509.

CLIMATE CHANGE AND TOMATO PROCESSING INDUSTRY Ila Gaur1 and S. K. Goyal2

1

Shri Venkateshwara University Gajraula, Amroha (U.P.), E-mail: [email protected] and 2BHU-KVK, IAS, Banaras Hindu University, Barkachha, Mirzapur (U.P.), E-mail: [email protected], Corresponding Author: S. K. Goyal

T

he importance of vegetables in providing balanced diet and nutritional security has been realised world over. Vegetables are now recognized as health food globally and play important role in overcoming micronutrient deficiencies and providing opportunities of higher farm income. The worldwide production of vegetables has tremendously gone up during the last decades and the value of global trade in vegetables now exceeds that of cereals. Hence, more emphasis is being given in the developing countries like India to promote cultivation of vegetables. Development of hybrid varieties, integrated insect-pest and diseases management practices, integrated nutrient management and standardizing improved agro-techniques including organic farming have changed the scenario of vegetables production in the country. In short, productivity, quality and post harvest management of vegetables will have to be improved to remain competitive in the next decades. The major objectives of reducing malnutrition and alleviating poverty in developing countries through improved production and consumption of safe vegetables will involve adaptation of current vegetable systems to the potential impact of climate change (Bhardwaj, 2012). A significant change in climate on a global scale will impact vegetable cultivation including tomato and agriculture as a whole; consequently affect the world's food supply. Climate change per se is not necessarily harmful; the problems arise from extreme events that are difficult to predict. More erratic rainfall patterns and unpredictable high temperature spells consequently reduce crop productivity. Developing countries in the tropics will be particularly vulnerable. Latitudinal and altitudinal shifts in ecological and agro-economic zones, land degradation, extreme geophysical events, reduced water availability, and rise in sea level and salinization make it difficult to cultivate the traditional vegetables in particular zones in the world. Unless measures are undertaken to mitigate the effects of climate change, food security in developing countries will be under threat and will put at risk the future of the vegetable growers in these countries. Tomato is the best source for overcoming micronutrient deficiencies and provides smallholder farmers with much higher income and more jobs per hectare than staple crops. The worldwide production of tomato has increased over the past quarter century and the value of global trade in tomato now exceeds that of cereals. Tomatoes are generally sensitive to environmental extremes, and thus high temperatures and limited soil moisture are the major causes of low yields and will be further magnified by climate change. Tomato (Lycopersicon esculentum) is one of the most important supplementary sources of minerals and vitamins in human diet. It is the second most cultivated vegetable in the world according to Food and Agricultural Organization Statistics (FAOSTAT, 2014). It is grown extensively throughout India for fresh and commercial processing (Maini and Kaur, 2000). It is an important vegetable in our diet because of its versatility of use in domestic cooking and commercial production of processed products. It has achieved a spectacular status because of its rich composition and widespread consumption. Tomato is a source of carotenoids, lycopene being predominant one, flavonoids, organic acids such as citric acid, and sugars such as fructose, glucose and sucrose, minerals such as potassium. Studies indicate that regular intake of cooked tomato appears to be the major nutritional factor accounting for lower risk of prostate cancer, digestive tract cancer and coronary heart diseases (Giovannucci et al., 2002). Fresh tomato is highly perishable and to extend its shelf life processing is needed so as to reduce the post-harvest losses and ensure its availability in different forms. The physico-chemical properties such as pH, titratable acidity, TSS, acid/sugar ratio etc. are important determinants of its acceptability (Sadler and Murphy, 2010). Consumer acceptability for processed product play an important role in its consumption and use, therefore the chemical and nutritional value of the processed product should not change or deviate too much from the original product. Therefore, the present investigation was aimed to study the physico-chemical properties of three varieties of tomato for different post-harvest processes.

72


The agro food processing industry is one of the largest in India, employs around 18% of the country’s industrial work force and is ranked fifth in terms of production, consumption, export and expected growth (Merchant, 2008). India is the world’s second largest producer of food next to China and has the potential of being the biggest in the World. The Indian domestic food market is expected to grow by nearly 40% of the current market size to $344 billion by 2025 (Annapoorna, 2011). India’s agricultural base is quite strong but wastage is very high and processing of food products is very low. Therefore, India’s food processing sector comparatively is small and its share in exports of processed food in world trade has remained at about 1.5 per cent or $3.2 billion (Bhuyan, 2010). India also produces a variety of temperate to tropical fruits, vegetables and other food products. Processing of food products plays an important role in the conservation and effective utilization of fruits and vegetables. India’s strong agricultural base, variety of climatic zones and accelerating economic growth holds significant potential for food processing industry that provides a strong link between agriculture and consumers. Though the Indian food processing industry is large in size, it is still at a nascent stage in terms of development. Of the country’s total agriculture and food produce, only 2 per cent is processed. The industry size has been estimated at US$ 70 billion by the Ministry of Food Processing, Government of India. The food processing industry contributed 9 per cent to India’s GDP and had share of 6 per cent in the total industrial production. The industry employs 1.6 million workers directly (Merchant, 2008). The industry grew at an estimated rate of 9.12 per cent during the period 2002 to 2007. Value addition of food products is expected to increase from the current 8 per cent to 35 per cent by the end of 2025. Fruit and vegetable processing, which is currently around 2 per cent of total production is expected to increase to 25 per cent by 2025 (Anon., 2006). India’s processing industry is highly fragmented and is dominated by the unorganized sector. A number of players in this industry are small. About 42 per cent of the output comes from the unorganized sector, 25 per cent from the organized sector and the rest from small scale players. The most common type of food processing units that form the organized sector are flour mills, fish processing units, fruits and vegetables processing units, meat processing units, non-alcoholic and aerated drinks units, sugar units (mills) and modernized rice mills. While India’s agricultural production base is quite strong, the food processing industry is still under developed. The highest share of the processed food is in the dairy sector, where 37% of total produce is processed, of which only 15 per cent is processed by the organized sector. The processing level is around 2.2% in fruits and vegetables, 21% in meat and 6% in poultry products. Of the 2.2% processing in fruits and vegetables only 48% is in organized sector remaining in unorganized sector (Merchant, 2008). Ugonna et al. (2015) carried out a study to appraise tomato value chain in order to promote the development of tomato production and processing industry in Nigeria. They reported that currently in Nigeria, about 1.8 Million tonnes of fresh tomato are produced per year, but over 50% of these are lost due to poor storage system, poor transportation and lack of processing enterprises. This makes it important to develop strategies for the development of tomato value chain. Tomato and its Processing: The word "tomato" comes from the Nahuatl word tomato, literally known as “the swelling fruit” (Online Etymology Dictionary). Tomato belongs to the Solanaceae family. Tomato (Solanum lycopersycum L.) is one of the most important vegetables worldwide. As it is a relatively short duration crop and gives a high yield, it is economically attractive. Tomatoes contribute to a healthy, well-balanced diet (Naika, 2005), as they are rich in minerals, vitamins, essential amino acids, sugars, dietary fibres, vitamin B and C, iron and phosphorus. It can be processed into different products including: Ketchup, puree, powder and juice. Tomato is one of the most popular produced and extensively consumed vegetable crops in the world (Grandillo et al., 1999). It can be eaten raw in salads or as an ingredient in many dishes, and in drinks (Alam et al., 2007). In regions where it is being cultivated and consumed, it constitutes a very essential part of people’s diet. Tomato production can serve as a source of income for most rural and periurban producers in India. Despite all the numerous benefits from the crop, many challenges are making its production unprofitable. Challenges Hindering Tomato Processing in India: Although tomato can improve the livelihoods of rural farmers, studies have shown that the full potential of the crop has been under exploited because of many challenges. Primary factors responsible for post-harvest produce losses include poor pre-harvest measures, adoption of poor production techniques (varieties with low shelf life, imbalance

Climate Change and Tomato Processing Industry

73

use of nutrients, insect pest and disease infestation and abiotic stresses), non-application of preharvest recommended treatments/practices, harvesting at improper stage and improper care at harvest; and post-harvest problems, non-removal of field heat, dumping produce, moisture condensation causing pathogen infestation, packaging in bulk without sorting and grading of produce, improper transportation, storage, and distant & time consuming market distribution. These losses bring low return to growers, processors and traders and country also suffers in terms of foreign exchange earnings (Kader, 1992). Education Level: Literacy is one of the important characteristics that influence farmers’ decisions about adoption of new technologies. Labour Used for Picking Tomatoes: The type and number of labour plays a vital role in the post harvest losses. Skilled labourers pick and handle the produce with care and hence do little damage to the crop. It is seen that most of the farmers perform their activities by engaging family labourers. Picking Time of Tomatoes: The time of picking is considered the most important factor in post harvest losses. According to Moneruzzaman et al. (2009) and Orzolek et al. (2006) farmers targeting distant markets must harvest their tomatoes in a matured green state. This will not only give the producers ample time to prepare the fruit for the market but also prevent mechanical injuries during harvesting. Meanwhile, farmers in most of the part of country harvest tomatoes when they are partially or fully ripened. Fully ripened tomatoes are susceptible to injuries during harvesting resulting in shorter shelf life (Toivonen 2007; Watkins 2006; Reid, 2002). This may be the reason why there are high level of losses in tomatoes harvested at fully ripened stage in India. Lack of Appropriate Harvesting Containers: Tomatoes are harvested by manual picking instead of mechanical picking in most parts of the country. In harvesting, care should be taken to avoid mechanical damage which can be an entry point for disease causing pathogens. The majority of farmers use wooden crates and woven baskets with hard and sharp surfaces which cause mechanical injuries to the harvested fruits. Overloading during harvesting can cause a build-up of excessive compressive forces resulting in crushing of fruits that are found at the base of the containers (Hurst, 2010). The use of smooth surface shallow containers that will prevent overloading will therefore result in reduction in both mechanical injuries and crushing to the harvested fruits. Kitinoja (2008) has therefore recommended the use of plastic basket for harvesting tomatoes. Excessive Field Heats and Lack of on-farm Storage Facilities: The field heat of harvested crop is usually high, and should be removed as quickly as possible before any postharvest handling activity (Janet and Richar, 2000). Field heats also give rise to a sudden increase in metabolic activity and prompt cooling after harvest to reduce the metabolism is very important (Akbudak et al., 2012). The optimum temperature for tomato harvesting of about 20oC can be attained either in the early hours of the morning or late in the evening. Harvested fruit must be pre-cooled to remove excessive field heat if harvested at times other than the recommended periods. This can be achieved by assembling harvested fruits at a central point with a cooling system in place. It is seen that in India farmers harvest their tomatoes in the morning and evening; most of them store the harvested tomatoes under tree shades until buyers arrive. Tree shade is not reliable as it is likely to shift away from the produce when there is delay in the arrival of buyers. The fruits are therefore exposed to the scorching sun causing a build-up of field heat in the produce. Farmers in developed countries make use of on-farm cooling systems in dealing with excessive field heats. An example of such facility used in the US is the force-air cooling system. Farmers in developing countries on the other hand however don’t have the capacity to install such technologies on their farms and have therefore improvised other cooling systems. This is an indication that over 90% of farmers have no on-farm storage facilities and therefore leave their harvested produce at the mercy of the weather. This can result in excessive loss of moisture and subsequent deterioration of the produce. The adoption of a simple on-farm structure like a small hut for temporal storage of harvested produce can be very beneficial in pre-cooling which is the first step in good temperature management in harvested produce Inappropriate Packaging Materials: A good packaging system should protect the commodity against pathogens, natural predators, moisture loss, temperatures extremes, crushing, deformation and bruising of the product. Methods of packing can affect the stability of products in the container during 73

74


shipping, and influence how much the container protects their quality. Pre-packaging or consumer packaging generally provides additional protection for the products (McGregor, 1987). The majority of these packaging materials do not allow better aeration within the packaged tomatoes causing a build-up of heat due to respiration. Poor Field Sanitation: Sanitation is of great concern to produce handlers, not only to protect produce against postharvest diseases, but also to protect consumers from food-borne illnesses. Fresh produce has being one of the main sources of food-borne illness outbreaks (Gombas et al., 2003). For example, Salmonella, Hepatitis and Cyclospera are among the diseases causing organisms that can be transferred via fresh fruits and vegetables like tomatoes (Kedar, 1986). Use of a disinfectant in precooling water can help to prevent both post-harvest diseases and field heat in produce. Fruits and vegetables are usually treated with chlorinated water after washing to reduce the microbial load prior to packaging. Workneh et al. (2012) indicated that anolyte water dipping disinfection of tomatoes did not only reduce the microbial loads on the fruits but also maintained superior quality of tomatoes during storage. Off-farm Challenges Condition of Roads: Majority of the production fields are located in remote areas, which are far from improved roads making access to competitive markets difficult and costly. The bad state of road and other infrastructure makes it very difficult, expensive and time consuming to transport harvested produce to marketing centres. Meanwhile any delay between harvest and consumption of the tomatoes can result in losses (Kader, 1986). Mode of Transportation: During transportation the produce should be immobilized by proper packaging and stacking, to avoid excessive movement or vibration. Vibration during transportation may cause severe bruising or other types of mechanical injury (McGregor, 1987) which is one of the major causes of postharvest losses to most fruits and vegetable especially tomatoes (Idah et al., 2007). Lack of Reliable Market: Market availability is a big challenge facing most tomato producers in developing countries. This challenge can be attributed to many factors. One of the factors is the pattern of production resulting in gluts. Although, there has been a tremendous improvement of the use of irrigation scheduling in dry season tomato production, a greater proportion of producers still rely on rainfed production. This causes high peaks in production which is always more than fresh consumption demand of the fruit locally. The problem is further compounded by lack of processing facilities which can be used to process the fruits into a more durable form for later consumption. Producers from developed countries always have supply contract with multinational supermarkets to supply tomatoes. An example is the Blush tomatoes in Guyra of New South Wales in Australia. Blush tomatoes supplies Coles and Woolworth with tomatoes making access to market already predetermined for the producers. In our case, there is no information on reliable market availability. There is lack of communication between producers and consumers, and also lack of market information (Kader 2005). This has been the main reason for the mismatch between production and available markets. There are good varieties of tomatoes in India, but only a few are suitable for industrial processing with regard to quantity and quality. The research also revealed that India is still not a major exporter of either fresh or processed tomato products despite the high production of fresh tomatoes. This may be due to inadequate supply of good quality seeds, inadequate storage facilities, poor disease and pest management, and poor processing facilities. The development of tomato for industrial use is currently gaining momentum, in the area of production of tomato juice, paste, ketchup, puree, and powder. Strategies identified to overcome the challenges include: policy shift to encourage Small and Medium Enterprises (SMEs) as well as Industries along the value chain; improved input supplies; organisation of farmers into cooperatives so as to initiate innovative funding mechanism for them; establishment of clusters for processors; improvement in marketing strategies including guaranteed price for fresh tomato products; adjustment in tariff regime to favour local manufacturers including outright ban on importation of processed tomato products; increased investments in Research and Development (R&D) to produce improved seed varieties and develop technologies for storage and processing; adoption of Good Agricultural Practice (GAP) by farmers (Chandrika et al., 2013).

Climate Change and Tomato Processing Industry

75

Opportunities in Tomato Processing 1. Increase in the number of teenagers and youngsters with higher spending power as well as increase in working population (especially women), is fuelling growth of Fast food industry in India and globally. Tomato products are one of the most important ingredients in ready to eat or fast food products thus increasing its usage as important taste maker / enhancer and flavoring ingredients. 2. Change in food consumption pattern in the last one decade in India in general and Gujarat in particular, has increased per capita consumption of fast foods such as pizza, sandwiches, burgers, hotdogs, Indian snacks like cutlets, Samosa, Kachori, Pakoda etc; in all classes of people and is boosting the market for processed tomato products like Tomato paste, puree, ketch up and sauces etc;. Increasing use of convenient snacking and variety of cosmopolitan fast food items like noodle, pasta, macroni, spaghetti has also boosted use of tomato products both in domestic and export markets. 3. Newer mode of packaging products such as Multi layer- Flexible plastic packaging, Tetra pack and Brick packing has made it possible to distribute tomato products to wide, distant and remote areas and store them at room temperature for a period of more than 4 months. It has also increased the shelf life of these products, which has contributed substantially in boosting the demand of tomato products in India and Globally. Conclusion: Climate change is a major cause which affects the good quality of tomato production throughout the world. Though, there are many promising dynamics which support good growth of tomato processing industry. There are still some significant constraints which, if not addressed sooner in future, can hamper the growth prospects of this industry in India. One of the biggest constraints is that this industry is capital intensive. It creates a strong entry barrier and allows limited number of players to enter the market. Major challenges faced by the Indian tomato processing industry are educating consumers that processed foods can be more nutritious; dealing with low price elasticity for processed products; need for distribution network; development of marketing channels; streamlining of food laws; improving product quality standards and strengthening product testing network; strengthening institutional framework to develop manpower for improving R&D capabilities to address global challenges. References Akbudak, B., Akbudak, N., Seniz, V. and Eris, A. (2012). Effect of pre-harvest harpin and modified atmosphere packaging on quality of cherry tomato cultivars “Alona” and “Cluster” British Food Journal, 114(2):180196. Alam, T., Tanweer, G. and Goyal, G.K. (2007). Packaging and storage of tomato puree and paste. Stewart Postharvest Review, 3(5): 1-8 Annapoorna. (2011). World of Food India. http://www.worldoffoodindia.com Anonymous. (2006). Food Processing, India Brand Equity Foundation. Confederation of Indian Industry, New Delhi, India. Bhardwaj, M.L. (2012). Effect of Climate Change on Vegetable Production in India. Vegetable Production under Changing Climate Scenario (Training manual), edited by Bhardwaj et al., CAFT, Dr. YS Parmar Univ. of Horti. & Foret., Solan (H.P.), pp. 1-12. Bhuyan, A. (2010). “India’s Food industry on the Path of High Growth” Indo-Asian News Service. Chandrika Ram, Goyal, S. K. and Kumar Manoj. (2013). Post-Harvest Management (PHM) of Horticultural Produce-Present Need. Agricultural Education, Research and Extension in India (Edited by Goyal, S. K. et al.,).Poddar Publication, Varanasi, pp. 124-129. FAOSTAT (2014). http://faostat.fao.org/site/1367/Default.aspx. Accessed: 04.01.2014. Giovannucci, E.; Rimm, E.B.; Liu, Y.; Stapfer, M.J. and Williett, W.C. (2002). A prospective study on tomato products - lycopene and prostate cancer risk. J. Natl. Cancer Inst., 94:391-8. Gombas, D.E., Chen, Y., Clavero, R.S. and Scott, V.N. (2003). Survey of Listeria monocytogenes in ready-toeat foods. Journal of Food Protection, 66:559–569. Grandillo, S., Zamir, D. and Tanksley, S.D. (1999). Genetic improvement of processing tomatoes: A 20 years perspective. Euphytica 110: 85–97. Hurst, W. C. (2010). Harvest, handling and sanitation commercial tomato production. Handbook B 1312. CAES Publications. University of Georgia. Idah, P.A., Ajisegiri, E.S.A. and Yisa, M.G. (2007). Fruits and Vegetables Handling and Transportation in Nigeria. AUJT, 10(3): 175-183.

75

76


Janet, B. and Richard, E. (2000). Postharvest handling of fruits and vegetables. An Appropriate Technology Transfer for Rural Areas (ATTTRA) Horticulture Technical note, 1-19. Kader, A.A. (1986). Effects of postharvest handling procedures on tomato quality. Acta Horticulture (ISHS), 190: 209-222. Kader, A.A. (1992). Post-harvest technology of horticultural crops. 2nd Ed. Univ. Of California, Div. of Agri. and Natural Resources. Public. 3311. Kader, A.A. (2005). Increasing food availability by reducing postharvest losses of fresh produce. Acta Hort., 682: 2169-2176. Kitinoja, L. (2008). Causes and sources of post-harvest problems. Post-harvest Training CDRom\Sample Presentations. From Ghana, pp 1-19. Maini, S.B. and Kaur, C. (2000). New developments in processing of horticultural Crops. In: National Seminar on Hi-Tech Horticulture organized by NAAS and Hort. Soc. of India, New Delhi and IIHR, Bangalore (2628th June, 2000), pp. 104-109. McGregor, B.M. (1987). Tropical products transport handbook. USDA, Agric. Handbook No. 668. 148. Merchant, A (2008). India- Food Processing Industry. OSEC Business Network land. www.osec.ch Moneruzzaman, K. M., Hossain, A. B. M. S., Sani, W., Saifuddin, M., and Alenazi, M. (2009). Effect of harvesting and storage conditions on the post harvest quality of tomato (lycopersicon esculentum mill) cv. roma VF. Australian Journal of Crop Science, 3(2): 113-121. Naika Shankara, Joep van Lidt de Jeude, Marja de Goffau, Martin Hilmi, and Barbara van Dam. (2005). Cultivation of tomato: production, processing and marketing. Agrodok 17. Agromisa Foundation and CTA, Wageningen. Orzolek, M.D., Bogash, M.S., Harsh, M. R., Lynn, F., Kime, L.F., Jayson, K. and Harper, J.K. (2006). Tomato Production. Agricultural Alternatives Pub. Code #UA291, pp. 2-3. Reid, M.S. (2002). Maturation and Maturity Indices. University of California, Agriculture and Natural Resources Publication, Oakland. Sadler, G.D. and Murphy, P.A. (2010). pH and titratable acidity. In: Nielson S.S. (ed): Food Analysis. str. 219238. Springer Science + Business Media, LLC2010. New York, USA. Toivonen, P.M.A. (2007). Fruit maturation and ripening and their relationship to quality. Stewart Postharvest Review, 3(4): 1–5. Ugonna, C.U., Jolaoso, M. A. and Onwualu, A. P. (2015). Tomato value vhain in Nigeria: Issues, challenges and strategies. Journal of Scientific Research & Reports, 7(7): 501-515. Watkins, C.B. (2006). The use of 1-methylcyclopropene (1-MCP) on fruits and vegetables. Biotechnology Advances, 24(1): 389–409. Workneh, T. S., Osthoff, G., and Steyn, M. (2012). Effects of pre-harvest treatment, disinfections, packaging and storage environment on quality of tomato. Journal of Food Science and Technology, 49(6):685-694.

IMPACT OF CLIMATE CHANGE ON VEGETABLE CROPS Rupesh Kumar Mandal, Akhilesh K. Pal, Kulveer S. Yadav, Ravi Kumar and Pankaj K. Singh Department of Horticulture, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi- 221 005, E-mail: [email protected], Corresponding Author: Rupesh Kumar Mandal

C

limate change has undoubtedly resulted in greater public involvement with a scientific subject than with any other topic in the history of modern science. The climate change is real phenomena and it will have impact on productivity and livelihood of primary farming options. Tropical and subtropical regions are among the most vulnerable to this climatic catastrophe which affect local production of foods particularly perishable like vegetables. The phenomena will lead to a situation of high temperature, high humidity and low light with excess or deficit moisture. This change will help pest dynamic and buildup of their population but negatively affect the crop plants. Vegetable crop plants are herbaceous succulents and much prone to abiotic stresses. Most of them are grown in different agro-climatic situations than their evolutionary regions which make the vegetables more vulnerable to adverse climatic factors and associated losses. The severity of environmental stress imposed on vegetable crops varies with their genotypes and other crop factors. Climate change factored rise in temperatures, reduction in irrigation water or drought situation, occurrence of frequent to prolonged flooding, occurrence of acidity or rise in salinity levels and increase in wind velocity are going to be major limiting factors in sustainable vegetable production. Temperature and water stress can affect the photosynthesis, reproductive growth and mineral uptake, resulting in poor growth of fruits and vegetables. This may lead to lower nutritive value of horticultural produce. Studies have indicated that soil water stress at early stages of onion crop growth caused 26% yield loss. In tomato, water stress accompanied by temperatures above 28°C induced about 30–45% flower drop in different cultivars. Chilli, with 60% area under rainfed cultivation, also suffers drought stress, leading to yield loss up to 50–60%. The production technologies like integrated nutrient management practices and in situ soil conservation and polythene mulching have been developed for rainfed chilli production. Effect of Climate Change 1. Increase in temperature increases transpiration and in drier regions leads to water stress causing yield reduction. In India, only about 41% area is irrigated and remaining 59% is rainfed. Even if we realize full irrigation potential in the country, nearly 50% area will still remain rainfed. Under such circumstances, increase in temperatures and changes in rainfall patterns . 2. The changed climate will probably lead to a decrease in crop productivity, but with important regional difference. 3. High temperature increases the rate of development in plants. A short life cycle, though less productive, can be beneficial for escaping drought and frost and late maturing cultivars could benefit from faster development rate. In colder regions, global warming could lead to longer of growth period and optimal assimilation at elevated temperatures 4. Droughts, floods, tropical cyclones, heavy precipitation, and heat waves will negatively impact agricultural production. 5. Rapid melting of glaciers in Himalayas could affect availability of water for irrigation especially in the Indo-Gangetic plains as well as neighboring countries. 6. The current fertilizer-use efficiency that ranges between 2% and 50% in India is likely to be reduced further with increasing temperature. 7. Small changes in temperature and rainfall will have significant impact on quality of fruits and vegetables with resultant implications in domestic and external trade. 8. Changes in temperature and humidity will also change insect pest and disease population. Effects of Carbon Dioxide on Vegetables: Increased CO2 has also been reported to enhance the concentrations of a number of bioactive components vegetables. In their review, increased sugars, ascorbic acid, phenols, flavonoids, anthocyanins, colour, firmness, starch and reduced organic acids, alkaloids were reported for many fruits and vegetables. Development of Vegetable Cultivars for Various Climatic Conditions: Agriculture which is sensitive to the climate changes will react sharply to these changes. The cropping pattern change and the change in planting seasons will put pressure on the breeders to develop adaptable hybrids for these

78


conditions. With the changing climatic conditions, the host pathogen interactions will also change. It was observed that more virulent pathotypes are emerging and affecting the crops. Breeding for Abiotic Stress: The breeding for resistance to these stresses is going on presently in many crops. Crops like tomato and hot peppers are bred to grow under high and low temperature without losing the ability to yield as much as in the normal conditions. Losses due to Diseases: Around 35-40% loss of vegetable production occurred every year globally. There are about 100,000 microbial/fungal pathogens, 10,000 insect pathogens and 30,000 weeds causing extensive damage to vegetable crops. In India, almost 1.40 lakh tonnes of pesticides are consumed in vegetable growing. The pre-harvest losses in vegetables in India are 10.5%. Yield Potential Traits: Starch biosynthesis plays an important role in plant metabolism. ADPglucose pyrophosphorylase (ADPGPP) is a critical enzyme for regulating starch biosynthesis in plant tissues. The hybrid produces about 60% more tomatoes than the average tomato plant, and the sugar content of the fruit is also higher than normal. It carries a mutation in a single gene that controls the timing of flower formation. Development of Tomato Cultivar for Abiotic Stress: Abiotic stress is the primary cause of crop loss worldwide, reducing average yields for most major crop plants by more than 50%. As tomato cultivation is taken all round the year and in arid regions, development of cultivars with improved fruit set under high temperatures is the need of the hour for crop production in regions where the temperature during part of the growing season reaches 35 oC or higher. Development of Potato Crop for Abiotic Stress: Potato is a native of temperate region grown under long-day conditions in mild and cool summer season in Europe and America was introduced and adapted to tropical short-day conditions in India during the last century. The crop is mainly con fined to Indo-gangetic plains in mild and cool winters in India. The autumn/winter planted crop in northern plains of India comprising the states of Uttar Pradesh, West Bengal, Bihar, Punjab, and Haryana, contributes 84% of total potato production in India. Global warming is likely to increase the incidence of viral, late blight, charcoal rot, and bacterial wilt and has little effect on early blight and may decrease wart, powdery scab, black scurf, and common scab diseases in Indo-gangetic plains. It is estimated that due to global warming, potato production in India may decline by 3.16% and 13.72% from current levels by the year 2020 and 2050, respectively. References Biswas, M.K., De, B.K., Nath, P.S. and Mohasin, M. (2004) Influence of different weather factors on the population build up of vectors of potato virus. Ann. Plant. Prot. Sci., 12: 352–355. Fleisher, D.H., Timlin, D.J. and Reddy, V.R. (2006) Temperature in fl uence on potato leaf and branch distribution and on canopy photosynthetic rate. Agron. J., 98: 1442–1452.

IMPACT OF CLIMATE CHANGE AND FOOD SECURITY Bijendra Kumar Singh, Akhilesh K. Pal, Kulveer Singh Yadav and Ravi Kumar Department of Horticulture, Institute of Agricultural Science, Banaras Hindu University Varanasi-221 005, E-mail: [email protected], Corresponding Author: Bijendra Kumar Singh

F

ood security is defined by FAO as the physical and economic access to food for all people at all times. Some of the prominent climate change impacts are growing deserts and increase in the magnitude of floods and droughts. An extreme decline in crop yields in arid and semi arid areas globally has caused food shortages and a manifold increase in food inflation. Countries of Africa, Middle East, Arab and Asia have close economic ties with natural resource and climate dependent sectors such as forestry, agriculture, water, and fisheries. Food scarcity is the biggest problem global and it severely affects the arid and semiarid regions/countries. Climate change has resulted in increases in globally- averaged mean annual air temperature and variations in regional precipitation and these changes are expected to continue and intensify in the future. The direct impact of climate change on agriculture and food supply has been expected to includes shortage in grain production resulting in less availability of food items, especially to the economically poor people, changes in agricultural inputs such as fertilizers and pesticides, shift in planting dates of agricultural crops, preference of crop genotypes due to adaptation to changing climate, soil erosion, soil drainage and lower soil fertility levels. Additionally, the incidence of pests, weeds and diseases in food crops will be more pronounced. High anthropogenic production of greenhouse gases and associated changes in climate are also being looked upon as a great challenge to food and livelihood security in India. Climate change will make monsoons unpredictable. As a result, rain-fed wheat cultivation in South Asia as well as total cereal production will go down and crop yield per hectare will be hit badly, causing food insecurity and loss of livelihood. The rising levels of the sea in the coastal areas will damage nursery areas for fisheries, causing coastal erosion and flooding. Agricultural land will shrink and the available land may not remain suitable for the present crops for too long. Farmers have to explore options of changing crops suitable to weather. Climate Change and Food Security: Food security has been defined by World Food Summit in 1996 as Food security exists when all people, at all times, have physical, social and economic access to sufficient, safe and nutritious food which meets their dietary needs and food preferences for an active and healthy life. According to this definition, there are three main dimensions to food security: food availability, access to food, and food absorption. Thus, adequate food production alone is not a sufficient condition for a country's food security. Climate change affects food security in complex ways. It impacts crops, livestock, forestry, fisheries and aquaculture, and can cause grave social and economic consequences in the form of reduced incomes, eroded livelihoods, trade disruption and adverse health impacts. However, it is important to note that the net impact of climate change depends not only on the extent of the climatic shock but also on the underlying vulnerabilities. Much of the literature on the impact of climate change on food security, however, has focused on just one dimension of food security i.e., food production. Recommendations to Overcome Climate Change Adoption of Sustainable Agricultural Practices: The main problem of Indian agriculture is low productivity. To meet India's growing food demand, there is an acute need for increasing productivity in all segments of agriculture. But given the vulnerability of Indian agriculture to climate change, farm practices need to be reoriented to provide better climate resilience. India needs to step up public investment in development and dissemination of crop varieties which are more tolerant of temperature and precipitation fluctuations and are more water and nutrient efficient. Agricultural policy should focus on improving crop productivity and developing safety nets to cope with the risks of climate change. Stronger Emphasis on Public Health: India has historically had a poor record in public health. With the worsening challenges of climate change, the country's policymakers have also paid little attention to its impacts on health. Despite the fact that the disease burden from vector-borne and diarrheal diseases is very high in urban slums and tribal areas of India, this area was overlooked when the original National Action Plan for Climate Change (NAPCC) was formulated. The Ministry of Health is currently formulating a National Mission for Health under the ambit of NAPCC but given the close

80


relationship between climate change, infectious diseases and food absorption, public expenditure on health needs to be stepped up drastically. Long-term Relief Measures in the Event of Natural Disasters: India's disaster management strategies are mostly inadequate, short lived and poorly conceived. Also, much of the emphasis is laid on providing quick relief to the affected households as opposed to developing long-term adaptation strategies. Little effort is made towards addressing the long-term impacts of natural disasters on agricultural productivity and under nutrition. A recent report by NITI Aayog suggests that “the government should transfer a minimum specified sum of cash to affected farmers and landless workers as an instant 58 relief. For richer farmers who may want insurance above this relief, the report recommends a separate commercially viable 59 crop insurance programme. Need for more Impact Assessment Studies: To develop climate-resilient strategies and make adequate policy interventions, there is a need for an integrated assessment of the impact of climate change on India's food security. So far, there are fewer studies on the impact of climate change on other dimensions of food security besides production. Research efforts should be directed towards assessing and quantifying where possible the impact of climate change on under nutrition and food absorption. References Misra, A.K. (2014). Climate change and challenges of water and food security. International Journal of Sustainable Built Environment, 3: 153-165. Sinha, S.X., Rao, N.H. and Swaminathan, M.S. (1988). Food Security in The Changing Global Climate. Indian Agricultural Research Institute, New Delhi, India.

TARGETING GLOBAL SUSTAINABILITY–FOOD SECURITY, BIODIVERSITY AND CLIMATE CHANGE A. Jha Tata Institute of Social Sciences (Tuljapur Campus), E-mail: [email protected]

S

ustainability has a temporal factor underlying it and to meet the temporal demands, one has to take in concern the minute but major factors which would decide the sustainability concerns in a major way. These sustainability concerns are mainly Environmental especially Biodiversity and the related change in Climate. One could talk of the Food security in this regard .Food security, when we talk about it ,is dependent on four different factors and as there are mainly four different pillars :Availability, Accessibility ,Affordability and these four main concerning factors has interwoven factors which would decide an important dialogue with the biodiversity and Environment because it is the affordability of the nutritious food with accessibility and also the substantive factors which would decide that the biodiversity and environment as a whole (Capone et al.,2014). This factor embeds within it the ecological concerns. When we talk about ecology, the knowledge regarding the ecological benefits is an important factor to be taken into consideration. Let us analyze these issues with the help of the few case studies in the Aravallis region. Historical Account and Geophysical Feature of the Chosen Area: Udaipur district which is in the Southern region of Rajasthan consists of elevated plateaus in Northern region of the district. 'Pai Panchayat' in the Girwa block is located in this region and consists of small village hamlets called ‘Falas'.

The Aravallis are the mountain region on which this village is located. As per the interview and discussion with the Tribal communities living here, they settled here 2-3 hundred years back mainly for the Livelihood. As the Udaipur city is located just 30 kms Away, they could easily sell the woods in the nearby market which eventually has led to large amount of deforestation in the area because of the forest cutting and felling of trees .Lack of water Availability over the years has been disturbing the livelihoods of the Local communities living in the area.

The tribal community living here are the Bhil Minas. There are 2 or 3 families who consider themselves more superior than other Minas in the village .These Minas who consider themselves as superior mostly practice the customs of the Rajputs. The geographical make up of this area makes the living condition of the villagers difficult because of the remote locations of household within a Falas itself ,few households are located on the top of the hills and there are no roads and transport facilities .Children in remote Falas are usually deprived of the education because the far locations of schools .

82


In fact, the remoteness of the dwellings has led to the death of few children a few years back, in rainy season while they for heading towards school. The household in this Falas are very far away from each other. The household chosen is in ‘Hamlipeepla’ fala located on a top of a hill. In such situation an overall deprivation of the Food security hampers the sustainability in the livelihood of the .local community. Climate Change

Geographical barriers

Lack of Diversification in Crops

Food Insecurity

Hampered Biodiversity

Household Analyses for analyzing Sustainability

The important factors chosen to analyze the food security of the household are as follows. First of all, the Geographical area in which this household is located. It takes 8-9 kms to reach to the bus stand and the nearby household to this household is around half meter away. Thus,’ Social contact and support' is missing which might further become a reason for poverty as social cohesion and asset is necessary to build a sustainable livelihood as that might help at the time of shock. Also, this might make it difficult for various Government schemes to function properly as the close locations of household would make it easier for facilitation of water or sewage facilities. Second reason for opting this household is social in context. The number of family members within this household are 5.The male of the house has relations with other women in the village which leads to family dispute and domestic violence within the family .And this has eventually deprived the children from education . The parents are barely careful of their children future and have no aspirations for them. The deprivation of literacy makes it impossible for them to aspire for the future. They are unaware of different government programmes and which are necessary for the sustenance of the household. Also, this household falls under the ‘’ BPL' with monthly income of 5,000-6,000 Demographic Particulars: The family chosen belongs to the 'Kharari' community among Bhil Meenas.The age of household members varies from 5-40 years. Total members of the household are '5' and they follow Hindu religion and celebrate Hindu festivals. Along with that, they have certain faiths and ceremonies of their own where they are supposedly spending money out of religious pressure. The normal death age in this village is around 60 years for men and women both. Living Condition: Living condition of the household is less than satisfactory. There is no sewage facility and they practice open defecation. They have a kutchha house .There generally cook food on chulhas .There is no tilt towards hygiene among the house members .They mainly depend on the tube well for drinking water or go 3-4 kms away to bring water from a pond(which is mostly dry) in a nearby Fala. Electricity connections are available. Household Belongings and Assets: Even though the house is a kutchhahouse, the electricity connection has made them to buy TV and dish TV for cable connection. Other than that, only grocery items could be observed and there are no modern appliances like fridge or cooler. Livelihood Strategies: The sources of the family income and the total family income are as follows: Sources of Income Agriculture Income NREGA Construction work

Total Period NIL 100 days(male members) 15-20 days(5-4 months)

Income Nil Rs. 150 /Day Rs. 120-150/day

Targeting Global Sustainability–Food Security, Biodiversity and Climate Change

83

As the agricultural income is not enough and they own just 2 acres of land with production of maize and wheat which is just enough for self a consumption, they mostly rely on other sources of income like NREGA or the male member working in the Udaipur city in a construction factory which again is irregular and seasonal in nature..Other than that, they find employment in Horticulture department works like afforestation projects for 15-20 days earning rupees120-150 per day but that again is irregular.Thus,yearly income varies from 50,000-60,000. Migration Pattern: There is no seasonal migration as such. Only the male member migrates to the Udaipur city on daily bases working as wage labourer in the construction factory and earning rupees 150 -200 per day. Employment as the construction work is irregular and uncertain. Indebtness: The household do not practice taking loans and hence are not indebted. They mostly get daily wages which they spend on daily bases .As they are not employing any modern techniques on their farm; they generally don’t take loan for agricultural land. The indebtedness is meager but the poverty still persists. Educational Status: The male member of the family had his education till class 5th and his wife never went to school. Children are not going school from past few days .Due to the Domestic violence and regular fights among parents, they are negligent towards education and pay less importance to future of their children. Food Consumption Pattern: They mostly rely on the local crops and maize is the staple diet as it is grown in abundance. There is no nutritious diet being given to children, every food item either as maize or wheat as the major ingredient. Thus, one could observe the malnourishment among the children .There is no variety in the type of vegetable cooked too. The pulses as they are not grown much, does not become the major diet. Health Status: There are no health problems in the family except the problem of malnourishment among children. Coping Mechanism: As the household is mainly concern on the ‘daily’ survival technique, they do not have major coping mechanism available .Water unavailability and lack of rain which is a major threat puts them into grievous situation. The only coping mechanism is migrating to nearby city and working on daily bases which might become a problem in future. Gender Issue: The household is mainly patriarchal in nature .Male member has done two marriages without the consent of the female member in the family which is leading to the domestic violence in the family.

Position in Social Hierarchy: As they belong from tribal area and are secluded from city, hence, social hierarchy and caste problems do not exist in this area. And family don not face any form of discrimination. Socioeconomic Relations with other Household in the Area: There is no such impact of socioeconomic relation as the family owns 2 acres of land which is average land holding in the village and they do not work on others land too. As there no social hierarchy encountered among the tribals, so the effect of socio-economic disparities become nil. The kinship networks have similar living conditions .one could not see any reference group which could motivate them for inter-generational change among the family members.

84


Perception about Government Schemes: 'Government does nothing and we don't want anything from Government, they are thieves’, as said by the male member of the household. Hence, they have a very negative perception about the Government schemes which according to them is only for Government's profit. As most of the time, they do not even get the proper ration from PDS, it has despaired them and they believe that Government schemes are mostly a profit making techniques. The only thing they are satisfied with is the employment from NREGA. Perception regarding their Development: One could not observe the inter-generational change among the family .As can be seen, the family environment has led to the drop-out of the children. For them development is living in the moment and they believe that people in the city are have more unsatisfactory life than them. They just demand for meeting the daily livelihood needs. Analysis & Conclusion: The geographical make up of the area, has led to the deprivation among these tribes. One could observe the spatial disparities as this tribal belt is just 30 kms from the Udaipur city but is miles away from so called 'Development' and 'Developmental schemes. Most of the schools do not have teachers as they avoid coming here due to the remoteness of the area. Transport facilities are stopped after 6 pm and no transports are allowed in the area. There is just 1 PHC where doctors are not available most of the time. Cultural factor also account for the poverty among them as they consume a lot of liquor (male and female), polygamy and bigamy is common, hence,5-6 children could be observed among in most of the families. Hence, intermingling of several factors is leading to the poverty among the interviewed household and the village Panchayat as a whole. Global Sustainability: The above case study clearly states how the disturbance in the availability of the local resources disturbs the food security. The disturbance is not only due to the environmental factors but also the lack of knowledge regarding the same (John Toye, 2014). But the Biodiversity itself might become the impeding factor where the geographical make up of an area hampers the local food security as the availability, accessibility, utilization and stability might come to a losing end. Diversification in the cropping pattern comes as a solution. Local concerns, therefore, can be linked to the Global sustainability issues where the while deciding upon the ecology concerns as a whole local settlements and livelihood of the same should be analyze

References Capone, R., Bilali, H. E., Debs, P., Cardone, G., & Driouech, N. (2014). Food System Sustainability and Food Security: Connecting the Dots. Journal of Food Security, 2(1), 13-22. Toye John. (2012). Human development in an environmentally constrained world in the post-2015 era. Background paper prepared for World Economic and Social Survey 2013.

INFLUENCE OF CLIMATE CHANGE ON SOME FOREMOST FLORICULTURAL CROPS Kulveer Singh Yadav, Akhilesh K. Pal, Ravi Kumar, Pankaj K. Singh, and Rupesh K. Mandal Department of Horticulture, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi-221 005, E-mail: [email protected], Corresponding Author: Kulveer Singh Yadav

C

limate change is one of the most important global environmental challenges in the history of mankind. It is mainly caused by increasing concentration of Green House Gases (GHGs) in the atmosphere. Subsequently, United Nations General Assembly in 1992 formed Intergovernmental Negotiating Committee for Framework Convention on Climate Change (UNFCCC) which finally adopted the framework for addressing climate change concerns. Climate of the planet earth is always in a state of change as a natural process influenced by both natural variability and induced environmental changes due to anthropogenic reasons. Natural causes include continental drift, volcanoes, earth’s tilt and ocean current while human causes are GHGs, agricultural practices, energy sources, waste disposal, depleting forest cover, etc. Flowers, being most sensitive part of a plant are expected to be affected most by the climate change. For increased CO2 concentrations, most of the flower crops are responding positively by the enhanced rates of photosynthesis and biomass production. Carbon dioxide levels of 800-1800 ppm have proven to be optimal for the majority of flower crops grown under protected cultivation. Crop production is sensitive to variability in climate in general and temperatures in particular. Temperature is a major factor for the control of plant development, and warmer temperatures are known to shorten development stages of determinate crops leading to reduced yield of a given crop. Growth and development of any plant is largely an expression of the interaction of the genotype with the environment. The environmental factors which contribute to this include temperature, duration and intensity of light, humidity and carbon dioxide. Climate Change and Floriculture: The impact of climate change on flowering plants and crops is becoming apparent. Commercial production of flowers, particularly grown under open field conditions, will be severely affected leading to poor flowering, improper floral growth and colour development besides reduction in the blooming span. Melting of ice cap in the Himalayan regions will alter temperatures, normally required for flowering of many ornamental plants like Rhododendron, Orchid, Tulip, Alstroemeria, Magnolia, Narcissus, etc. Some of them will fail to bloom or flower with less abundance while the others will be affected differently. Indigenous species in the natural habitat may not proliferate and will be under threat of unfavorable agro-climatic conditions. Unseasonal monsoon may deprive the Western Ghats and surrounding regions of normal precipitation, affecting those species requiring higher humidity and water. Similarly, the plains may also be affected either by drought or floods and abrupt seasonal variations. The onset of new diseases, pests or even altered resistance to the existing pathogen/pests is also expected. The performance of some of the wellestablished commercial flowering cultivars may turn poor or may be erratic. The impact of climate change on flowering plants and crops will be more pronounced. Melting of ice cap in the Himalayan regions will reduce chilling required for the flowering of many of the ornamental plants like Rhododendron, Orchid, Tulipa, Alstromerea, Magnolia, Saussurea, Impatiens, Narcissus etc. Some of them will fail to bloom or flower with less abundance while others will be threatened. Indigenous species in the natural habitat will be under threat for not getting favourable agro-climatic conditions for their proliferation. Western Ghats and surrounding regions may be deprived of normal precipitation due to abnormal monsoon. Plant species requiring high humidity and water may find them under difficult conditions for survival. Plains of India will also have similar kind of problems and will be affected either by drought or excessive rains, floods and seasonal variations. Commercial production of flowers particularly grown under open field conditions will be severely affected leading to poor flowering, improper floral development and colour besides reduction in flower size and short blooming period. Effect of Elevated CO2 on Flower Crops: Pan et al. (2008) studied the effect of CO2 enrichment during morning and evening in Rosa hybrida and found an increase in cut flower production in the cvs. Escimo (41.5% and 18.2%) and Black Beauty (28.4% and 19.55%) respectively. In oriental

86


yellow poly-bud cut lily, CO2 at 600 ppm could increase the stem height (about 0.57 grades) and also had a positive effect on the growth of colour bud (Shenglin, 2005). Effect of Temperature on Flower Crops: Plant temperature is affected by radiation energy transfer and evaporation from the plant surface. Most of the flower crops in greenhouses are grown at specified night temperature with a minimum increase of 10–15°C. Gladiolus production at high temperatures (42–45°C) and dry air (42–45% RH) conditions resulted in low flowering percentage (54%) and the number of florets per spike (6.1) compared to 85% flowering and 8.5 florets per spike at 36–40°C and moist air (60–70% RH) (Shillo and Halevy, 1976). Optimum day and night temperatures for quality cut flower production is presented in following table: Crops Rose Carnation Chrysanthemum Gladiolus Gerbera Anthurium Vanda, Dendrobium and Phalaenopsis Cymbidium and Paphiopedilum Dahlia Tuberose

Temperature (°C) Day Night 20 15 18 13 15.60 8 23 15 16 12 23.90 18.3 26.50 15.5 13 10 25 16 16 30

Protected Cultivation: Most of commercial flower crops are grown under protected condition; therefore, change in climate may not affect global floriculture. But in India, commercial floriculture practiced under protected conditions is limited (about 5–10% of the total area) and restricted to the few regions of country. Flower crops particularly grown under open field conditions may be affected due to change in climatic conditions leading to poor flowering, improper fl oral development and colour besides reduction in flower size and short blooming period. Future Strategies: To mitigate the challenge of changing climate, we need to be proactive to understand and visualize climatic variation in future and work in collective and collaborative manner with multi institutional approach. Awareness and educational programmes for the growers, modification of present horticultural practices and greater use of green house technology are some of the solutions to minimize the effect of climate change. The most effective way to address climate change is to create awareness among grower to adopt a sustainable development pathway, besides using renewable energy, forest and water conservation, reforestation, etc. It is necessary that selection of plant species/cultivars is to be considered keeping in view the effects of climate change. The performance of different seasonal may not be satisfactory due to shorter and warmer winter. Judicious water utilization in the form of drip, mist and sprinkler will be a key factor to deal with the drought conditions. Development of new cultivars of floricultural crops tolerant to high temperature, resistant to pests and diseases, short duration and producing good yield under stress conditions, will be the main strategies to meet this challenge. References Pan, H., Zhang, Q., Liu, Q., Liang, S. and Kang, H. (2008) Effects of different CO2 enrichment programs during the day on production of cut roses. Acta Hortic., 766: 59–64. Runkle. E. (2006) Temperature Effects on Floriculture Crops and Energy Consumption. The OFA Bulletin, 894. Shenglin, W. (2005) Effects of high concentration CO2 on lily growth and its two allele chemicals. Chin. J. Appl. Ecol., 16(01):111–114. Shillo, R. and Halevy, A.H. (1976) The effect of various environmental factors on flowering of gladiolus. I. Light intensity. Sci Hortic., 4:131–137. Vision 2050 (2015) Directorate of Floricultural Research. I.C.A.R. pp. 1-24.

IMPACT OF CLIMATE CHANGE ON FOOD SECURITY OF INDIA Anjali Agrawal Assistant Professor, Law School, Banaras Hindu University, Varanasi

C

limate change is the largest environmental threat facing India today. Climate change has potentially large and alarming consequences for India, which is home to the largest number of hungry and deprived people in the world – to be precise 360 million undernourished and 300 million poor people. Sustaining supply of food itself is emerging as a critical issue. Temperature and its associated seasonal patterns are critical components of agriculture production system. Rising temperatures associated with climate change will likely have a detrimental impact on crop production, livestock, fisheries and allied sectors. Because of climate change, Indian agriculture is doubly vulnerable. First as around 50 percent of India’s total agricultural areas are rain fed, it is highly vulnerable to climate change impacts on monsoon. Secondaly, more than 80 percent of farmers in India are small and marginal (having less than 1 hectare of land) thus having less capacity to cope with climate change impacts on agriculture. Climate change affects food security through its impacts on all components of global, national and local food production systems, which is projected to affect all dimensions of food security, namely food availability; access to food and food utilization. Thus achieving food and nutritional security in a scenario of degrading natural resources (water, soil, bio diversity) and climate change seems to be a biggest challenge for India. Objective 1. The objective of this paper is to explore the effects of climate change on all the dimensions of food security of India. 2. It also explores ways to reduce negative impacts of climate change on food security of India through adaptation and resilience. Methodology: The present research paper is a secondary data based study. Data relating to the climate change and its impact on production has been collected from Environmental Statistics by Ministry of Planning and Programme Implementation, Economic Survey, Ministry of Finance Government of India, State of Agriculture, Ministry of Agriculture Government of India, and from research articles, papers and different websites. So far as the analysis of the data is concerned, the simple statistical tools and techniques such as percentage share, growth over previous year, relative shares have been used. 1. Food Security: The world food summit that took place in Rome, in November 1996, drew up an action plan on the promise that, “All people have the right to adequate food and to be free from hunger”. According to FAO (1996) “Food security exists when all the people at all the times have physical and economic access to sufficient, safe and nutritious food to meet their dietary needs and food preferences for an active and healthy life (Rome Declaration on World Food Security, 1996).” In the wider sense food security implies livelihood security at the level of each household and all members within, and involves ensuring both physical and economic access to balanced diet, safe drinking water, environmental sanitation, primary education and basic health care. Components of Food Security: Food security is conventionally viewed in terms of three components, Food availability, accessibility and utilization. 1. Food availability: The availability of sufficient quantities of food of appropriate qualities, supplied through domestic production or imports (including food aid). 2. Food Access: Access by individuals to adequate resources (entitlements) to acquire appropriate foods for a nutritious diet. 3. Food Utilization: Food utilization relates to the capacity of an individual to absorb and utilize the nutrients in the food, and is determined by practiced, beliefs, eating habits, hygiene, sanitation and health. 2. Climate Change: The Inter-Governmental Panel on Climate Change (IPCC) defines climate change as a change in the state of the climate that can be identified (e.g., using statistical tests) by changes in the mean and/or variability of its properties, and that persists for an extended period, typically decades or longer. The definition provided by UNFCCC defines as ‘a change that is attributed directly or indirectly to human activity that alters the composition of the global atmosphere

88


and that is in addition to natural climate variability observed over comparable time periods’ (Government of India, 2013). The important factors, which are responsible for climate change and are causally contributed by human civilization on earth, are- Greenhouse Gases, Deforestation, Land-use Change, Energy Usage, Vehicular Usage. In addition to this, water vapor, which absorbs the heat radiations from Sun and trap such radiations in the atmosphere making the earth warmer, is considered important. Emissions of GHGs beyond certain limits make earth’s atmosphere hotter and induce climate change. The extent of GHGs in the atmosphere increased phenomenally from 280ppm1 (1750) to 379ppm in 2005 (IPCC-AR42). 3. Implications of Climate Change for Food Security: Food security is one of the leading concerns associated with climate because any variability in climatic factor can directly affect a country’s ability to feed its people (Change et al., 2009). Climate change affects food security in complex ways. It impacts crops, livestock, forestry, fisheries and aquaculture, and can cause grave social and economic consequences in the form of reduced incomes, eroded livelihoods, trade disruption and adverse health impacts (Ahmad et al., 2011). However, it is important to note that the net impact of climate change depends not only on the extent of the climatic shock but also on the underlying vulnerabilities. According to the Food and Agriculture Organization (2016), both biophysical and social vulnerabilities determine the net impact of climate change on food security (Climate change and food security: risks and responses, 2016). What are the implications of climate change for the India’s food security system? To answer this it is necessary to examine the effects of climate change on all dimensions of food security such as: food production, access and utilization. 3.1 Impact of climate change on Agriculture Production and Food Security: Indian agriculture, and thereby India’s food production, is highly vulnerable to climate change largely because the sector continues to be highly sensitive to monsoon variability. After all, about 65 percent of India’s cropped area is rain-fed. From ancient times India’s agriculture has been dependent on monsoons. Any change in monsoon trends drastically affects agriculture. Even the increasing temperature is affecting Indian agriculture. Acute water shortage conditions, together with thermal stress, will affect rice productivity even more severely. Recent studies done at the Indian Agricultural Research Institute indicate the possibility of a loss of between 4 and 5 million tonnes in wheat production in the future with every rise of 1oC temperature throughout the growing period. Rice production is slated to decrease by almost a tonnes/hectare if the temperature rises by 2 degree celsius. In Rajasthan, a 2 degree rise in temperature was estimated to reduce production of pearl millet by 10 to 15 percent. If maximum and minimum temperatures rise by 3 and 3.5 degrees respectively, then soya bean yields in M.P will decline by 5 percent compared to 1998. Agriculture will be affected in the coastal regions of Gujarat and Maharashtra, as fertile areas are vulnerable to inundation and salinization. Figure-1. Interlinkage between climatic and non-climatic variables on Agriculture, Food Security and Poverty Climate Factor Rainfall Maximum, Minimum and Mean Temperature)

Agriculture Productivity (Land Productivity, Labour Productivity and Value of Production)

Fertilizers Irrigated Area Tractors, Pump set, Livestock)

Food Security and Its Components (Availability, Stability, Accessibility and Utilization of Food)

Poverty

Infrastructure (Road Length, Government Expenditure, Literacy Rate etc.)

Food Security Index and Interlink with Components of Food Security

Impact of Climate Change on Food Security of India

89

According to the 2006 Human Development Report of the UNDP, 2.5 billion people in South Asia will be affected by water scarcity by the year 2050 (UNDP, 2006). Rising temperature, changing precipitation patterns, and an increasing frequency of extreme weather events are expected to be the main reasons for reducing regional water availability and impacting hydrological cycles of evaporation and precipitation. This will drastically affect agriculture production in a region where over 60 percent of the agriculture is rained, such as in India. The impact of climate change on water availability will be particularly severe for India because large parts of the country already suffer from water scarcity, to begin with, and largely depend on groundwater for irrigation. According to Cruz et al. (2007), the decline in precipitation and droughts in India has led to the drying up of wetlands and severe degradation of ecosystems. About 54 percent of India faces high to extremely high water stress (Cruz et al., 2007). About 54 percent of India faces high to extremely high water stress (Tien et al., 2015). Large parts of north-western India, notably the states of Punjab and Haryana, which account for the bulk of the country’s rice and wheat output, are extremely water -stressed. Figure 2 shows that groundwater levels are declining across India. About 54 percent of India’s groundwater wells are decreasing, with 16 percent of them decreasing by more than one meter per year. North-western India again stands out as highly vulnerable; of the 550 wells studied in the region, 58 percent had declining groundwater levels. With increased periods of low precipitation and dry spells due to climate change, India’s groundwater resources will become even more important for irrigation, leading to greater pressure on water resources. According to the World Bank projections, with a global mean warming of 2°C above pre-industrial levels, food water requirements in India will exceed green water availability (Turn Down the Heat, 2013). The mismatch between demand and supply of water is likely to have far-reaching implications on food grain production and India’s food security. Figure 2: Groundwater level in India (meters below the ground level)

Source: World Resources Institute

Figure 3 shows that most districts with very high and high vulnerability to climate change are in Rajasthan, Gujarat, Maharashtra, Madhya Pradesh, Karnataka and Uttar Pradesh. Wheat and rice, two crops central to nutrition in India, have been found to be particularly sensitive

90


to climate change. Lobell et al (2012) found that wheat growth in northern India is highly sensitive to temperatures greater than 34°C (David et al., 2012). Figure 3: Vulnerability of Indian Agriculture to Climate Change (2021-2050)

Source: CA Rama Rao et al (2013)

The Intergovernmental Panel on Climate Change (IPCC) report of 2007 echoed similar concerns on wheat yield: a 0.5°C rise in winter temperature is likely to reduce wheat yield by 0.45 tonnes per hectare in India. Acute water shortage conditions, together with thermal stress, will affect rice productivity even more severely (Easterling et al., 2007). The disruption of established precipitation patterns negatively impacts Indian agriculture since agriculture systems have developed cropping patterns dependent on regional weather conditions. Across regions, precipitation patterns are changing with wet years becoming wetter and dry years become drier. The development of crops is also affected by increase in intra rain fall variability. This change could result in a greater number of heavy rainfall events a decrease in the overall number of rainy days, and longer gaps between rains, as well as increased rate of evapo-transpiration. Estimates show that the rise in mean surface temperature will not only affect the post-monsoon and winter weather, but it is likely to lead to a 70% decline in summer rainfall by 2050 (Johny, 2012). Monsoons are the lifeline of Indian agriculture so it is not surprising that the changes occurring in monsoon patterns are damaging crop yields. The timely arrival of the monsoon is of crucial importance to food production in the country and changing patterns in the monsoon are a threat to agriculture, food security, and the overall economy. The onset of the summer monsoon in India is getting delayed and disturbed. This affects crop cycles and cultivation in rainfed areas. Monsoon delays and failures inevitably lead to a reduction in agricultural output, thereby deepening food insecurity. 3.11 Temperature and its Impact on Crop Production: Temperature is an important variable influencing crop production particularly during rabi season. The indirect effects through the increase in temperature will reduce crop duration, increase crop respiration rates, increase evapotranspiration, decrease fertilizer use efficiencies and enhance pest infestation. A general warming trend has been predicted for India but knowing temporal and spatial distribution of the trend is of equal importance.


91

Lal (2001) reported that annual mean area-averaged surface warming over the Indian sub-continent is likely to range between 3.5 and 5.5oC by 2080s (Lal, 2001). (Table 1). Table 1. Climate Change Projections for India Year Season 2020s

2080s

Annual Rabi Kharif Rabi Kharif Annual Rabi Kharif

Temperature Change (0 C ) Lowest Highest 1.00 1.41 1.08 1.54 0.87 1.17 2.54 3.18 1.81 2.37 3.53 5.55 4.14 6.31 2.91 4.62

Rainfall Change (%) Lowest Highest 2.16 5.97 -1.95 4.36 1.81 5.10 -9.22 3.82 7.18 10.52 7.48 9.90 -24.83 -4.50 10.10 15.18

Source: Lal (2001).

The output of the studies so far carried out by Agarwal (2009) have indicated that a marginal 1°C increase in atmospheric temperature along with increase in CO2 concentration would cause very minimal reduction in wheat production of India if simple adaptation strategies like adjustment of planting date and varieties are adopted uniformly. But in absence of any adaptive mechanism, the yield loss in wheat can go up to 6 million tonnes. A further rise by 5 0C may cause loss of wheat production up to 27.5 million tonnes. Similarly, rice yields may decline by 6% for every one degree increase in temperature. 3.12 Role of Greenhouse Gases on Crop Production: The increasing levels of greenhouse gases (GHGs) in the atmosphere have been attributed as a major driving force for rapid climate change. The main GHGs contributing to this phenomenon are CO2, CH4 and N2O. Apart from fossil fuel burning, the frequent volcanic eruptions are also contributing to this increase. Climate change will affect crop yields and cropping pattern due to the direct effects of changes in atmospheric concentrations of greenhouse gases in general and CO2 in particular. The rate of CO2 release into the atmosphere has increased by 30 times in the last three-four decades. It is estimated that a 0.5 degree celsius rise in winter temperature would reduce wheat yield by 0.45 tonnes per hectare. A recent World Bank report studied two drought prone regions in Andhra Pradesh and Maharashtra and one flood prone region in Orissa on climate change impacts. It has found that climate change could have the following serious impacts:  In Andhra Pradesh, dryland farmers may see their incomes plunge by 20 percent.  In Maharashtra, sugarcane yields may fall dramatically by 25-30 percent.  In Orissa, flooding will rise dramatically leading to a drop in rice yields by as much as 12 percent in some districts (Aggarwal et al., 2002). 3.2 Food Access: Climate change amplifies the economic drivers of food insecurity. Variation in the length of the crop growing season and higher frequency of extreme events due to climate change and the consequent growth of output adversely affect the farmer’s net income. India is particularly vulnerable because its rural areas are home to small and marginal farmers who rely on rain-fed monocropping, which provides barely a few months of food security in a normal year. According to Ramachandran (2014), food stocks begin to run out three or four months after harvest, farm jobs are unavailable and by the next monsoon/sowing season, food shortages peak to hunger (Ramachandran, 2014). Climate change will also have an adverse impact on the livelihoods of fishers and forest-dependent people. Landless agricultural labourers wholly dependent on agricultural wages are at the highest risk of losing their access to food. In regions with high food insecurity and inequality, increased frequency of droughts and floods will affect children more, given their vulnerability. Vedeld et al., 2014) conducted a survey of nine villages in the drought-prone Jalna district of Maharashtra and found that local crop yields and annual incomes of farmers dropped by about 60 percent in the drought of 2012-13 (T. et al., 2014). Such a large fall in income is likely to have a huge impact on child nutrition because poor households typically spend the bulk of their earnings on food. In another study based on 14 flooded and 18 non-flooded villages of Jagatsinghpur district in Orissa, Rodriguez-Llanes et al (2011) found that exposure to floods is associated with longterm malnutrition (Rodriguez-Llanes et al., 2011). Yet the impact of climate change on food

92


access is not limited to rural areas. Urban food insecurity is also a critical issue because poor households from rural and coastal regions typically migrate to urban areas for livelihood options. Ramachandran observes that hunger often triggers off a wave of migration towards cities, relocating entire families to urban slums. These migrants mostly join the ranks of poorly paid workers in the urban informal sector, where there is no security of tenure and wages fall below the legal minimum. India’s urban food insecurity indicators present an alarming picture. For example, over 30 percent of children below five years are underweight in urban Bihar, Madhya Pradesh and Karnataka (See Table 2). The proportion of urban children who are stunted and wasted is high even in Karnataka and Maharashtra, which are relatively prosperous states. Table 2: Child Nutritional Status in Urban India (2014-15) Proportion of children under Proportion of Children under 5 who are stunted(%) 5 who are underweight(%) Andhra Pradesh 28.3 28.4 Assam 22.3 21.4 Bihar 39.8 37.5 Goa 18.3 25.3 Haryana 33.4 28.5 Karnataka 32.6 31.5 Maharashtra 29.3 30.7 Manipur 24.1 13.1 Meghalaya 36.5 22.9 Madhya Pradesh 37.5 36.5 Puducherry 24.7 23.3 Sikkim 22.9 12 Telangana 20.9 22.2 Tamil Nadu 25.5 21.5 Tripura 17.2 21.7 Uttarakhand 32.5 25.6 West Bengal 28.5 26.2 Source: Compiled from National Family Health Survey – 4 Database

Proportion of Children under 5 who are wasted (%) 15.5 13.2 21.3 27.7 21 24.8 24.9 6.4 13.7 22 26.1 13.2 14.6 19 13.4 18.6 16.7

Climate change will exacerbate India’s existing problems of urban food insecurity. The highest risks related to climate change are likely to be concentrated among the lowincome groups residing in informal settlements which are often located in areas exposed to floods and landslides and where housing is especially vulnerable to extreme weather events such as wind and water hazards. 3.3 Food Utilization: As outlined above, even without climate change further increases in food prices are expected. Recent modelling and analysis predicts additional price increases due to climate change for some of the most important agricultural crops–rice, wheat, maize, and soybeans. To the resulting increases in the number of people at risk of hunger, climate change is projected to add another 10 to 20 % by 2050. Calorie availability in 2050 is likely to have declined relative to 2000 levels throughout the developing world: 24 million additional malnourished children, 21 % more than today, are anticipated –almost half of them, 10 million, in sub-Saharan Africa. 3.4 Climate Change Impact on Livestock: The effects of climate change on food production are not limited to crops. It will affect food production and food security via its direct or indirect impact on other components of the agricultural production systems, especially livestock production which is closely linked with crop production. India owns 57 % of the world's buffalo population and 16 % of the cattle population. It ranks first in the world in respect of cattle and buffalo population, third in sheep and second in goat population. The sector utilizes crop residues and agricultural by-products for animal feeding that are unfit for human consumption. Livestock sector has registered a compounded growth rate of more than 4.0% during last decade, in spite of the fact that a majority of the animals are reared under sub-optimal conditions by marginal and small holders and milk productivity per animal is low. Increased heat stress associated with rising temperature may, however, cause distress to dairy animals and possibly impact milk production. A rise of 2 to 6°C in temperature is expected to negatively impact growth, puberty and maturation of crossbred cattle and buffaloes. The low producing indigenous cattle are found to have high level of tolerance to these adverse impacts than high yielding crossbred cattle. Therefore, high


93

producing crossbred cows and buffaloes will be affected more by climate change. Heat stress on animals will reduce rate of feed intake. The higher temperatures and changing rainfall patterns may cause increased spread of the existing vector-borne diseases and macro-parasites, alter disease pattern, give rise to new diseases and affect reproduction behaviour. All these factors will affect performance of the livestock. 4. Controlling Measures: By 2065 India’ population is likely to cross 1.7 billion mark demanding more and diversified foods. Aggarwal (2009) has reported that if farmers plant earlier than usual then climate-induced damages to wheat can be reduced by 60-75 per cent. Other important adaptations include water harvesting, its conservation and efficient use through micro-irrigation techniques such as sprinkler and drip irrigation. According to an estimate, micro-irrigation, watershed management and insurance cover can avert 70 per cent of the avoidable loss due to drought (ECA, 2009). 4.1 Adaptation Strategies: Adaptation’ involves actions that reduce the impact of the event or process without changing the likelihood that it will occur. The process may include relocating the communities living close to the sea level or switching to crops that can withstand higher temperature etc. Some of the adaptation strategies to negate/moderate the impacts of climate change on agriculture are summarized below: 1. Developing new plant genotypes for drought, heat and cold tolerance adapted to climatic variability and ranges. 2. For short season crops such as wheat, rice, barley, oats and many vegetable crops, extension of the growing season may allow more crops in a year. 3. Development of integrated farming system models for integrating crops, livestock, fisheries, horticulture, etc. to reduce risk and assure a higher income. 4.2 Mitigation Strategies: Mitigation refers to measures for reduction of emissions of GHGs that cause climate change like switching from fossil fuel based power generation to alternative sources of renewable energy like solar, wind, nuclear etc. 1. Reducing greenhouse gas emissions through carbon sequestration in different land use systems, with a major emphasis on raising horticultural plantations and multi-purpose tree species on degraded soils. 2. Improved management of livestock populations including poultry through better management of feeding and livestock housing. 3. Improving the efficiency of energy use in agriculture by using better designed efficient machinery and implements. 4. Integrating trees with crops and promotion of conservation agriculture practices. 4.3 India’s National Action Plan on Climate Change: On June 30, 2008, Prime Minister Manmohan Singh released India's first National Action Plan on climate Change (NAPCC) outlining existing and future policies and programs addressing climate mitigation and adaptation. The plan identifies eight core “National Missions” running through 2017 .The plan “identifies measures that promote our development objectives while also yielding co-benefits for addressing climate change effectively.” Under the ambit of NAPCC, 8 Missions have been initiated to implement the programmes related to mitigation and adaptation. The missions are: National Solar Mission, National Mission for Enhanced Energy Efficiency in Industry, National Mission on Sustainable Habitat, National Water Mission, National Mission for Sustaining the Himalayan Ecosystem, National Mission for a ‘Green India’, National Mission for Sustainable Agriculture, National Mission on Strategic Knowledge for Climate Change. 4.4 Socio Economic and Policy Issues: Apart from the use of technological advances to combat climate change, there has to be sound and supportive policy framework. The frame work should address the issues of redesigning social sector with focus on vulnerable areas/ populations, introduction of new credit instruments with deferred repayment liabilities during extreme weather events, weather insurance as a major vehicle to risk transfer. Governmental initiatives should be undertaken to identify and prioritize adaptation options in key sectors (storm warning systems, water storage and diversion, health planning and infrastructure needs). Focus on integrating national development policies into a sustainable development framework that complements adaptation should accompany technological adaptation methods. Policy initiatives in relation to access to banking, micro-credit/insurance services before, during and after a disaster event, access to communication and information services is imperative in

94


the envisaged climate change scenario. Some of the key policy initiatives that are to be considered are: Mainstreaming adaptations by considering impacts in all major development initiatives Facilitate greater adoption of scientific and economic pricing policies, especially for water, land, energy and other natural resources. Consider financial incentives and package for improved land management and explore CDM benefits for mitigation strategies. Establish a “Green Research Fund” for strengthening research on adaption, mitigation and impact assessment (Venkateswarlu et al., 2009). 5. Way Forward: Recommendations 1. India's disaster-management strategies are mostly inadequate, short-lived and poorly conceived. Also, much of the emphasis is laid on providing quick relief to the affected households as opposed to developing long-term adaptation strategies. 2. A four-pronged strategy is recommended for the water sector: (i) Increase irrigation efficiency. (ii) Promote micro irrigation in water-deficient areas. (iii) Better water resource infrastructure planning (iv) Restoration of water bodies in rural areas. 4. There is a need to intensify efforts to increase climate literacy among all stakeholders of agriculture and allied sectors: students, researchers, policy planners, science managers, industry and farmers. 5. It is equally important to improve delivery of credit and crop insurance products to farmers to strengthen their capacity to adopt adaptation and mitigation measures. 6. In addition, the role of local institutions in strengthening capacities e.g., SHGs, banks and agricultural credit societies should be promoted. 7. Agricultural policy should focus on improving crop productivity and developing safety nets to cope with the risks of climate change. 8. Achieving food security in the context of climate change calls for an improvement in the livelihoods of the poor and food-insecure to not only help them escape poverty and hunger but also withstand, recover from, and adapt to the climate risks they are exposed to. Conclusion: Climate change poses an unprecedented challenge to the aim of eradicating hunger and poverty. In order to meet the growing demand for food security and nutrition under increasingly difficult climatic conditions and in a situation of diminishing resources, the world must urgently move towards embracing a two-fold approach: First, we must invest in and support the development of more efficient, sustainable and resilient food production systems. Second, we must improve access to adequate food and nutrition by the most vulnerable and at risk populations and communities and enhance social protection systems and safety nets as part of the adaptation agenda.Our findings indicate with climate change producing more food with limited resources will be a big challenge in the absence of adaptation and mitigation strategies. It is therefore imperative to promote uptake of sustainable agricultural practices to overcome the potential threats to food security. It is estimated that India needs 320 MT of food grains by the year 2025. For a country like India, sustainable agricultural development is essential not only to meet the food demands, but also for poverty reduction through economic growth by creating employment opportunities in non-agricultural rural sectors. Thus Climate change is an important obstacle in the sustainable development of agriculture and food security of India. Along with the measures and policies being implemented by the government the education, knowledge and awareness among the people about the adverse impact of climate change the active and whole hearted participation of the people and society as whole is very much necessary. References Aggarwal, P.K., Mall, R.K. (2002). Climate change and rice yields in diverse agro-environments of India. II Effects of uncertainties in scenarios and crop models on impact assessment. Climate Change, 52: 331–343. Ahmad, J., Dastgir, A. and Haseen, S. (2011). ‘Impact of climate change on agriculture and food security in India’, International Journal of Agricultural Environmental and Biotechnology 4 (2):129-137. Change Parry et al. (2009). Climate Change and Hunger: Responding to the Challenge, Rome: World Food Programme, 2009, http://www.preventionweb.net/files/12007_wfp212536.pdf. Climate change and food security: risks and responses, Food and Agriculture Organisation, 2016. http://www.fao.org/3/a-i5188e.pdf.


95

David B. Lobell, Adam Sibley and J. Ivan Ortiz-Monasterio. (2012). Extreme heat effects on wheat senescence in India”, Nature Climate Change, 2:186, http://www.nature.com/nclimate/ journal/v2/n3/full/nclimate1356.html Easterling, W. E., et al. (2007). Food, fibre and forest products, in Climate Change 2007: Impacts, Adaptation and Vulnerability. Contribution of Working Group II to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change, eds. M. L. Parry et al. (UK: Cambridge University Press, 2007), 469-506, http://www.ipcc.ch/pdf/ assessmentreport /ar4/ wg2/ar4_wg2_full_report.pdf. ECA (Economics of Climate Adaptation). (2009). Shaping Climate-Resilient Development: A Framework for Decision-making. Government of India. (2013). Statistics Related to Climate Change–India, Statistics & Programme Implementation Government of India, New Delhi. www.mospi.gov.in. Johny Stanly. (2012). Climate Change and Economy: In search of fine balance. In Zee News. http://zeenews.india.com/EarthDay/story.aspx?aid=617794. Lal M. 2001. Future climate change: implications for Indian summer monsoon and its variability. Current Science 81(9):1205. R. V. Cruz et al. (2007) “Asia”, in Climate Change: Impacts, Adaptation and Vulnerability. Contribution of Working Group II to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change, eds. M.L. Parry et al.(UK: Cambridge University Press, 2007), 469506. Ramachandran Nira. (2014). Persisting Undernutrition in India: Causes, Consequences and Possible Solutions (New Delhi: Springer). Rodriguez-Llanes et al. (2011). Child malnutrition and recurrent flooding in rural eastern India: a community-based survey, BMJ Open, 1(2011),http://bmjopen.bmj.com/content/1/2/e000109.full. Rome Declaration on World Food Security. (1996). Rome, http://www.fao.org/docrep/ 003/w3613e/w3613e00.HTM. T. et al. (2014). Governing extreme climate events in Maharashtra, India, Final report on WP3.2: Extreme Risks, Vulnerabilities and Community-based Adaptation in India (EVA): A Pilot Study, TERI Press, New Delhi, 2014. http://www.teriin.org/projects/eva/files/Governing_climate_ extremes _in_Maharashtra.pdf . Tien Shiao, Andrew Maddocks, Chris Carson and Emma Loizeaux. (2015) “3 Maps Explain India’s Growing Water Risks”, India%E2%80%99s-growing-water-risks. Turn Down the Heat. (2013). Climate Extremes, regional impacts, and the case for resilience”, World Bank, 2013. http://www.worldbank.org/content/dam/Worldbank/document/Full_Report_Vol_2_Turn_Down_The_ Heat _%20Climate_Extremes_Regional_Impacts_Case_for_Resilience_Print%20 version_FINAL.pdf. UNDP (2006). Beyond scarcity: Power, poverty, and global water crisis. Human Development Report. UNDP. Venkateswarlu, B., A K. Shankar., and Gogoi, A. K. (2009). “Climate change adaptation and mitigation in Indian agriculture.” Proceedings of National Seminar on Climate Change Adaptation Strategies in Agriculture and Allied Sectors. Kerala Agricultural University, Thrissur, December 2008, pp.109-121.

CLIMATE CHANGE IMPACT ON GLOBAL FOOD SECURITY Deepika Baranwal Assistant Professor, Department of Home-Science, Arya Mahila P G College, BHU, Varanasi, Uttar Pradesh, India, Email: [email protected]

F

ood security exists when all people at all times have physical or economic access to sufficient safe and nutritious food to meet their dietary needs and food preferences for an active and healthy life. Food security depends more on socio-economic conditions than on agroclimatic ones, and on access to food rather than the production or physical availability of food. It stated that, to evaluate the potential impacts of climate change on food security, it is not enough to assess the impacts on domestic production in food-insecure countries. One also needs to (i) assess climate change impacts on foreign exchange earnings; (ii) determine the ability of food surplus countries to increase their commercial exports or food aid; and (iii) analyse how the incomes of the poor will be affected by climate change. Climate is a particularly important driver of food system performance at the farm end of the food chain, affecting the quantities and types of food produced and the adequacy of production-related income. Extreme weather events can damage or destroy transport and distribution infrastructure and affect other non-agricultural parts of the food system adversely. However, the impacts of climate change are likely to trigger adaptive responses that influence the environmental and socio-economic drivers of food system performance in positive as well as negative ways. This paper is concerned with the projected balance of these various impacts on food system performance. Food Security

Potential Impacts of Climate Change on Food Availability: Food availability is determined by the physical quantities of food that are produced, stored, processed, distributed and exchanged. FAO calculates national food balance sheets that include all these elements. Food availability is the net amount remaining after production, stocks and imports have been summed and exports deducted for each item included in the food balance sheet. Adequacy is assessed through comparison of availability with the estimated consumption requirement for each food item. This approach takes into account the importance of international trade and domestic production in assuring that a country’s food supply is sufficient. The same approach can also be used to determine the adequacy of a household’s food supply, with domestic markets playing the balancing role. Production of food and other agricultural commodities may keep pace with aggregate demand, but there are likely to be significant changes in local cropping patterns and farming practices. There has been a lot of research on the impacts that climate change might have on agricultural production, particularly cultivated crops. Some 50 percent of total crop production comes from forest and mountain ecosystems, including all tree crops, while crops cultivated on open, arable flat land account for only 13 percent of annual global crop production. Production from both rainfed and irrigated agriculture in dryland ecosystems accounts for approximately 25 percent, and rice produced in coastal ecosystems for about 12 percent (Millennium Ecosystem Assessment, 2005). The evaluation of climate change impacts on agricultural production, food supply and agriculture-based livelihoods must take into account the characteristics of the agro-ecosystem where particular climateinduced changes in biochemical processes are occurring, in order to determine the extent to which such changes will be positive, negative or neutral in their effects. The so-called “greenhouse

Climate Change Impact on Global Food Security

97

fertilization effect” will produce local beneficial effects where higher levels of atmospheric CO2 stimulate plant growth. This is expected to occur primarily in temperate zones, with yields expected to increase by 10 to 25 percent for crops with a lower rate of photosynthetic efficiency (C3 crops), and by 0 to 10 percent for those with a higher rate of photosynthetic efficiency (C4 crops), assuming that CO2 levels in the atmosphere reach 550 parts per million (IPCC, 2007c); these effects are not likely to influence projections of world food supply, however (Tubiello et al., 2007). Mature forests are also not expected to be affected, although the growth of young tree stands will be enhanced (Norby et al., 2005). The impacts of mean temperature increase will be experienced differently, depending on location (Leff, Ramankutty and Foley, 2004). For example, moderate warming (increases of 1 to 3 ºC in mean temperature) is expected to benefit crop and pasture yields in temperate regions, while in tropical and seasonally dry regions, it is likely to have negative impacts, particularly for cereal crops. Warming of more than 3 ºC is expected to have negative affects on production in all regions (IPCC, 2007a). The supply of meat and other livestock products will be influenced by crop production trends, as feed crops account for roughly 25 percent of the world’s cropland. For climate variables such as rainfall, soil moisture, temperature and radiation, crops have thresholds beyond which growth and yield are compromised (Porter and Semenov, 2005). For example, cereals and fruit tree yields can be damaged by a few days of temperatures above or below a certain threshold (Wheeler et al., 2000). In the European heat wave of 2003, when temperatures were 6 ºC above long-term means, crop yields dropped significantly, such as by 36 percent for maize in Italy, and by 25 percent for fruit and 30 percent for forage in France (IPCC, 2007b). Increased intensity and frequency of storms, altered hydrological cycles, and precipitation variance also have long-term implications on the viability of current world agroecosystems and future food availability. Wild foods are particularly important to households that struggle to produce food or secure an income. A change in the geographic distribution of wild foods resulting from changing rainfall and temperatures could therefore have an impact on the availability of food. Changes in climatic conditions have led to significant declines in the provision of wild foods by a variety of ecosystems, and further impacts can be expected as the world climate continues to change. For the 5 000 plant species examined in a sub-Saharan African study (Levin and Pershing, 2005), it is predicted that 81 to 97 percent of the suitable habitats will decrease in size or shift owing to climate change. By 2085, between 25 and 42 percent of the species’ habitats are expected to be lost altogether. The implications of these changes are expected to be particularly great among communities that use the plants as food or medicine. Constraints on water availability are a growing concern, which climate change will exacerbate. Conflicts over water resources will have implications for both food production and people’s access to food in conflict zones (Gleick, 1993). Prolonged and repeated droughts can cause loss of productive assets, which undermines the sustainability of livelihood systems based on rainfed agriculture. For example, drought and deforestation can increase fire danger, with consequent loss of the vegetative cover needed for grazing and fuelwood (Laurence and Williamson, 2001). Storage, Processing and Distribution: Food production varies spatially, so food needs to be distributed between regions. The major agricultural production regions are characterized by relatively stable climatic conditions, but many food-insecure regions have highly variable climates. The main grain production regions have a largely continental climate, with dry or at least cold weather conditions during harvest time, which allows the bulk handling of harvested grain without special infrastructure for protection or immediate treatment. Depending on the prevailing temperature regime, however, a change in climatic conditions through increased temperatures or unstable, moist weather conditions could result in grain being harvested with more than the 12 to 14 percent moisture required for stable storage. Because of the amounts of grain and general lack of drying facilities in these regions, this could create hazards for food safety, or even cause complete crop losses, resulting from contamination with microorganisms and their metabolic products. It could lead to a rise in food prices if stockists have to invest in new storage technologies to avoid the problem. Distribution depends on the reliability of import capacity, the presence of food stocks and – when necessary – access to food aid (Maxwell and Slater, 2003). These factors in turn often depend on the ability to store food. Storage is affected by strategies at the national level and by physical infrastructure at the local level. Transport infrastructure limits food distribution in many developing countries. Where infrastructure is affected by climate, through either heat stress on roads or increased frequency of flood events that

98


destroy infrastructure, there are impacts on food distribution, influencing people’s access to markets to sell or purchase food (Abdulai and CroleRees, 2001). Exchange of food takes place at all levels–individual, household, community, regional, national and global. At the lowest levels, exchanges usually take the form of reciprocal hospitality, gift-giving or barter, and serve as an important mechanism for coping with supply fluctuations. If changing climatic conditions bring about trend declines in local production, the capacity of affected households to engage in these traditional forms of exchange is likely to decline. Trade remains the main mechanism for exchange in today’s global economy. Although most food trade takes place within national borders, global trade is the balancing mechanism that keeps exchange flowing smoothly (Stevens, Devereux and Kennan, 2003). The relatively low cost of ocean compared with overland transport makes it economically advantageous for most countries to rely on international food trade to smooth out fluctuations in domestic food supply. Where trade is heavily regulated, as in southern Africa, farmers’ behaviour illustrates this principle. After a food crisis such as that in southern Africa in 2002, even if recovery programmes lead to a bumper harvest of maize, in some countries the maize may not find its way into national grain markets, as announced or anticipated producer prices and market regulations could encourage farmers to channel their surplus outside formal markets (Mano, Isaacson and Dardel, 2003: iv). FAO projects that the impact of climate change on global crop production will be slight up to 2030. After that year, however, widespread declines in the extent and potential productivity of cropland could occur, with some of the severest impacts likely to be felt in the currently food-insecure areas of sub-Saharan Africa, which have with the least ability to adapt to climate change or to compensate through greater food imports. Although the projections suggest that normal carryover stocks, food aid and international trade should be able to cope with the localized food shortages that are likely to result from crop losses due to severe droughts or floods, this is now being questioned in view of the price boom that the world has experienced since 2006. According to FAO, the global food price index rose by 9 percent in 2006 and by 37 percent in 2007. The price boom has been accompanied by much higher price volatility than in the past, especially in the cereals and oilseeds sectors, reflecting reduced inventories, strong relationships between agricultural commodity and other markets, and the prevalence of greater market uncertainty in general. This has triggered a widespread concern about food price inflation, which is fuelling debates about the future direction of agricultural commodity prices in importing and exporting countries, be they rich or poor, and giving rise to fears that a world food crisis similar in magnitude to those of the early 1970s and 1980s may be imminent, with little prospect for a quick rebound as the effects of climate change take their toll. Potential Impacts of Climate Change on Food Access: Food accessibility is a measure of the ability to secure entitlements, which are defined as the set of resources (including legal, political, economic and social) that an individual requires to obtain access to food (FAO, 2003). Until the 1970s, food security was linked mainly to national food production and global trade (Devereux and Maxwell, 2001), but since then the concept has expanded to include households’ and individuals’ access to food. Allocation: Food is allocated through markets and non-market distribution mechanisms. Factors that determine whether people will have access to sufficient food through markets are considered in the following section on affordability. These factors include income-generating capacity, amount of remuneration received for products and goods sold or labour and services rendered, and the ratio of the cost of a minimum daily food basket to the average daily income. Non-market mechanisms include production for own consumption, food preparation and allocation practices within the household, and public or charitable food distribution schemes. For rural people who produce a substantial part of their own food, climate change impacts on food production may reduce availability to the point that allocation choices have to be made within the household. A family might reduce the daily amount of food consumed equally among all household members, or allocate food preferentially to certain members, often the able-bodied male adults, who are assumed to need it the most to stay fit and continue working to maintain the family. Non-farming low-income rural and urban households whose incomes fall below the poverty line because of climate change impacts will face similar choices. Urbanization is increasing rapidly worldwide, and a growing proportion of the expanding urban population is poor. Allocation issues resulting from climate change are therefore likely to become more and more significant in urban areas over time. Where urban gardens are available, they


99

provide horticultural produce for home use and local sale, but urban land-use restrictions and the rising cost of water and land restrain their potential for expansion. Urban agriculture has a limited ability to contribute to the welfare of poor people in developing countries because the bulk of their staple food requirements still need to be transported from rural areas. Political and social power relationships are key factors influencing allocation decisions in times of scarcity. If agricultural production declines and households find alternative livelihood activities, social processes and reciprocal relations in which locally produced food is given to other family members in exchange for their support may change or disappear altogether. Public and charitable food distribution schemes reallocate food to the most needy, but are subject to public perceptions about who needs help, and social values about what kind of help it is incumbent on more wealthy segments of society to provide. If climate change creates other more urgent claims on public resources, support for food distribution schemes may decline, with consequent increases in the incidence of food insecurity, hunger and famine related deaths. Affordability: In many countries, the ratio of the cost of a minimum daily food basket to the average daily income is used as a measure of poverty (World Bank PovertyNet, 2008). When this ratio falls below a certain threshold, it signifies that food is affordable and people are not impoverished; when it exceeds the established threshold, food is not affordable and people are having difficulty obtaining enough to eat. This criterion is an indicator of chronic poverty, and can also be used to determine when people have fallen into temporary food insecurity, owing to reduced food supply and increased prices, to a sudden fall in household income or to both. Income-generating capacity and the remuneration received for products and goods sold or labour and services rendered are the primary determinants of average daily income. The incomes of all farming households depend on what they obtain from selling some or all of their crops and animals each year. Commercial farmers are usually protected by insurance, but small-scale farmers in developing countries are not, and their incomes can decline sharply if there is a market glut, or if their own crops fail and they have nothing to sell when prices are high. Most food is not produced by individual households but acquired through buying, trading and borrowing (Du Toit and Ziervogel, 2004). Climate impacts on income-earning opportunities can affect the ability to buy food, and a change in climate or climate extremes may affect the availability of certain food products, which may influence their price. High prices may make certain foods unaffordable and can have an impact on individuals’ nutrition and health. Changes in the demand for seasonal agricultural labour, caused by changes in production practices in response to climate change, can affect income-generating capacity positively or negatively. Mechanization may decrease the need for seasonal labour in many places, and labour demands are often reduced when crops fail, mostly owing to such factors as drought, flood, frost or pest outbreaks, which can be influenced by climate. On the other hand, some adaptation options increase the demand for seasonal agricultural labour. Local food prices in most parts of the world are strongly influenced by global market conditions, but there may be short-term fluctuations linked to variation in national yields, which are influenced by climate, among other factors. An increase in food prices has a real income effect, with low-income households often suffering most, as they tend to devote larger shares of their incomes to food than higher-income households do. When they cannot afford food, households adjust by eating less of their preferred foods or reducing total quantities consumed as food prices increase. Given the growing number of people who depend on the market for their food supply, food prices are critical to consumers’ food security and must be watched. Food often travels very long distances (Pretty et al., 2005), and this has implications for costs. Increasing fuel costs could lead to more expensive food and increased food insecurity. The growing market for biofuels is expected to have implications for food security, because crops grown as feedstock for liquid biofuels can replace food crops, which then have to be sourced elsewhere, at higher cost. Preference: Food preferences determine the kinds of food households will attempt to obtain. Changing climatic conditions may affect both the physical and the economic availability of certain preferred food items, which might make it impossible to meet some preferences. Changes in availability and relative prices for major food items may result in people either changing their food basket, or spending a greater percentage of their income on food when prices of preferred food items increase. In southern Africa, for example, many households eat maize as the staple crop, but when there is less rainfall, sorghum fares better, and people could consume more of it. Many people prefer

100


maize to sorghum, however, so continue to plant maize despite poor yields, and would rather buy maize than eat sorghum, when necessary. The extent to which food preferences change in response to changes in the relative prices of grain-fed beef compared with other sources of animal protein will be an important determinant of food security in the medium term. Increased prices for grain-fed beef are foreseeable, because of the increasing competition for land for intensive feedgrain production, the increasing scarcity of water and rising fuel costs (FAO, 2007c). If preferences shift to other sources of animal protein, the livestock sector’s demands on resources that are likely to be under stress as a consequence of climate change may be contained. If not, continued growth in demand for grain-fed beef, from wealthier segments of the world’s population, could trigger across-the-board increases in food prices, which would have serious adverse impacts on food security for urban and rural poor. Potential Impacts of Climate Change on Food Utilization: Food utilization refers to the use of food and how a person is able to secure essential nutrients from the food consumed. It encompasses the nutritional value of the diet, including its composition and methods of preparation; the social values of foods, which dictate what kinds of food should be served and eaten at different times of the year and on different occasions; and the quality and safety of the food supply, which can cause loss of nutrients in the food and the spread of food-borne diseases if not of a sufficient standard. Climatic conditions are likely to bring both negative and positive changes in dietary patterns and new challenges for food safety, which may affect nutritional status in various ways. Nutritional Value: Food insecurity is usually associated with malnutrition, because the diets of people who are unable to satisfy all of their food needs usually contain a high proportion of staple foods and lack the variety needed to satisfy nutritional requirements. Declines in the availability of wild foods, and limits on small-scale horticultural production due to scarcity of water or labour resulting from climate change could affect nutritional status adversely. In general, however, the main impact of climate change on nutrition is likely to be felt indirectly, through its effects on income and capacity to purchase a diversity of foods. The physiological utilization of foods consumed also affects nutritional status, and this–in turn–is affected by illness. Climate change will cause new patterns of pests and diseases to emerge, affecting plants, animals and humans, and posing new risks for food security, food safety and human health. Increased incidence of water-borne diseases in flood-prone areas, changes in vectors for climate-responsive pests and diseases, and emergence of new diseases could affect both the food chain and people’s physiological capacity to obtain necessary nutrients from the foods consumed. Vector changes are a virtual certainty for pests and diseases that flourish only at specific temperatures and under specific humidity and irrigation management regimes. These will expose crops, livestock, fish and humans to new risks to which they have not yet adapted. They will also place new pressures on care givers within the home, who are often women, and will challenge health care institutions to respond to new parameters. Malaria in particular is expected to change its distribution as a result of climate change (IPCC, 2007a). In coastal areas, more people may be exposed to vector- and water-borne diseases through flooding linked to sea-level rise. Health risks can also be linked to changes in diseases from either increased or decreased precipitation, lowering people’s capacity to utilize food effectively and often resulting in the need for improved nutritional intake. Where vector changes for pests and diseases can be predicted, varieties and breeds that are resistant to the likely new arrivals can be introduced as an adaptive measure. A recent upsurge in the appearance of new viruses may also be climate-related, although this link is not certain. Viruses such as avian flu, ebola, HIV/AIDS and SARS have various implications for food security, including risk to the livelihoods of small-scale poultry operations in the case of avian flu, and the extra nutritional requirements of affected people in the case of HIV-AIDS. The social and cultural values of foods consumed will also be affected by the availability and affordability of food. The social values of foods are important determinants of food preferences, with foods that are accorded high value being preferred, and those accorded low value being avoided. In many traditional cultures, feasts involving the preparation of specific foods mark important seasonal occasions, rites of passage and celebratory events. The increased cost or absolute unavailability of these foods could force cultures to abandon their traditional practices, with unforeseeable secondary impacts on the cohesiveness and sustainability of the cultures themselves. In many cultures, the reciprocal giving of gifts or sharing of food is common. It is often regarded as a social obligation to feed guests, even when they have dropped in unexpectedly. In conditions of chronic food scarcity,


101

households’ ability to honour these obligations is breaking down, and this trend is likely to be reinforced in locations where the impacts of climate change contribute to increasing incidence of food shortages. Food safety may be compromised in various ways. Increasing temperature may cause food quality to deteriorate, unless there is increased investment in cooling and refrigeration equipment or more reliance on rapid processing of perishable foods to extend their shelf-life. Decreased water availability has implications for food processing and preparation practices, particularly in the subtropics, where a switch to dry processing and cooking methods may be required. Changes in land use, driven by changes in precipitation or increased temperatures, will alter how people spend their time. In some areas, children might have to prepare food, while parents work in the field, increasing the risk that good hygiene practices may not be followed. Potential Impacts of Climate Change on Food System Stability: Food system stability is determined by the temporal availability of, and access to, food. In long-distance food chains, storage, processing, distribution and marketing processes contain in-built mechanisms that have protected the global food system from instability in recent times. However, if projected increases in weather variability materialize, they are likely to lead to increases in the frequency and magnitude of food emergencies for which neither the global food system nor affected local food systems are adequately prepared. Stability of Supply: Many crops have annual cycles, and yields fluctuate with climate variability, particularly rainfall and temperature. Maintaining the continuity of food supply when production is seasonal is therefore challenging. Droughts and floods are a particular threat to food stability and could bring about both chronic and transitory food insecurity. Both are expected to become more frequent, more intense and less predictable as a consequence of climate change. In rural areas that depend on rainfed agriculture for an important part of their local food supply, changes in the amount and timing of rainfall within the season and an increase in weather variability are likely to aggravate the precariousness of local food systems. Stability of Access: As already noted, the affordability of food is determined by the relationship between household income and the cost of a typical food basket. Global food markets may exhibit greater price volatility, jeopardizing the stability of returns to farmers and the access to purchased food of both farming and non-farming poor people. Food Emergencies: Increasing instability of supply, attributable to the consequences of climate change, will most likely lead to increases in the frequency and magnitude of food emergencies with which the global food system is ill-equipped to cope. An increase in human conflict, caused in part by migration and resource competition attributable to changing climatic conditions, would also be destabilizing for food systems at all levels. Climate change might exacerbate conflict in numerous ways, although links between climate change and conflict should be presented with care. Increasing incidence of drought may force people to migrate from one area to another, giving rise to conflict over access to resources in the receiving area. Resource scarcity can also trigger conflict and could be driven by global environmental change. Grain reserves are used in emergency-prone areas to compensate for crop losses and support food relief programmes for displaced people and refugees. Higher temperatures and humidity associated with climate change may require increased expenditure to preserve stored grain, which will limit countries’ ability to maintain reserves of sufficient size to respond adequately to large-scale natural or human incurred disasters. Conclusion: Climate change will affect all four dimensions of food security: food availability, food accessibility, food utilization and food systems stability. It will have an impact on human health, livelihood assets, food production and distribution channels, as well as changing purchasing power and market flows. Its impacts will be both short term, resulting from more frequent and more intense extreme weather events, and long term, caused by changing temperatures and precipitation patterns, People who are already vulnerable and food insecure are likely to be the first affected. Agriculturebased livelihood systems that are already vulnerable to food insecurity face immediate risk of increased crop failure, new patterns of pests and diseases, lack of appropriate seeds and planting material, and loss of livestock. People living on the coasts and flood plains and in mountains, drylands and the Arctic are most at risk. As an indirect effect, low-income people everywhere, but particularly in urban areas, will be at risk of food insecurity owing to loss of assets and lack of adequate insurance coverage. This may also lead to shifting vulnerabilities in both developing and developed countries.

102


Food systems will also be affected through possible internal and international migration, resourcebased conflicts and civil unrest triggered by climate change and its impacts. Agriculture, forestry and fisheries will not only be affected by climate change, but also contribute to it through emitting greenhouse gases. They also hold part of the remedy, however; they can contribute to climate change mitigation through reducing greenhouse gas emissions by changing agricultural practices. References Abdulai, A. & CroleRees, A. (2001). Constraints to income diversification strategies: Evidence from Southern Mali. Food Policy, 26(4): 437-452. Devereux, S. & Maxwell, S., eds. (2001). Food security in sub-Saharan Africa. Brighton, UK, Institute of Development Studies (IDS). Du Toit, A. & Ziervogel, G. (2004). Vulnerability and food insecurity: Background concepts for informing the development of a national FIVIMS for South Africa. Available at: www.agis.agric.za/agisweb/FIVIMS_ZA. FAO. (2003). Conceptual framework for national, agricultural, rural development, and food security strategies and policies, by K. Stamoulis and A. Zezza. Rome. FAO. (2007). Food Outlook November 2007: High prices and volatility in agricultural commodities. Gleick, P.H. 1993. Water in crisis: A guide to the world’s fresh water resources. New York, Oxford University Press. IPCC. (2007a). Climate Change 2007- Impacts, adaptation and vulnerability. Contribution of Working Group II to the Fourth Assessment Report of IPCC. Cambridge. UK. Cambridge University Press. IPCC. (2007b). Climate Change 2007- the physical science basis. Contribution of Working Group I to the Fourth Assessment Report of IPCC. Cambridge. UK. Cambridge University Press. Laurence, W.F. & Williamson, G.B. (2001). Positive feedbacks among forest fragmentation, drought and climate change in the Amazon. Conservation Biology, 28(6): 1529_1535. Leff, B., Ramankutty, N. & Foley, J. (2004). Geographic distribution of major crops across the world. Article No. GB1009 in Global Biogeochemical Cycles, 18(1). Levin, K. & Pershing, J. (2005). Climate science 2005: Major new discoveries. WRI Issue Brief. Washington, DC, WRI. Mano, R., Isaacson, B. & Dardel, P. (2003). Policy determinants of food security response and recovery in the SADC region: the case of the 2002 food emergency. Paper presented to the Regional Dialogue on Agricultural Recovery, Food Security and Trade Policies in Southern Africa, 26-27 March 2003, Gaberone, Botswana. Maxwell. S. & Slater, R. (2003). Food policy old and new. Development Policy Review, 21(5-6): 531-553. Millennium Ecosystem Assessment. (2005). Ecosystems and human well-being: Synthesis. Washington DC, Island Press for WRI. Norby, R.J., DeLucia, E.H., Gielen, B., Calfapietra, C., Giardina, C.P., King, J.S, Ledford, J., McCarthy, H.R., Moore, D.J.P., Ceulemans, R., De Angelis, P., Finzi, A.C., Karnosky, D.F., Kubiske, M.E., Lukac, M., Pregitzer, K.S., Scarascia-Mugnozza, G.E., Schlesinger, W.H. & Oren, R. (2005). Forest response to elevated CO2 is conserved across a broad range of productivity. Proceedings of the National Academy of Sciences, 102(50): 18052-18056. Porter, J.R. & Semenov, M.A. (2005). Crop responses to climatic variation. Philosophical Transacations of the Royal Society B: Biological Sciences, 360: 2021-2035. Pretty, J.N., Ball, A.S., Lang, T. & Morrison, J.I.L. (2005). Farm costs and food miles: An assessment of the full cost of the UK weekly food basket. Food Policy, 30(1): 1-19. Stevens, C., Devereux, S. & Kennan, J. (2003). International trade, livelihoods and food security in developing countries. IDS Working Paper No. 215. Brighton, UK, Institute of Development Studies. supply. European Journal of Agronomy, 26: 215-228. Tubiello, F.N., Amthor, J.A., Boote, K., Donatelli, M., Easterling, W.E., Fisher, G., Gifford, R., Howden, M., Reilly, J. & Rosenzweig, C. (2007). Crop response to elevated CO2 and world food Wheeler, T.R., Crauford, P.Q., Ellis, R.H., Porter, J.R. & Vara Prasad, P.V. (2000). Temperature variability and the yield of annual crops. Agriculture, Ecosystems and Environment, 82: 159-167. World Bank PovertyNet. (2008). Measuring poverty. Available at: http://go.worldbank.org/VCBLGGE250.

FOOD SECURITY UNDER CHANGING CLIMATE; PROBLEMS, PRIORITIES & PROSPECTS D.R. Chowdary Department of Genetics and Plant Breeding, School of Agriculture, Sam Higginbottom Institute of Agriculture, Technology & sciences (Deemed-to-be-University), Allahabad (U.P), India-211007, E-mail: [email protected]

T

he global population is projected to go up from 7.0 billion (now) to 9.5 billion by 2050(FAO 2015). FAO estimates that 70 percent increase in total agricultural production is needed to feed the growing population by 2050. Effects of climate change on food security is already taking place and creating new challenges to scientists and causing risk to farming community. 75% of poor and food insecure people rely on agriculture and natural resources for their living. The accelerating pace of climate change combined with global population growth threatens food security (Nelson et al., 2009). Populations in the developing countries are already vulnerable to food insecurity. Over the past 6 decades the food production is doubled while just increasing agricultural land by 10 percent around world. From last decade the impacts of climate change on agriculture production is more unpredictable. Uneven Rainfall, drought, temperature is causing potential damage to crops in some low-latitude areas. Tropical countries are more affected than the temperate countries. The temperature is projected to rise 1-3° C together with carbon dioxide by 2050 will change the rainfall pattern may show positive impact on mid and high latitude areas by growing season longer. However, it shows detrimental effects in low latitude agricultural systems. By 2050, 3% of Africa’s land will no longer be able to grow maize and will transiting to livestock farming systems. Agriculture also produces large effects on climate change by emitting greenhouse gases into atmosphere and as an industry it has highly sensitive to climate change. Thus a portfolio required to adapt the agriculture production in changing climate. The temperatures of the temperate and polar regions are increasing, decreasing the snowing period thereby increasing the day length and intensity of photoperiods one side. Other side includes melting glacious, sinking oceans, unpredictable weather conditions cause shifting cropping seasons, may cause resurgence of diseases and pests. People living in the coastal areas already being affected by ocean warming, rising levels, extreme weather events, salt water intrusions, ocean acidification and subsequent changes to resources they depend on food and livelihoods. Impacts of Climate Change: Climate change affects the basic elements of life around the world which includes access to water, food, healthcare. The overall costs and risks of climate change around world are equivalent to losing of 5% global GDP every year. The estimated damage may rise to 20% of GDP or more if a wide range of risks taken into account (Stern,2006,2007). The dryland areas of the world are increasing under the impact of climate change. In India more than 3 million ha become semi-arid over the last 4 decades. Drought: Drought is an important environmental factor limiting the productivity of crops around the world. Climate change models are predicting great variability in rainfall patterns and increased dry spells thus the demand is growing for crops exhibiting the drought tolerance and water use efficiency so, breeder should increase4 emphasis on selection of varieties which tolerate prolonged water deficit. Temperature Change: It is estimated that average 0.2° c to 0.3° c temperature per decade (IPCC 2007). This may appear low value, but it shows high value loss. Recent data shows that milder winters and warmer summers in many parts of the world. This change will affect agricultural crops in bidirectional way. Warmer winters may affect the production of crops need vernalization to achieve full productive potential and heat waves affect development of fruits & dehydration of cereals the predictions show in the absence of any interventions these two accounts 30% and 70% yield reductions (Burney et al. 2010). Atmospheric CO2 Levels: Elevated levels of atmospheric CO2have beneficial effects on plants because it contributes more efficient production of biomass (carbohydrates). Inherent nutrient use efficiencies may increase under high CO2levels (Drake et al. 1997). The indirect consequences that affect food production by increased CO2includes sea level rises, global warming (Braasch 2007). Pest and Disease Incidence: Climate change is alternating the distribution, incidence and intensity of pest and diseases. This will change the crop-pest relationship, with higher atmospheric CO2, plants

104


grow faster and accumulate more carbon and Nitrogen leads to increase the pest density and damage intensity. By including positive and negative impacts the losses to pest and diseases will rise up to 15% from today’s minimal level. Rising Sea Level: Sea level rise by thermal expansion of ocean water and water flowing in after melting of ice due to warmer climate. The crop production will be vulnerable where inundating sea water to coastal land and low lying coastal agriculture. The sea level rise will salinize the groundwater. It would be major threat to Bangladesh and Egypt where the large productivity depends on river deltas (Chakravarty and Mallick, 2003). Priorities & Prospects: On the World Food Day-2016, FAO stated that if we want to deal with climate change, need to look at seven different areas related to food and agriculture where change should happen. These includes 1. Forestry 2. Agriculture 3. Livestock management 4. Food waste 5. Natural resources 6. Fisheries 7. Food systems Agriculture: As the climate changes, the food production must too. Climate change is making harder to produce food because of the floods, droughts, warmer seasons etc., to adapt to these effects of climate change need to focus on the following areas.  Conservation and Utilization of Biodiversity: Genetic erosion is also reached the plant genetic resources in remote areas and centers of crop diversity. Landraces are more susceptible than the crop wild relatives. In general, loss of landraces due to climate change is higher than to the crop wild relatives. Conservation of diversity by ex situ conservation &in situ conservation is ongoing trend. On-farm conservation has come into the focus of researchers to utilize these traits for crop improvement.  Novel Breeding Techniques: The growing population made a challenges to Breeders in the scenario of climate change. To address these challenges, the use of Genetically Modified Organisms (GMOs) is an answer but many countries and their liberal growth to being complete forbidden. Though, new strategies are needed for crop improvement quickly. Direct genetic manipulation of genome by adding a desirable trait to variety for effective performance. Use of modern mutagenesis process by using Zinc Finger Nuclease (ZFN) to produce useful variations. Forests: Forests provides shelter and food to many people around the world. These are important in determining the accumulation of greenhouse gases in atmosphere. They absorb 2.6 billion tonnes of CO2every year, about 1/3rd of the CO2released from fossil fuels. However, when the forests are cut down their impact is big. Deforestation accounts for nearly 20% of all greenhouse gas emissions more than the world’s entire transport system. So, need to protect and care the forests to keep our planet healthy. Livestock Management: Livestock production has been an integral part of agriculture in India and many regions around globe. Livestock includes cows, goats, sheep, pigs, donkeys and camels which produce greenhouse gases. We need even more animals to feed growing population. More natural resources are also used to provide meat than vegetables or pulses especially water. A kilogram of beef is produced in the feed lot requires 7 kg of grain, a kilogram of pork needs 4 kg, and kilogram of poultry needs just over 2 kg (Brown 1997). Eating at least one meat-free meal every week is something you can do to help. Food Waste: Energy is generated used in pre-harvest and post-harvest stages of food supply chain resulting the emissions of greenhouse gases due to dependency on fossil fuels unfortunately one third of food is lost or wasted each year wasted food usually produce rots, rotting food release harmful gases like methane. So, you can avoid throwing food leftovers by planning your meals. Fisheries and Aquaculture: Over 500 million people around the world depend on fisheries or aquaculture for their livelihoods directly or indirectly. Fish also provides essential nutrients to 3 billion people around world comprising 400 million people in the poorest countries still and all, climate change is bringing a large challenge to these resources from overfishing and poor management the production systems are facing crises. Due to extreme weather events the frequency of

Food Security under Changing Climate; Problems, Priorities & Prospects

105

storms are increasing makes fisheries as well as other community members will be at great risk of losing their lives and assets (aquaculture infrastructure). The adaption strategies must be location specific and needs to take into account both short-term and long-term phenomena. Conclusions: Climate change is influencing plant production in both developing and developed countries of world. Productivity is likely to be maintained with an increased cost of management by the developed regions of world. But in developing countries the story is different due to poverty, over population some regions having political and economic instability. There should be realization that the climate is both a resource to be managed wisely and hazard to dealt with (Wittwer, 1995). Priority should be given to the tropical areas because these are mostly affected by the global warming. The conservation of ecosystems of crop plants should be prioritized. The plant breeders need to understand the nexus of environmental changes by utilizing plant growth simulation models. References Annual report. (2015). Retrieved fromhttp://annualreport2015.icrisat.org/# Big Facts on Climate Change, Agriculture and Food Security. Retrieved fromhttp://ccafs.cgiar.org/bigfacts/ Braasch, G. (2007) Earth under fire: how global warming is changing the world. University ofCalifornia Press, Berkeley, CA Bringing the blue world into the green economy (2016) Retrieved fromhttp://www.fao.org/news/story/en/ item/431191/icode/ Brown, L.R. (1997). The agricultural link: how environmental deteriorationcould disrupt economic progress. World Watch Paper No 136, World Watch Institute, Washington, DC Burney, J.A., Davis, S.J., Lobella, D.B. (2010). Greenhouse gas mitigation by agricultural intensification. Proc Natl Acad Sci, USA 107:12052–12057 Chakravarty, S. and Mallick, K. (2003). Agriculture ina greenhouse world, what really will be? In: EnvironmentalChallenges of the 21st Century, ed. Kumar, A. A. P. H. Publishing Corporation, New Delhi. pp. 633–652. Drake, B.G., Gonza`lez-Meler, M.A., Long, S.P. (1997). More efficient plants: a consequence of risingatmospheric CO2? Annu Rev Plant Physiol Plant Mol Biol., 48:609–639 Forests and Climate Change, Center for International Forestry Research, Retrieved fromhttp://www.cifor.org/ forests-and-climate-change/ Nelson, G. C., Rosegrant, M. W., Jawoo Koo, Robertson, R., Sulser, T., Zhu, T., Ringler, C. et al. (2009). Climate Change: Impact on Agriculture and Costsof Adaptation. Food Policy Report. International Food PolicyResearch Institute, Washington DC. 19p. Stern, N. (2006). Stern review on the economics of climate change.Her Majesty’s Treasury and the Cabinet Office, London. http://www.hmtreasury.gov.uk/independent_reviews/stern_review_economics_climate_ change/ sternreview_index.cfm Stern, N. (2007). The Economics of Climate Change: The SternReview. Cambridge University Press, Cambridge. Wittwer, S. H. (1995). Food, Climate and CO2: The Global Environment and World Food Production. Michigan State University, Michigan. World Food Day Activity Book. (2016). Retrieved fromhttp://www.fao.org/3/a-i5685e.pdf

CLIMATE CHANGE RESPONSE STRATEGIES FOR AGRICULTURE: CHALLENGES AND OPPORTUNITIES FOR THE 21ST CENTURY Govind Kumar Bagri1, Avinash Kumar Rai2, Rajesh Kumari3 and Dheeraj Kumar Bagri4 1,2

Department of Soil Science and Agricultural Chemistry, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi, UP-221005, India, Email: [email protected], 3Department of Plant Protection, Faculty of Agricultural Sciences, Aligarh Muslim University, Aligarh, UP-202002, India and 4Department of Animal Husbandry and Dairying, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi, UP-221005, India, Corresponding Author: Govind Kumar Bagri

C

limate change will affect agriculture and forestry systems through higher temperatures, elevated CO2 concentration, precipitation changes, increased weeds, pests, and disease pressure, and increased vulnerability of organic carbon pools. High temperatures can lead to negative impacts such as added heat stress, especially in areas at low to mid-latitudes already at risk today, but they also may lead to positive impacts such as an extension of the growing season in currently cold-limited high-latitude regions(Baker, J. T. 2004).Overall, current studies project that climate change will increase the gap between developed and developing countries through more severe climate impacts in already vulnerable developing regions, exacerbated by the relatively lower technical and economic capacity to respond to new threats. Elevated atmospheric CO2 concentrations increase plant growth and yield and may improve plant water use efficiency. However, a number of factors such as pests, soil and water quality, adequate water supply, and crop-weed competition may severely limit the realization of any potential benefits (Tubiello, F. N., et al. 2002). Changes in precipitation patterns, especially in the frequency of extreme events such as droughts and floods, are likely to severely affect agricultural production. These impacts will tend to affect poor developing countries disproportionately; especially those currently exposed to major climate risks (Schmidhuber, J., et al. 2007). However, increased frequency of extremes may also increase damage in well-established food production regions of the developed world. For instance, the European heat wave of 2003, with temperatures up to 6°C above long-term means and precipitation deficits up to 300 millimeters, resulted in crop yields falling 30 percent below long-term averages, as well as severe ecosystem, economic, and human losses. Weeds, pests and diseases under climate change have the potential to severely limit crop production. Whereas quantitative knowledge is lacking compared to other controllable climate and management variables, some anecdotal data show the proliferation of weed and pest species in response to recent warming trends. For example, the activity of mountain pine beetle and other insects in the United States and Canada is taking place notably earlier in the season and resulting in major damage to forest resources. Similarly, in 2006, Northern Europe experienced the first ever incidence of bluetongue, a disease generally affecting sheep, goat and deer, in the tropics. More frequent climate extremes may also promote plant and animal disease and pest outbreaks. In Africa, droughts between the years 1981–1999 have been shown to increase the mortality rates of national livestock herds by between 20 percent and 60 percent. Vulnerability of organic carbon pools to climate change has important repercussions for land sustainability and climate mitigation. In addition to plant species responses to elevated CO2, future changes in carbon stocks and net fluxes will critically depend on land use actions such as afforestation/reforestation, and management practices such as Nitrogen (N) fertilization, irrigation, and tillage, in addition to plant species responses to elevated CO2 (Peterson, A. G., et al. 2004). It is very likely that climate change will increase the number of people at risk of hunger compared with reference scenarios that exclude climate change; the exact impacts will however be strongly determined by future socioeconomic development. Six major points emerge from recent studies: 1. It is estimated that climate change may increase the number of undernourished people in 2080by up to 170 million. 2. The magnitude of these climate impacts is estimated to be relatively small compared with the impact of socioeconomic development, which is expected to substantially diminish the number of malnourished and hungry people significantly by 2100. Progress in reducing the number of

Climate Change Response Strategies for Agriculture: Challenges and Opportunities…….

107

hungry people will be unevenly distributed over the developing world and it is likely to be slow during the first decades of this century. With or without climate change, the millennium development goal of halving the prevalence of hunger by 2015 is unlikely to be realized before 2020–30. 3. In addition to socioeconomic pressures, food production may increasingly compete with bioenergy demands in coming decades. Studies addressing the possible consequences for world food supply have only recently started to surface and provide both positive and negative views of this competition for agricultural resources. 4. Sub-Saharan Africa is likely to surpass Asia as the most food insecure region. In most climate change scenarios, sub-Saharan Africa accounts for 40 to 50 percent of undernourished people globally by 2080, compared with about 24 percent today. 5. Although there is significant uncertainty regarding the effects of elevated CO2 on crop yields, this uncertainty reduces when following the supply chain through to food security issues (Kimball, B. A., et al. 2002). 6. It is important to now recognize that the recent surge in energy prices could have a more substantial and more immediate impact on economic development and food security than captured by any of the present Special Report on Emissions Scenarios (SRES). Benefits of adaptation vary with crop species, temperature and rainfall changes. Modeling studies that incorporate key staple crops indicate that adaptation benefits are highly species-specific (Long, S.P.,et al. 2004). For example, the potential benefits of adaptation for wheat are similar in temperate and tropical systems, increasing average yields by 18 percent when compared with the scenario without adaptation. The benefits for rice and maize are relatively smaller and increase yield by around 10 percent compared with the no-adaptation baseline. These improvements to yield translate to damage avoidance due to increased temperatures of 1 to 2°C in temperate regions and between 1.5 to 3°C in tropical regions, potentially delaying negative impacts by up to several decades. In terms of temperature and rainfall change, there is a general tendency for most of the benefits of adaptation to be gained under moderate warming (of less than 2°C), although these benefits level off at increasing changes in mean temperature. In addition, yield benefits from adaptation tend to be greater under scenarios of increased rather than decreased rainfall. Useful synergies for adaptation and mitigation in agriculture, relevant to food security exist and should be incorporated into development, disaster relief, climate policy, as well as institutional frameworks at both the national and international level. Synergistic adaptation strategies aim to enhance agro ecosystem and livelihood resilience, including social, economic and environmental sustainability, in the face of increased climatic pressures, while simultaneously avoiding maladaptation1 actions that inadvertently increase climate change vulnerability (Fuhrer, J. 2003). Such strategies include forest conservation and management practices, agroforestry production for food or energy, land restoration, recovery of biogas and waste and, soil and water conservation activities that improve the quality, availability and efficiency of resource use. Although many of these strategies are already often deeply rooted in local cultures and knowledge, this needs to be recognized, built on, and supported by key international agencies and non-governmental organizations. Clearly, potential mitigation practices such as bioenergy and extensive agriculture that result in competition for the land and water resources necessary for ecosystem and livelihood resilience need to be minimized. A general metrics framework is useful for planning and evaluating the relative costs and benefits of adaptation and mitigation responses in the agricultural sector. In this framework, biophysical factors, socioeconomic data, and agricultural system characteristics are evaluated relative to vulnerability criteria of agricultural systems, and are expressed in terms of their exposure, sensitivity, adaptive capacity, and synergy with climate policy. For example,  Metrics for biophysical factors may include indexes for soil and climate resources, crop calendars, water status, biomass, and yield dynamics.  Metrics for socioeconomic data include indexes describing rural welfare, reflected, for instance, in regional land and production values, total agricultural value added, financial resources, education and health levels, effective research, development and extension capacity, or the agricultural share of the Gross Domestic Product (GDP). Importantly, they may include nutrition indexes comparing

108


regional calorie needs versus food availability through local production and trade. They could also indicate degree of protectionism and the status of crop insurance programs (Cline, W. 2007).  Metrics for climate policies describe regional commitments to adaptation and mitigation policies, relevant to agriculture. For instance, such metrics measure land use and sequestration potential; number and type of CDM projects in place and committed land area; area planned for bio-energy production, and so on. These may be useful for identifying potential synergies of mitigation with adaptation strategies within regions, helping to define how vulnerability may change with time. References Baker, J.T. (2004). Yield Responses of Southern US Rice Cultivars to CO2 and Temperature. Agricultural and Forest Meteorology 122 (3–4): 129–137. Cline, W. (2007). Global Warming and Agriculture: Impact Estimates by Country. Washington, DC: Peterson Institute for International Economics. Fuhrer, J. (2003). Agroecosystem Responses to Combinations of Elevated CO2, Ozone, and Global Climate Change. Agriculture Ecosystems & Environment 97(1–3): 1–20. Kimball, B.A., Kobayashi,K. and M. Bindi. (2002). Responses of Agricultural Crops to Free-Air CO2 Enrichment. Advances in Agronomy 77: 293–368. Long, S.P., Ainsworth, E.A. and Leakey, A.D.B. (2004). Rising Atmospheric Carbon Dioxide: Plants Face the Future. Annual Review of Plant Biology 55: 591–628. Peterson, A.G. and Neofotis, P.G. (2004). A Hierarchical Analysis of the Interactive Effects of Elevated CO2 and Water Availability on the Nitrogen and Transpiration Productivities of Velvet Mesquite Seedlings. Oecologia 141(4): 629–640. Schmidhuber, J. and Tubiello, F.N. (2007). Global Food Security under Climate Change. Proceedings of the National Academy of Sciences of the United States of America 104(50): 19703–19708. Tubiello, F.N. and Ewert, F. (2002). Simulating the Effects of Elevated CO2 on Crops: Approaches and Applications for Climate Change. European Journal of Agronomy, 18(1–2): 57–74.

EFFECT OF CLIMATE CHANGE ON HORTICULTURAL CROPS Kulveer Singh Yadav, Akhilesh K. Pal, Sandeep K. Mauriya Ravi Kumar, Pankaj K. Singh and Rupesh K. Mandal Department of Horticulture, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi- 221 005, E-mail: [email protected], Corresponding Author: Kulveer Singh Yadav

C

limate is the statistics of weather, usually over a 30 year interval. It is measured by assessing the patterns of variation in temperature, humidity, atmospheric pressure, wind, precipitation, atmospheric particle count and other meteorological variables in a given region over long periods of time. A change in global or regional climate patterns, in particular a change apparent from the mid to late 20th century onwards and attributed largely to the increased levels of atmospheric carbon dioxide produced by the use of fossil fuels. In India, increase in mean annual maximum temperature was 0.76 0C and mean minimum temperature was 0.22 0C. Increase in annual mean temperature was 0.49 0C during the period, commencing from 1901 to 2003. In terms of increase in temperature, the West Coast of India is warmer, followed by the Northeast India and the Western Himalayas when compared to other regions of the country. The years 2009 and 2010 were recorded as the warmest in the country since 1901. Increase in temperature and rainfall was noticed in the country in tune with the global warming and climate change though spatial and seasonal differences were evident. At the same time, rainfall during the monsoon season was deficit in recent years like 1987, 2002 and 2009 which adversely affected the food grains production in India. In the case of thermo-sensitive crops like tea, coffee, cardamom, cocoa, cashew and black pepper, the projected increase of 2–3 0C in temperature may directly affect the cropped area and productivity. Therefore, proactive technologies need to be developed against the global warming and climate change for sustenance of crop production in horticulture as a part of “climate resilient horticulture”. The established commercial varieties of fruits, vegetables and flowers will perform poorly in an unpredictable manner due to aberration of climate. Commercial production of horticultural plants particularly grown under open field conditions will be severely affected. Due to high temperature physiological disorder of horticultural crops will be more pronounced eg. Spongy tissue of mango, fruit cracking of litchi, flower and fruit abscission in solanaceous fruit vegetables, etc. Air pollution also significantly decreased the yield of several horticultural crops and increases the intensity of certain physiological disorder like black tip of mango. Development of new cultivars of horticultural crops tolerant to high temperature, resistant to pests and diseases, short duration and producing good yield under stress conditions, as well as adoption of hi–tech horticulture and judicious management of natural resources will be the main strategies to meet this challenge. Climate change is predicted to cause an increase in average air temperature of between 1.4 0C and 5.8 0C, increases in atmospheric CO2 concentration, and significant changes in rainfall pattern (Houghton et al. 2001). The Impact of Climate Change on Horticultural Crops: The chilling requirement for the flowering of some of the ornamental plants like Rhododendron, Orchid, Tulipa, Alstromerea, Magnolia, Saussurea, Impatiens, Narcissus etc getting reduce due to melting of ice particle of in himalayan region. Low temperatures shut down flowering in Jasmine (35 0C. Due to increase in temperature fruit crops like citrus, grapes, melons etc. will mature earlier by about 15 days. Higher temperature and moisture stress helps in increase sunburn and cracking in apples, apricot and cherries and increase in temperature at maturity will lead to fruit cracking and burning in litchi (Kumar and Kumar, 2007). Some major fruit crops and their varieties which are tolerance against abiotic stress Crop Variety Annona Arka Sahan Fig Deanna and Excel Grape (rootstock) Dogridge Lime Rangpur lime and Cleopatra mandarin Mango Bappakai Pomegrante Ruby Source: Rai and Yadav (2005)

Tolerant Drought tolerant Drought tolerant Salinity tolerant Salinity tolerant Salinity tolerant Drought tolerant

110


Consecutive drought here reduced the coconut production about 300000 nuts/year for four years. Productivity loss was to the tune of about 3500 nuts/hectare/year in India. Due to increase in maximum and minimum day temperature and decreasing the annual rainfall the productivity showed decreasing trend in most of the black pepper growing areas of India. In black pepper, Accs 1380 (IC 316801), 1387 (IC 316803), 1410 (IC 316817), 1423 (IC 316825) and 1430 (IC 316832) were identified as relatively tolerant to drought. In cardamom, RR1 (IC 349591), CL-893 (IC 349537), Green Gold (IC 349550) were found relatively tolerant under Kerala, India condition. Kashmir’s prized saffron crops have suffered a 40% drop in production, Cumin, coriander, nigella, ajwain are the crops which are very sensitive to frost. Incidence of frost causing serious loss in yield almost reaches up to zero. Fennel and fenugreek are also affected by frost but growth stage plays an important role. So far no efforts have been made to identify the source of resistance against low temperature injury in available germplasm of seed spices crops. Climatic changes will influence the severity of environmental stress imposed on vegetable crops. High temperatures very conducive to losses in tomato productivity because it helps reduced fruit set, and smaller and lower quality fruits. Hazra et al. (2007) reported that symptoms causing fruit set failure at high temperatures in tomato s includes bud drop, abnormal flower development, poor pollen production, dehiscence, and viability, ovule abortion and poor viability, reduced carbohydrate availability, and other reproductive abnormalities. Most of the vegetable crops are highly sensitive to flooding and genetic variation with respect to this character is limited. Flooded crops especially in tomato plants accumulate endogenous ethylene that causes damage to the plants. Some major vegetable crops and their varieties and lines which are tolerance against abiotic stress Crop Variety Advanced Line Tolerant Capsicum IIHR Sel.-3, IIHR-19-1 High temperature Chilli Arka Lohit IIHR Sel.-132 Cow pea Arka garima, Arka Suman and Arka Samrudhi Dolichos Arka Jay, Arka Vijay,Arka Sambram, Arka Photo insensitive Amogh and Arka Soumya Onion Arka Kalyan MST-42 and MST-46 Tomato Arka Vikas RF- 4A Drought/rainfed Source: Hazra and Som (1999) and Rai and Yadav (2005)

Other Adverse Impacts  Floral abortions, flower and fruit drop taking place rapidly.  Higher temperature increases irrigation requirement in higher amount.  Suitability and adaptability of current cultivars would change.  Changes in the distribution of existing pests, diseases and weeds, and an increased threat of new incursions and also increased incidence of physiological disorders such as tip burn  Increase in pollination failures if heat stress days occur during flowering  Increased risk of spread and proliferation of soil borne diseases as a result of more intense rainfall events (coupled with warmer temperatures) Measure to overcome these Consequences of Climate Change on Horticultural Crops: Under the basic research some of the researchable issues under basic sciences include i.e. quantification of impacts of elevated temperature and CO2 on growth, development and yield of horticultural crops. Biotechnological approaches for multiple stress tolerance with monitoring the penology of perennial crops under changing climates etc. Under the applied research focus should be given on the development of suitable agronomic adaptation measures for reducing the adverse-climate related production losses. Development of crop simulation models for horticultural crops for enabling regional impact, adaptation and vulnerability analysis along with identification and refinement of indigenous technological knowledge to meet the challenges of weather related aberrations. Quantification of carbon sequestration potential of perennial horticultural systems. To develop eco-friendly, water use efficient irrigation system and fertilizer application systems. Development of pre and post harvest produce storage systems which can meet the challenges of climate related risks and recycling/usage of horticultural biomass should be emphasized. Under the capacity building there is need to train the researchers, horticultural extension personnel and farmers on climate change issues. Infrastructural development also needs to be taken up to make the Indian Horticulture resilient to climate change. More storage structure and training on

Effect of Climate Change on Horticultural Crops

111

making of value added products can augment the farm income to make farmer more resilient to adverse situations References Hazra, P. and Som, M.G. (1999). Technology for Vegetable Production and Improvement. Naya Prokash, Kolkata, India. Hazra, P., Samsul, H.A., Sikder, D. and Peter, K.V. (2007). Breeding of tomato (Lycopersicon esculentum Mill) against resistant to high temperature stress. International Journal of Plant Breeding, 1(1): 31-40. Houghton, J., Ding, Y., Griggs, D., Noguer, M. and Van der Linden P. (2001). Climate Change 2001: The Scientific Basis. Cambridge University Press, Cambridge, UK. Kumar, R. and Kumar, K.K. (2007) Managing physiological disorders in litchi. Indian Horticulture, 52(1): 2224. Rai, N. and Yadav, D.S. (2005) Advances in Vegetable production. Researchco Book Centre, New Delhi, India. Ravi, J., Sudha Vani, V. and Hannamani, M. (2015) Impact of Climate Change in Indian Horticulture-A Review. International Journal of Multidisciplinary Advanced Research Trends, 1(2): 131-141.

CLIMATE CHANGE AND FOOD SECURITY: RISKS AND RESPONSES 1

Pukhraj Meena1, Arvind2, A.D. Tripathi2, and Manoj Kumar Meena3

Ph.D Scholar, Centre of Food Science and Technology, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi, Email: [email protected], 2Assistant Professor, Centre of Food Science and Technology, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi and 3Ph.D Scholar, Department of Agronomy, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi, Corresponding Author: Pukhraj Meena

F

ood security exists when all people, at all times, have physical and economic access to sufficient, safe and nutritious food that meets their dietary needs and food preferences for an active and healthy life (World Food Summit, 1996). Climate change impacts food security in its four dimensions: availability, access, utilization and stability, directly and indirectly. As noted by the Intergovernmental Panel on Climate Change (IPCC), there is much less quantitative understanding of how non-production components of food security will be affected. They were mainly about availability, 70 percent, access, utilization and stability being represented by 11.9 percent, 13.9 percent and 4.2 percent. Six precepts for decision-makers developing policy responses to climate change impacts on food security listed below:1. Climate change impacts on food security will be worst in countries already suffering high levels of hunger and will worsen over time. 2. The consequences for global under-nutrition and malnutrition of doing nothing in response to climate change are potentially large, and will increase over time. 3. Food inequalities will increase, from local to global levels, because the degree of climate change and the extent of its effects on people will differ from one part of the world to another, from one community to the next and between rural and urban areas. 4. People and communities who are vulnerable to the effects of extreme weather now will become more vulnerable in the future and less resilient to climate shocks. 5. There is a commitment to climate change of 20-30 years into the future as a result of past emissions of greenhouse gases that necessitates immediate adaptation actions to address global food insecurity over the next two to three decades. 6. Extreme weather events are likely to become more frequent in the future and will increase risks and uncertainties within the global food system. Cascading Impacts from Climate Change on Food Security in the Fisheries Sector: Changes in distribution, species composition, productivity, risks and habitats will require changes in fishing practices and aquaculture operations, as well as in the location of fish landing, farming and processing facilities. Extreme events will impact on infrastructure, ranging from landing and farming sites to post-harvest facilities and transport routes. They will also affect safety at sea and settlements, with communities living in low-lying areas at particular risk. Water stress and competition for water resources will affect aquaculture operations and inland fisheries production, and are likely to increase conflicts among water-dependent activities. Livelihood strategies will have to be modified, for instance with changes in fishers’ migration patterns due to changes in timing of fishing activities. Reduced livelihood options, especially in the coastal regions, inside and outside the fishery sector, will force occupational changes and may increase social pressures. Livelihood diversification is an established means of risk transfer and reduction in the face of shocks, but reduced options for diversification will negatively affect livelihood outcomes. There are particular gender dimensions, including competition for resource access, risk from extreme events and occupational change in areas such as markets, distribution and processing, in which women currently play a significant role. Economic and Social Consequences: Impacts on production directly translate in economic impacts at various scales, on the farm and in the food chain, and with social consequences. The effects of climate change are translated into social and economic consequences through a range of different pathways that can result in changes in agricultural incomes, food markets, prices and trade patterns, and investment patterns. At farm level, they can reduce incomes. They can impact physical capital. They can force farmers to sell productive capital, for instance cattle, to absorb income shocks. Climatic risks can also hinder agricultural development by discouraging investments. Climatic shocks that impact a significant volume of worldwide production or an area of importance in terms of world markets have global consequences on markets: (i) quantity and price effects, with increased tension on

113

Climate Change and Food Security: Risks and Responses

markets; and (ii) impacts on bilateral contracts and/or import/export behavior, with disruption of trade patterns. Ultimately, the impact of climate change on agricultural incomes depends on the effects on production as well as on markets and prices. As documented in above sections, the expected impacts of climate change on agricultural production are generally negative for areas with the highest concentration of poor and food-insecure smallholders and for countries with a high dependence on agriculture in the national economy. Rural poverty and hunger are concentrated in two regions: South Asia, with the greatest number of poor rural people, and Africa south of the Sahara (SSA), with the highest incidence of rural poverty and where population growth rates are still high. Agriculture in these areas is considered highly vulnerable to climate change impacts due to the limited coping capacity of the population as much as to the exposure to increased climate risks estimated that with no adaptation actions taken, GDP in sub-Saharan Africa would decline by 0.2 percent by 2050 under a moderate climate change scenario (scenario B2 of the special report on emission scenarios of the IPCC), however this could be reversed and a positive growth in GDP attained if adaptation measures that generate a 25 percent increase in crop productivity were implemented. Impacts of Extreme Events, Climate-related Disasters: Agriculture is one of the sectors most affected by natural hazards and disasters. The majority of the people most vulnerable to natural hazards are the world's 2.5 billion small-scale farmers, herders, fishers and forest-dependent communities, who derive their livelihood from renewable natural resources. With climate change, the risks to food and nutrition security are multiplied by the expected increase in the frequency and intensity of climate-related extremes and disasters. The magnitude of impacts of extreme events on agriculture is high. FAO's recent analysis of 78 post-disaster needs’ assessments in 48 developing countries spanning the 2003–2013 period shows that 25 percent of all economic losses and damages inflicted by medium- and large-scale climate induced hazards such as droughts, floods and storms in developing countries are affecting the agriculture sector. To arrive at a closer estimate of the true financial cost of disasters to developing world agriculture, FAO compared decreases in yields during and after disasters with yield trends in 67 countries affected by medium to larger-scale events that hit 250 000 people or more, between 2003 and 2013. The final tally: USD80 billion in losses to crops and livestock, alone, over that ten-year period. Conclusions: Climate change is already impacting, and will increasingly impact, food security and nutrition. Through effects on agro-ecosystems it impacts agricultural production, the people and countries depending on it and ultimately consumers through increased price volatility. The impacts of climate change on food security and nutrition are the results of climate changes themselves and of the underlying vulnerabilities of food systems. They can be described as “cascading impacts” from climate to biophysical, to economic and social, to households and food security. At each stage vulnerabilities exacerbate effects. This leads to drawing some important conclusions The first and the worst impacted are the most vulnerable populations (poor), with livelihoods vulnerable to climate change (depending on agriculture sectors), in areas vulnerable to climate change.  Reducing vulnerabilities is key to reduce final impacts on food security and nutrition and also to reduce long-term effects.  The first and main impacts on food security and nutrition will be felt through reduced access and stability for the most vulnerable. From an agronomic perspective, favourable conditions for crops and other species will move geographically. Optimizing these conditions will thus require changing crops and other cultivated species, moving them. Even to benefit from potential positive effects, such as longer growing seasons in some cold regions, would, most of the time, require significant changes in agricultural systems and practices to effectively translate into production growth. Also, these changes of climatic conditions will go with changes of other biotic parameters (like pests and diseases), which can counteract the benefits of climatic changes. References FAO. (1984). Fourth World Food Survey. Rome: United Nations Food and Agriculture Organization. FAO. (1987). Fifth World Food Survey. Rome: United Nations Food and Agriculture Organization.

114


FAO. (1988). 1987 Production Yearbook. Rome: United Nations Food and Agriculture Organization. Statistics Series No. 82. FAO. (1991). AGROSTAT/PC. Rome: United Nations Food and Agriculture Organization. International Bank for Reconstruction and Development/World Bank. (1990). World Population Projections. Baltimore: Johns Hopkins University Press. International Benchmark Sites Network for Agrotechnology Transfer (IBSNAT). (1989). Decision Support System for Agrotechnology Transfer Version 2.1 (DSSAT V2. l). Honolulu: Dept. of Agronomy and Soil Science. College of Tropical Agriculture and Human Resources: University of Hawaii. IPCC. (1990a). Houghton, J. T., Jenkins, G. J. and Ephraums, J. J. eds. Climate Change: The IPCC Scientific Assessment. International Panel on Climate Change. Cambridge: Cambridge University Press. IPCC. (1990b). Tegart, W. J. McG., Sheldon, G. W. and Griffiths, D. C. eds. Climate Change: The IPCC Impacts Assessment. Canberra: Australian Government Publishing Service. IPCC. (1992). Houghton, J. T., Callander, B. A., and Varney, S. K. eds. Climate Change 1992. The Supplementary Report to the IPCC Scientific Assessment. Cambridge: Cambridge University Press. United Nations. (1989). World Population Prospects 1988. New York: United Nations. World Food Institute. (1988). World Food Trade and U.S. Agriculture, 1960-1987. Ames: Iowa State University.

ENSURING FOOD SECURITY THROUGH EVALUATION OF DECONTAMINATION METHODOLOGIES FOR REMOVAL OF PESTICIDE RESIDUES IN TOMATO (Solanum lycopersicum)

1

Sudhakar S. Kelageri1, Cherukuri Sreenivasa Rao1, V. Shashi Bhushan1 and P. Narayana Reddy2

AINP on Pesticide Residues, PJTSAU, Hyderabad, Telangana, India and 2 Department of Pl. Pathology, College of Agriculture, Rajendranagar, PJTSAU, Hyderabad, Telangana, India, Corresponding Author: Sudhakar S. Kelageri

P

esticides are used globally for the protection of food, fibre, human health and comfort. Food is the basic necessity of life and food contaminated with toxic pesticides is associated with severe effects on the human health (Chauhan et al. 2012), in this context it is pertinent to explore strategies that address food safety issues especially in the developing countries like India where pesticidal contamination is widespread due to indiscriminate usage. With changing food habits tomato being consumed as salad hence food safety issues are gaining importance. The risk of pesticide residues in foods need to be addressed as per FSSAI (Food Safety and Standards Authority of India) and hence for the protection of consumer health and interests, household risk mitigation methods for removal of pesticide residues in tomato are to be recommended based on the scientific evaluation, as the food habits are changing enormously. Presence of these persistent chemicals as residue elicits multiple health complexities ranging from mild allergies to deadly diseases. To minimize dietary exposure to pesticides, it is pertinent to explore strategies that effectively help in reducing the residue content at individual level. Methodology Field Experiment: Tomato crop was sown in kharif 2013, at student’s farm, College of Agriculture, Rajendranagar, Hyderabad. Experiment was laid out in a Randomized Block Design (RBD) with six treatments including untreated control replicated four times. Test insecticides were selected based on farmer’s usage and recommendations by package of practices. Insecticides used were Dimethoate 30% EC @300 g a.i. ha-1, λ-cyhalothrin 5 % EC @15 g a.i. ha-1, Phosalone 35% EC @ 450 g a.i. ha-1, Flubendiamide 20% WG @ 48 g a.i. ha-1, Profenophos 50% EC @500 g a.i. ha-1. The first spray was given after fruit initiation and second spray was given at 10 days after first spray. A total of two sprays were given during the experiment. Pesticide Residue Analysis Method Validation Preparation of Working Standards: Certified Reference Materials (CRMs) of Dimethoate, λcyhalothrin, Phosalone, Flubendiamide and Profenophos were purchased from Dr. Erhenstorfer, Germany during 2013. Primary standards, intermediary and working standards were prepared from the CRMs using acetone and hexane as solvents. Working standards of all the pesticides were prepared in the range of 0.01 ppm to 0.5 ppm in 10 ml calibrated graduated volumetric flask using distilled n-hexane as solvent. All the standards were stored in deep freezer maintained at -200C. Limit of Detection and Linearity: The working standards of dimethoate, λ-cyhalothrin, phosalone and profenophos were injected in Gas Chromatograph with Electron Capture Detector (ECD) and Thermionic Specific Detector (TSD) and flubendiamide were injected in Liquid Chromatograph with Photo Diode Array (PDA) Detector for estimating the lowest quantity of flubendiamide which can be detected under standard operating parameters. Based on the response of the detector (ECD) to different quantities (ng) of CRM standards injected, it was found that the LOD (limit of detection) for profenophos, dimethoate, λ-cyhalothrin, phosalone is is 0.01 ng, and the linearity is in the range of 0.01 ng to 0.10 ng. Based on the response of the detector (PDA) it was found that the LOD (limit of detection) for flubendiamide is 0.05 ng, and the linearity is in the range of 0.05 ng to 0.10 ng. Method Validation: Prior to pesticide application and field sample analysis, the residue analysis method was validated following the SANCO document (12495/2011). The tomato fruits (5 kg) collected from untreated control plots were brought to the laboratory and the stalks were removed prior to samples preparation. The sample was homogenized using Robot Coupe Blixer (High volume homogenizer) and homogenized sample of each 15 g was taken in to 50 ml centrifuge tubes. The required quantity of Dimethoate, λ-cyhalothrin, Phosalone, Flubendiamide and Profenophos intermediary standard prepared from CRM is added to each 15 g sample to get fortification levels of

116


0.05 ppm, 0.25 ppm and 0.5 ppm in three replications each. These foritifcation levels are selected to know the suitability of the method to detect and quantify pesticides in tomato below Maximum Residue Limits (MRLs) of Codex Alimentarius Commission (CAC). The AOAC official method 2007.01 (Pesticide Residues of Foods by Acetonitrile Extraction and Partitioning with Magnesium Sulfate) was slightly modified to suit to the facilties available at the laboratory and the same was validated for estimation of LOQ (Limit of Quantitation) of above mentioned pesticides in Tomato matrix. Limit of Quantification (LOQ) / Limit of Determination: The fortified samples (0.05, 0.25 and 0.5 mg kg-1) were analyzed and the recovery factors were calculated. Recovery percentage of all pesticides ranged between 88.27 to 117.79. Results show that the method is suitable for the analysis of residues of all pesticides up to 0.05 mg kg-1 (Limit of Quantification), except phosalone where in LOQ was 0.25 mg kg-1. Decontamination Methods Employed: The zero day samples which are free from pests and cracks from various treatments were collected separately in large quantities and made into 6 sets, each in 4 replications. One set of sample from each treatment (in 4 replications) is analyzed for deposits of the pesticide. The remaining sets of samples of zero day from each treatment samples were subjected to various decontamination methods separately and the residues were calculated to know the efficiency of the various decontamination methods in removal of pesticide residues from the tomato samples. Decontamination methods employed includes Tap water wash, 2% salt solution, 0.1% baking soda, 4% acetic acid solution and veggy wash. In all treatments 2 Kg of tomato fruits were dipped in respective solution for 10 min, followed by the tap water wash for 30 sec, further the fruits were kept for air drying on tissue paper for 5 min, followed by analysis. Results and Discussion Efficiency of different test decontamination methods was evaluated through quantification of their residues after subjecting to risk mitigation methods, and the results are presented in Table 1. In the present study, veggy wash, a formulation prepared by AINP on Pesticide Residues proved to be the most efficient in removing various pesticides. The next promising treatment was dipping in 4% acetic acid solution for 10 min followed by tap water wash for 30 sec, these findings are in agreement with the results of Dikshit et al. (1984) who reported that washing of cowpea with 1% acetic acid solution was capable of removing 85.70 and 88.60 % of metasystox and carbaryl residues. Similar results were reported by Radwan et al. (2004) who reported that washing of hot pepper, sweet pepper and brinjal with 2% acetic acid removed pirimophos-methyl residues by 76.61, 95.74 and 94.58 %. 2% salt solution was found to be third best treatment except in case of profenophos where 0.1% baking soda solution was found as third best treatment. The results are in agreement with the findings of Reddy and Rao (2004) who reported 72.80, 67.50, 51.80 and 58.20% removal of acephate, chlorpyriphos, quinalphos and bifenthrin residues from grapes by dipping them in 2% salt solution for 10 min, followed by water wash. Table-1. Effectiveness of various decontamination methods Insecticides

Mean per cent removal of insecticides (%) ± SD Decontamination methods Tap water 2% salt 0.1% Baking solution soda solution Dimethoate 23.29 ± 1.44 58.69 ± 0.46 52.30 ± 0.68 (1.01) (0.54) (0.63) Lambda 29.43 ± 2.81 48.02 ± 2.14 39.59 ± 2.50 cyhalothrin (0.09) (0.07) (0.08) Phosalone 39.06 ± 0.72 47.60 ± 1.57 44.40 ± 0.72 (1.54) (1.32) (1.40) Flubendiamide 17.71 ± 1.85 39.75 ± 0.95 45.30 ± 0.81 (0.74) (0.54) (0.49) Profenophos 37.60 ± 0.95 55.31 ± 0.23 47.60 ± 0.75 (0.94) (0.68) (0.79) Figures in the parenthesis are concentration of insecticide residues mg kg-1

CD (5%) 4% Acetic acid solution 65.49 ± 0.36 (0.45) 59.31 ± 0.05 (0.05) 52.34 ± 1.04 (1.20) 61.63 ± 0.55 (0.34) 71.22 ± 0.42 (0.43)

Veggy wash 76.77 ± 0.04 (0.31) 68.87 ± 2.19 (0.04) 55.13 ± 0.74 (1.13) 65.39 ± 1.15 (0.31) 75.84 ± 1.37 (0.37)

1.55 3.89 2.10 1.55 1.57

Dipping in 0.1% baking soda (NaHCo3) solution for 10 min followed by tap water wash was the 4th best treatment in removing residues from tomatoes. The results are in line with the findings of Liang et al. (2012) who reported that washing of cucumber with 2% NaHCO3 was efficient enough to remove the trichlorfon, dimethoate, dichlorovos, fenitrothian and chlorpyrifos residues by 73.20,

Ensuring Food Security through Evaluation of Decontamination Methodologies………

117

58.70, 96.40, 51.10 and 77.80%. Tap water wash was the least effective treatment and the findings of present investigations are in agreement with the findings of Abou-Arab (1999) who reported that washing of tomato fruits with water removed dimethoate and profenophos residues up to 18.80 and 22.17 % respectively. Jayakrishnan et al. (2005) reported that washing of tomato fruits with water removed lambda cyhalothrin residues by 29-30%. Conclusions: Based on the test reports, it can be concluded that pesticides such as dimethoate, lambda-cyahlothrin, phosalone, flubendiamide and profenophos can be removed from tomato for food safety with simple house processing methods, and out of all methods, washing with AINP formulation i.e. veggy wash proved to be the best, and also economical. So, this result can be propagated and popularized among home makers for removal of pesticides from tomato when used as fresh vegetable salad, and also create confidence that they eat safe food without pesticide residues. References Abou-Arab, A. A. K. (1999). Behaviour of pesticides in tomatoes during commercial and home preparation. Food chemistry. 65: 509-514. Chauhan, R., Monga, S and Kumari, B. (2012). Dissipation and decontamination of bifenthrin residues in tomato. Bulletin of Environmental Contamination and Toxicology. 89: 181-186. Dikshit, A. K., Awasthi, M. D and Handa, S. K. (1984). Decontamination of insecticide residues from cowpea. Pesticide. 42-43. Jayakrishnan, S., Dikshit, A. K., Singh, J. P and Pachauri, D. C. (2005). Dissipation of lambda-cyhalothrin on tomato (Lycopersicon esculentum Mill.) and removal of its residues by different washing processes and steaming. Bulletin of Environmental Contamination and Toxicology. 75: 324–328. Liang, Y., Wang, W., Shen, Y., Liu, Y and Lui, X. J. (2012). Effects of home preparation on organophosphorus pesticide residues in raw cucumber. Food Chemistry. 133: 636-640. Radwan, M. A., Shiboob, M. M., Elamayem, A and Aal, A. A. (2004). Pirimiphos-methyl residues in some field grown vegetables and removal using various washing solutions and kitchen processing. International Journal of Agriculture and biology. 6(6): 1026-1029. Reddy, D. J and Rao, B. N. (2004). Decontamination of insecticide residues from grape berries. Indian Journal of Plant Protection. 32(2): 52-55.

AN ASSESSMENT ON THE EFFECT OF CLIMATE CHANGE ON PROTEASE PRODUCING BACTERIA Tuhina Verma1 and Swati Agarwal2

1

Assistant Professor, Department of Microbiology (Centre of Excellence), Dr. Ram Manohar Lohia Avadh University, Faizabad, Uttar Pradesh, India, 2Research Scholar, Department of Microbiology (Centre of Excellence), Dr. Ram Manohar Lohia Avadh University, Faizabad, Uttar Pradesh, India, E-mail: [email protected], Corresponding Author: Tuhina Verma

P

roteases are the most important among industrial enzymes and constitute about more than 60% of the global enzyme market. These enzymes are found in a wide diversity of plants, animals and microorganisms but they are mainly produced by bacteria and fungi. Proteases from bacterial sources are preferred over the enzymes from plant or animal sources (Kumar et al., 2012) because bacterial proteases have higher rate of enzyme production due to their rapid growth, broad biochemical diversity, cheaper production cost, stability to chemical and physical changes in the medium and the ease with which the enzymes can be genetically manipulated to generate new enzymes for various applications (Sharma et al., 2014). There is renewed interest in the study of protease enzymes, mainly due to the recognition that these enzymes not only play an important role in the cellular metabolic processes but have also gained considerable attention in the industrial community (Gupta et al., 2005). They are widely used in leather processing, detergent industry, food industries, bioremediation process, pharmaceutical, textile industry, waste processing companies, and in the film industry, etc. (Rao et al., 1998). Several bacterial species, belonging to a variety of genera such as Bacillus, Pseudomonas, Aeromonas, Staphylococcus, etc. are reported to produce alkaline protease having diverse industrial applications (Saha et al., 2011; Habib et al., 2012; Ahmad and Ansari, 2013; Verma and Agarwal, 2016). Various environmental factors associated with the change in climate, affects the diversity and efficiency of indigenous protease producing bacteria. The most important among these are the environmental pH, temperature, salinity, presence of various heavy metals, etc. (Al-Shehri, 2004). Karuna and Ayyanna (1993) have reported that the metabolic activities of the microorganisms are sensitive to the pH changes and the pH of the culture media has marked effect on the amount of protease produced. Changes in pH may also cause denaturation of enzyme resulting in the loss of catalytic activity. Moreover, higher temperature is found to have some adverse effects on metabolic activities of microorganisms producing proteolytic enzymes (Tunga, 1995). However, some microorganisms produce heat stable proteases, which are active at higher temperatures. The thermal stability of the enzymes may be due to the presence of some metal ions or adaptability to carry out their biological activity at higher temperature (Gaure et al., 1989; Al-Shehri, 2004). Protease production at low temperature has also been reported by Damare et al. (2004). Most of the proteases reported were not sufficiently stable in the presence of high salt concentration (Gitishree et al., 2010; Rayda et al., 2012;). Interestingly, haloalkaline bacterial proteases are important for the hydrolysis of proteins under the environment of dual extremities of high salt and alkaline pH and enable the bacteria to absorb and utilize hydrolytic products under harsh condition (Verma and Agarwal, 2016). Although the production of protease enzymes has been improved significantly by using bacteria, fungi and genetically modified microbes but still it is not sufficient to meet most of the industrial demands. Further, many industrial processes are carried out in stressed environments, where most of the normal bacterial proteases becomes unstable (Nisha and Diwakaran, 2014). Also, there is very limited information on the protease producing bacteria from the natural environment, where the activity and protease production efficiency is not significantly affected under variable climatic conditions. Thus, it would be of great importance to have bacterial protease that has optimal activities at wide ranges of pH, temperature and salt concentration. Keeping it in view, the present study aims to isolate the protease producing bacteria from various climates and to evaluate its protease production efficiency in view of commercial application. 1. Materials and Methods 1.1 Sample Collection: Soil sample from three different sites of Faizabad and Kanpur, India were collected during various climatic conditions. The saline soil was collected from the salt lake of Kanpur. The acidic soil was collected from rainfall region and the alkaline soil was collected from the

An Assessment on the Effect of Climate Change on Protease Producing Bacteria

119

soil of dairy industry of Faizabad region aseptically in sterile containers, transported on ice to the laboratory and was processed for the isolation of protease producing bacteria within 6-8 h of collection. 1.2 Bacterial Isolation and Screening for Protease Activity: One gram of soil of all the three samples were separately suspended in 9.0 ml sterile distilled water and thereafter the protease producing bacteria were isolated from the soil suspension by the serial dilution method (APHA, 1998). Further, for the isolation of bacteria 0.1 ml suspension of appropriate dilution of all three samples were spread over skim milk agar plates containing 1.0% (w/v) skimmed milk, 0.5% (w/v) peptone, 1.0% (w/v) NaCl and 1.5% (w/v) agar by the standard pour plate technique (APHA, 1998). The pH of the medium was adjusted to 7.0, 5.0 and 9.0 for soil sample from salt lake, rain fall region and dairy industry, respectively. Plates were then incubated at 35oC for 24-48 h. Colonies forming transparent zones around the bacterial colony due to hydrolysis of milk casein, after 24-36 h of incubation were taken as evidence for qualitative determination of protease producing bacteria from different samples and their bacterial population was assessed. The total numbers of bacteria grown on skim milk agar plates were determined as colony forming units per ml (CFU/ml). Further isolation of bacterial colonies was done by streaking on several nutrient agar plates. Morphologically distinct bacterial colonies showing the clear zone diameter greater than 20.0 mm were selected and re-streaked several times on the same medium to obtain pure isolates. All the selected cultures were maintained on nutrient agar slants at 4°C and sub-cultured after every five weeks. 1.3 Preparation of Crude Extracellular Alkaline Protease Extract: A total of forty one morphologically distinct bacterial isolates producing alkaline protease was isolated from soil of dairy industry followed by thirty six bacteria producing acidic protease from rainfall region soil and thirty seven bacteria producing haloalkaline protease from salt lake of Kanpur were selected and their protease production efficiency was evaluated. The crude extracellular alkaline protease of selected bacteria were prepared by inoculating each strain individually into 50 ml of sterilized skim milk broth of respective pH in 150 ml Erlenmeyer conical flask and incubated at 35+1°C up to 24-30 h in an orbital shaker (120 rpm). After incubation, each sample was centrifuged at 10,000 rpm and 4°C for 5 min and the cell-free supernatant were collected and used as a crude enzyme extract for extracellular protease assay. 1.4 Protease Enzyme Assay: The protease activity was assayed by the casein digestion method of Anson (1938). Supernatant (culture filtrate) was used as the source of crude enzyme. The reaction mixture consisted of 0.25 ml of 50 mM sodium phosphate buffer (pH 7.0) containing 2.0% (w/v) of casein and 0.15 ml of enzyme solution. The reaction mixture was incubated at 25ºC for 15 min thereafter stopped by adding 1.2 ml of 10.0% (w/v) TCA then incubated at 37ºC for an additional 15 min, and the precipitate was removed by centrifugation at 8,000 rpm for 5 min. Further 1.4 ml of 1.0 M NaOH was added to 1.2 ml of the supernatant, and its absorbance was measured at 600 nm. The activity was determined by detecting the release of amino acids (tyrosine) from casein and the amount of tyrosine released was calculated from the standard curve constructed with tyrosine (Anson, 1938). One unit of protease activity is defined as the amount of enzyme required to liberate 1.0 μg of tyrosine per min per ml under the standard assay conditions. 1.5 Effect of Climate Change on Protease Production: The influence of various environmental factors associated with the change in climate such as temperature, pH and presence of other heavy metals on protease production in selected bacterial isolates was studied. The influence of temperature on protease production was assessed by growing bacterial culture in the skim milk broth of varying temperature viz., 20, 25, 30, 35, 40, 45, 50, 55 and 65°C and the protease activity was assayed as described above. Similarly, the effect of growth pH on protease production was determined by incubating the culture broth at different pH ranging from 4.0 to 12.0 following the standard method. The effect of various metal ions viz. Cu+2, Mn2+, Pb2+, Zn2+, Cr+6, Mg+2, Cd+2 and Ni+2 (200 -1 mgl ) on protease activity was investigated. The crude enzyme extract was incubated with different metal solutions at 35°C for 1 h to study metal ion stability and the protease activity was assayed following the standard methods.

120


2. Results and Discussion 2.1 Isolation and Screening of Protease Producing Bacteria: A total of forty one bacterial isolates producing alkaline protease was isolated from soil of dairy industry followed by thirty six bacteria producing acidic protease from rainfall region soil and thirty seven bacteria producing haloalkaline protease from salt lake of Kanpur on selective skimmed milk agar plates. These bacteria were selected on the basis of colony morphology and protease production efficiency. They exhibited clearance proteolytic zone greater than 20.0 mm and were considered as protease producing isolate. Bacteriological examination of the three soil samples revealed the presence of protease producing bacteria in the range of 5.0×105–6.0×106, 2.0×104–5.0×105 and 7.0×103–9.0×104 CFU ml−1, from the soil of dairy, rainfall region and salt lake, respectively. Our study clearly indicates that these soils support the growth of protease producing bacteria. Information on types, numbers and characteristics of bacteria is important in understanding the diversity of proteolytic bacteria for various commercial applications Further, out of these isolates fifteen bacteria from dairy soil sample having clear vibrant zone diameter between 25-36 mm, twelve bacteria from rain fall soil sample with zone diameter between 25-33 mm and sixteen bacteria from salt lake soil sample having zone diameter between 24-35 mm were re-selected for further study. Several researchers have also isolated the protease producing bacteria from garden soil (Kuberan et al., 2010; Gaur et al., 2014) but the enzyme becomes unstable when the industrial processes were carried out at dual extremities of high temperature and pH. 2.2 Assay of Protease Activity in Selected Bacteria: Based on the casein digestion method the protease production efficiency of the selected bacterial strains were determined. Fifteen bacteria from dairy soil produced protease enzyme between 290-360U/ml. Twelve strains from rainfall region produced maximum protease ranging between 305-380 U/ml whereas, sixteen strains from salt lake exhibited maximum protease activity between 245-390U/ml. Among these isolates, based on their protease production efficiency, six strains from dairy soil, five from rainfall region soil and five from salt lake soil seems to be promising were selected for further study. Results indicated that the protease activity was maximum during the stationary phase and thereafter the enzyme activity started to decline. This correlation was attributable to an increased need for turnover of cell proteins at the slower growth rate (Muthuprakash and Abraham, 2011; Gaur et al., 2015; Verma and Agarwal, 2016). Further, incubation resulted into a lesser growth as well as lesser alkaline protease production. These findings are in agreement with the study of other researchers who reported maximum protease activity during the post exponential phase or onset of stationary phase of their growth (Jadhav et al., 2013; Lakshmi and Prasad, 2015). 2.3 Effect of Climate Change on Protease Production: The effect of environmental factors (temperature, pH and presence of other heavy metals) associated with climate change on bacterial protease production was studied. Figure 1 depicts that the selected six bacterial strains isolated from dairy soil yielded maximum protease production between 435-480 U/ml in the incubation temperature range of 35-45°C. The influence of pH on protease production was studied by varying the pH from 4.0 to 12. Figure 2 depicts that the maximum protease production the above six strains was found ranging between 468-540 U/ml between 8.0-10.0 pH. Further, increase in temperature and pH resulted in the decrease of protease and biomass production. Temperature was found to significantly regulate the synthesis and secretion of bacterial extracellular protease by changing the physical properties of the cell membrane (Niadu and Devi, 2005). Therefore, temperature is a critical parameter that should be considered in order to obtain maximum protease production (Lazim, 2009). Initial pH of the production medium is the most important factor that significantly influences the production of proteases (Da Silva et al., 2007). The pH of the medium plays a vital role by inducing physiological changes in microbes and their enzyme secretion. It also strongly affects enzymatic processes and transport of compounds across the cell membrane (Verma and Agarwal, 2016). Proteases that having optimum pH between 8 and 12 are have potential applications in the fields of detergent application, dehairing of hides, and silver recovery from waste X-ray and photographic films (Gupta et al., 2001; Maurer, 2004). The metal ions are considered to be important cofactors for an enzyme to function. Effect of various metal ions viz. Cu+2, Mn+2, Pb+2, Zn+2, Cr+6 and Mg2+ on protease activity revealed that the protease production was highly stimulated (480-670 U/mL) by metals tested in the bacteria isolated from dairy soil sample except Cd+2 and Ni+2 (Table 1). Sindey and Lester (2014) have also observed similar findings in their study.


121

Table 1: Effect of heavy metals on protease production efficiency (U/ml) of bacteria isolated from dairy soil S.No. Bacterial Effect of heavy metals on protease production (U/ml) strains Cu+2 Mn+2 Pb+2 Zn+2 Mg+2 Ni+2 Cd+2 TDS-6 480 570 600 490 550 500 540 1 TDS-14 590 650 620 670 550 570 520 2 TDS-19 580 510 540 550 490 450 460 3 TDS-25 640 630 600 497 510 550 500 4 TDS-32 600 670 700 640 680 550 520 5 TDS-39 495 570 555 500 537 475 475 6 Figure 1. Effect of temperature on the protease activity of bacteria isolated from dairy soil TDS-6

Protease Activity (U/ml)

600

TDS-14

TDS-19

TDS-25

TDS-32

TDS-39

500 400 300 200 100 0 20

25

30

35

40

45

50

55

60

0

Temperature ( C)

Figure2. Effect of pH on the protease activity of bacteria isolated from dairy soil TDS-6

Protease activity (U/ml)

600

TDS-14

TDS-19

TDS-25

TDS-32

TDS-39

500 400 300 200 100 0 4

5

6

7

8

9

10

11

12

pH

It is evident from Figure 3 that the five selected bacteria isolated from rainfall region soil showed maximum protease production ranging between 420-440 U/ml within a temperature range of 35-50°C and yielded maximum protease production between 430-500 U/ml in the pH range 5.0-7.0 (Figure 4). Many reports showed bacterial and fungal alkaline protease production at lower and moderate temperatures of 20-30°C (Malathi and Chakraborty,1991; Kumar and Takagi, 1999; Niadu and Devi, 2005; Soarese et al., 2005; Lazim, 2009;). In the similar study Puri et al (2002) reported that the optimum temperature for proteolytic activity of protease producing bacteria was 370C-500C. The metal ions are considered to be important cofactors for an enzyme to function. Effect of various metal ions viz. Cu+2, Mn+2, Pb+2, Zn+2, Cr+6, Mg2+, Cd+2 and Ni+2 on protease activity revealed that the protease production was highly stimulated between 438-660 U/ml by bacteria isolated from rain fall region soil (Table 2). Nadeem et al., (2007) reported that the supplementation of magnesium, calcium and manganese salts to the culture medium exhibited better production of bacterial protease. Gaur et al., (2014) observed that CaCl2 enhanced the protease production in Bacillus species followed by MgCl2. The metal ions protect the enzyme from thermal denaturation and maintain its active confirmation at high temperature. Table 2: Effect of heavy metals on protease production efficiency (U/ml) of bacteria isolated from rainfall region soil S.No. Bacterial Effect of heavy metals on protease production (U/ml) strains Cu+2 Mn+2 Pb+2 Zn+2 Mg+2 Ni+2 Cd+2 TAS-3 470 494 520 550 520 480 490 1 TAS-11 450 455 500 660 440 470 550 2 TAS-17 410 455 430 450 480 410 470 3 TAS-25 530 550 470 497 510 500 450 4 TAS-35 438 478 500 510 440 456 440 5

122


Figure 3. Effect of temperature on the protease activity of bacteria isolated from rainfall region soil TAS-3


600

TAS-11

TAS-17

TAS-27

TAS-35

500 400 300 200 100 0 20

25

30

35

40

45

50

55

60

Temperature (0C)

Figure 4. Effect of pH on the protease activity of bacteria isolated from rainfall region soil TAS-3

TAS-11

TAS-17

TAS-27

TAS-35


600 500 400 300 200 100 0 4

5

6

7

8

9

10

11

12

pH

Figure 5 reveals that the five selected bacteria isolated from salt lake soil showed maximum protease production ranging between 480-575 U/ml within the temperature range 30-55°C. and yielded maximum protease production between 550-610 U/ml in the pH range 6.0-10.0. Mukesh et al. (2012) reported that protease production from Bacillus sp. was highest at pH 9.0. The effect of various metal ions on protease activity was also evaluated. The ions Cu+2, Mn+2, Pb+2, Zn+2, Cr+6, Mg2+, and Cd+2 stimulated the protease activity of TSL-5, TSL-13 and TSL-23 (550-675 U/ml), whereas, Ni2+ inhibited the activity of TSL-5, TSL-13 and TSL-23. The protease production was stimulated in TSL29 and TSL-33 by Cu+2, Mn+2, Pb+2, Ni+2, Cr+6, Mg2+, and Cd+2 (580-690 U/ml) but the protease production was inhibited in the presence of Zn+2. The present observation is in agreement with earlier study reported by Krishnaveni et al. (2012) where the magnesium sulphate and manganese sulphate enriched medium enhanced the protease production in Bacillus subtilis. Figure 5. Effect of temperature on the protease activity of bacteria isolated from salt TSL-5

TSL-13

TSL-23

TSL-29

TSL-33

700


600 500 400 300 200 100 0 20

25

30

35

40

45

Temperature (°C)

50

55

60

3. Conclusion: Our studt results that promising protease producing bacterial isolates where isolated from soil of diverse climate. There isolates were able to produce higher protease in broad temperature and pH range and in presence of other metals within 24-36h. The potential of these strains to produce higher protease under various environmental conditions makes them a promising candidate for different industrial and environmental application.


123

References Ahmad, J. and Ansari, T.A. (2013). Alkaline protease production using proteinacous Tannery solid waste. J Pet Environ Biotechnology, 342-348. Al-Shehri, M.A. (2004). Production and some properties of protease produced by Bacillus licheniformis isolated from Tihamet Aseer, Saudi Arabia. Pakistan J. Biol. Sci., 7: 1631–5 Baltimore. Anson, M.L. (1938). The estimation of pepsin, trypsin, papain, and cathepsin with hemoglobin. J Gen Physiol, 22(1):79-89. APHA. (1998). Standard Methods for the Examination of Water and Wastewater. American Public Health Association. 20th Edn., APHA Press, Washington,DC. Da Silva, C.R., Delatorre, A.B. and Martins, M.L. (2007). Effect of the culture conditions on the production of an extracellular protease by ther-mophilic Bacillus sp and some properties of the enzymatic characterization. Brazi. Jour of Microbiol., 38: 253-258 Damare, S., Raghukumar, C. and Muraleedharan, U. (2004). Deep-sea Fungi as a Source of Alkaline, Coldtolerant Proteases. National Institute of Oceanography, Dona Paula, Goa India Gaur, R., Tiwari, S. and Sharma, A. (2014). Isolation and characterization of thermotolerant alkaline serine protease of Bacillus sp. P-02. American Journal of Food Technology, 9(5): 246-256 Gaur, R., Tiwari, S. and Singh, S. (2015). Production and Characterization of Thermotolerant-Organic Solvent Resistant Acidic Protease by Pseudomonas aeruginosa RGSS-09 Isolated from Dairy Sludge. Asian Journal of Biochemistry, 10 (2): 52-66. Gaure, R., Yadav, J. and Pandey, L. (1989). Thermostbility of extracellular protease enzyme by Spicaria fusispora. Hindustan Antibiot. Bull., 31: 36–7. Gitishree, D., Prasad, M.P. (2010). Isolation, purification & mass production of protease enzyme from bacillus subtilis. Int. Res. J. Microbiol., 1(2):026-031. Gupta, A., Roy, I., Patel, R.K., Singh, S.P., Khare, S.K. and Gupta, M.N. (2005). One-step purification and characterization of an alkaline protease from halo alkaliphilic Bacillus sp. J Chromatography A. 1075 1038. Habib, N., Ashraf, M., Ali, Q. and Perveen, R. (2012). Response of salt stressed okra (Abelmoschuses culentus Moench) plants to foliar-applied glycine betaine and glycine betaine containing sugarbeet extract. South Afr J. Bot.(83): 151-158. Jadhav, A.G., Jaybhaye, A.A. and Musaddiq, M. (2013). Salt tolerant protease produced by an aerobic species belonging to the Bacillus genus isolated from saline soil. International Journal of Scientific and Research Publications, (3), 2250-3153. Karuna, J. and Ayyanna, C. (1993). Production of semi-alkaline protease enzyme from Aspergillus spp. Proceeedings of the Ninth National Convention of Chemical Engineers and International Symposium on Importance of Biotechnology in Coming Decades. Pp: 8–11. Viskhapatnam India Krishnaveni, K., Mukesh Kumar, D.J., Balakumaran, M.D., Ramesh, S., Kalaichelvan, P.T. (2012). Production optimization of protease extracellular alkaline protease from Bacillus Subtilis isolated from dairy effluent. Dr.Pharmacia Lett., 1:98-109 Kuberan, T., Sangaralingam, S. and Thirumalai, V.A. (2010). Isolation and optimization of protease producing Bacteria from Halophilic soil. J. Biol. sci. Res. 1(3):163-174. Kumar, C.G. and Takagi, H. (1999). Microbial alkaline proteases: From a bioindustrial viewpoint. (Research Review) Biotechnology Advance, 17, 561–594. Lakshmi, G. and Prasad, N.N. (2015). Purification and Characterization of Alkaline Protease from a Mutant Bacillus licheniformis Bl8. Advances in Biological Research, 9 (1): 15-23, Litchfield CD (2002). Halophiles. J Ind Microbiol Biotechnol, 28: 21–2. Lazim, H., Mankai, H., Slama, N., Barkallah, I. and Limam, F. (2009). Production and optimization of thermophilic alkaline protease in solid-state fermentation by Streptomyces sp. CN902.J Indian Microbiology Biotechnology 36: 531-537. Malathi, S. and Chakraborty, R. (1991). Production of alkaline protease by a new Aspergillus flavus isolate under solidsubstrate fermentation conditions for use a depilation agent. Applied Environmental Microbiology 57:712–16. Maurer, K. (2004). Current Opin. Biotechnology 15: 330–334. http://dx.doi.org/10.1016/j.copbio.2004.06.005 Mukesh Kumar, D.J., Premavathi, V., Govindarajan, N., Balakumaran, M.D., Kalaichelvan, P.T. (2012). Production and Purification of Alkaline Protease from Bacillus sp. MPTK 712 Isolated from Dairy Sludge. Global Veterinaria, 8 (5):433-439 Muthuprakash, K.M.S. and Abraham, J.A. (2011). Comparative analysis of protease producing microbes isolated from tannery effluent. International Journal of Science and Nature, (2): 110-113. Nadeem, M., Qazi, J.L., Baig, S., and Syed, Q. (2007). Studies On Commercially Important Alkaline Protease From Bacillus licheniformis N-2 Isolated from Decaying Organic Soil. Turkish Journal of Biochemistry, 32: 171-177.

124


Naidu, K.S.B. and Devi, K.L. (2005). Optimization of thermostable alkaline protease production from species of Bacillus using rice bran. Africa J. Biotechnology, 4: 724-726. Nisha, N.S. and Divakaran, J. (2014). Optimization Parameters for Alkaline protease Production using Bacterial isolates from different coastal regions of Tamil Nadu, India. Int.J.Curr.Microbiol.App.Sci, 3(8): 500-505 Puri, S., Beg, Q.K. and Gupta, R. (2002). Optimization of alkaline protease production from Bacillus p. using response surface methodology. Current Microbiology, 44:286-290 Rao, M.B., Tanksale, A.M., Ghatge, M.S. and Deshpande, V.V. (1998). Molecular and biotechnological aspects of microbial proteases. Microbiol. Mol. Biol. Rev., 62: 597–635. Saha, R.N., Wissink, E.M., Bailey, E.R., Zhao, M., Fargo, D.C., Hwang, J.Y., Daigle, K.R., Fenn, J.D., Adelman, K., Dudek, S.M. (2011). Rapid activity-induced transcription of Arc and other IEGs relies on poised RNA polymerase II. Nat Neurosci., (14):848 856. Sharma, K.M., Kumar, R., Vats, S., Gupta, A. (2014). Production, partial purification and characterization of alkaline protease from Bacillus aryabhattai K3. Sidney, F. and Lester, P. (2014). Methods in Enzymology. Academic Press Inc., New York Soarese, V.F., Castilho, L.R., Bon, E.P.S. and Freire, D.M.G. (2005). High-yield Bacillus subtilis protease production by solid-state fermentation, Human press, 311-319. Tunga, R.B. (1995). Influence of Temperature on Enzyme Production. Tech. M. Thesis, II. T. Kharagpur, India Verma Tuhina and Agarwal Swati (2016). Isolation and screening of haloalkaline protease producing bacteria from tannery solid waste. International Journal of Research in Engineering and Technology Volume: 05 Issue: 01 eISSN: 2319-1163. Verma Tuhina and Agarwal Swati. (2016). Production and Optimization of Extracellular Alkaline Protease from Halotolerant Chromate resistant Bacillus circulans isolated from Tannery solid waste. International Journal of Plant Pathology.Vol 9,issue-1

HIDDEN HARVEST UNDER CHANGING CLIMATE Vikas Kumar Jain 1, Anil K. Singh1, Prashant Bisen2 , Ashish Kumar Maurya1, Anupam Tiwari1, Sumit Pal1 and Risha Varan3 1

Department of Horticulture,2 Department of Genetics and Plant Breeding, Institute of Agriculture Science, B.H.U., Varanasi, U.P.,3College of Agriculture, G.B.P.U.A.&T, Pantnagar, Uttarakhand, India, Email: vikasjkumar88@ gmail.com, Corresponding Author: Vikas Kumar Jain

C

limate on planet Earth has changed many times, ranging from the ice ages to periods of warmth. During the last several decades increases in average air temperatures have been reported and associated effects on climate have been debated worldwide in a variety of forums. Due to its importance around the globe, agriculture was one of the first sectors to be studied in terms of potential impacts of climate change (Adams et al., 1990). Many alternatives have been proposed to growers aimed at minimizing losses in yield. However, few studies have addressed changes in postharvest quality of fruits and vegetable crops associated with these alterations. According to studies carried out by the Intergovernmental Panel on Climate Change (IPCC), average air temperatures will increase between 1.4 and 5.8 °C by the end of this century, based upon modelling techniques that incorporated data from ocean and atmospheric behaviour (IPCC, 2001). Other investigators forecast for the near future that rising air temperature could induce more frequent occurrence of extreme drought, flooding or heat waves than in the past (Assad et al., 2004). In most tropical regions temperature effects were so far lower, but important changes in rain distribution has occurred in Australia, Asia and Africa. In such events monsoon weakening was observed across Asia and Africa, playing an important role by making rain more scarce and irregular, at a point that climate changes are pointed as one of the most important causes of recent famines in areas such as the Sahel region of Africa (Henson, 2008). Higher temperatures can increase the capacity of air to absorb water vapor and, consequently, generate a higher demand for water. Higher evapotranspiration indices could lower or deplete the water reservoir in soils, creating water stress in plants during dry seasons. For example, water stress is of great concern in fruit production, because trees are not irrigated in many production areas around the world. It is well documented that water stress not only reduces crop productivity but also tends to accelerate fruit ripening (Henson, 2008). Exposure to elevated temperatures can cause morphological, anatomical, physiological, and, ultimately, biochemical changes in plant tissues and, as a consequence, can affect growth and development of different plant organs. These events can cause drastic reductions in commercial yield. However, by understanding plant tissues physiological responses to high temperatures, mechanisms of heat tolerances and possible strategies to improve yield, it is possible to predict reactions that will take place in the different steps of fruit and vegetable crops production, harvest and postharvest (Kays, 1997). Besides increase in temperature and its associated effects, climate changes are also a consequence of alterations in the composition of gaseous constituents in the atmosphere. CO2, also known as the most important greenhouse gas, and O3 concentrations in the atmosphere are changing during the last decade and are affecting many aspects of fruit and vegetable crops production around the globe (Felzer et al., 2007; Lloyd & Farquhar, 2008). CO2 concentrations are increasing in the atmosphere during the last decades (Mearns, 2000). The current atmospheric CO2 concentration is higher than at any time in the past 420 thousand years (Petit et al., 1999). Further increases due to anthropogenic activities have been predicted. CO2 concentrations are expected to be 100% higher in 2100 than the one observed at the pre-industrial era (IPCC, 2007). Ozone concentration in the atmosphere is also increasing. Even low-levels of ozone in the vicinities of big cities can cause visible injuries to plant tissues as well as physiological alterations (Felzeret al., 2007). The above-mentioned climate changes can potentially cause postharvest quality alterations in fruit and vegetable crops. Although many researchers have addressed climate changes in the past and, in some cases, focused postharvest alterations, the information is not organized and available for postharvest physiologists and food scientists that are interested in better understanding how these changes will affect their area of expertise. In thisarticle, we review how any change in ambient temperature and levels of CO2 and O3 can potentially influence the postharvest quality of vegetable and fruit crops.

126


Hidden Harvest: After crops are harvested, respiration is the major process to be controlled. Postharvest physiologists and food scientists do not have many options to interfere with the respiratory process of harvested commodities, since they are largely dependent on the product specific characteristics (Saltveit, 2002). In order to minimize undesirable changes in quality parameters during the postharvest period, growers and entrepreneurs can adopt a series of techniques to extend the shelflife of perishable plant products. Postharvest technology comprises different methods of harvesting, packaging, rapid cooling, storage and transportation, among other important technologies. This set of strategies is of paramount importance to help growers all over the world to withstand thechallenges that climate changes will impose throughout the next decades. Effects of Temperature: Fruit and vegetable growth and development are influenced by different environmental factors (Bindi et al., 2001). During their development, high temperatures can affect photosynthesis, respiration, aqueous relations and membrane stability as well as levels of plant hormones, primary and secondary metabolites. Seed germination can be reduced or even inhibited by high temperatures, depending on the species and stress level (Bewley, 1997). Most of the temperature effects on plants are mediated by their effects on plant biochemistry. That is, of course, for good water supplied plants, for which the Q10 for growth is very high. For plants that are subjected to water deficit, temperature is a physical facilitator for balancing sensible and latent heat exchange at the shoot, which is modulated by relative humidity and by wind. Most of the physiological processes go on normally in temperatures ranging from 0 °C to 40 °C. However, cardinal temperatures for the development of fruit and vegetable crops are much narrower and, depending on the species and ecological origin, it can be pushed towards 0 °C for temperate species from cold regions, such as carrots and lettuce. On the other hand, they can reach 40°C in species from tropical regions, such as many cucurbits and cactus species (Went, 1953). A general temperature effect in plants involves the ratio between photosynthesis and respiration. For a high yield, not only photosynthesis should be high but also the ratio photosynthesis/ respiration should be much higher than one. At temperatures, around 15 °C, the above-mentioned ratio is usually higher than ten, explaining why many plants tend to grow better in temperate regions than in tropical ones (Went, 1953). Higher than normal temperatures affect the photosynthetic process through the modulation of enzyme activity as well as the electron transport chain (Sage & Kubien, 2007). Additionally, in an indirect manner, higher temperatures can affect the photosynthetic process increasing leaf temperatures and, thus, defining the magnitude of the leaf-to-air vapor pressure difference (D), a key factor influencing stomatal conductance (Lloyd & Farquhar, 2008). Photosynthetic activity is proportional to temperature variations. High temperatures can increase the rate of biochemical reactions catalysed by different enzymes. However, above a certain temperature threshold, many enzymes lose their function, potentially changing plant tissue tolerance to heat stresses (Bieto& Talon, 1996). Fruit and vegetable crops are generally cooled after harvest and before packing operations. Rapid cooling methods such as forced-air cooling, hydrocooling and vacuum cooling demand considerable amounts of energy (Thompson, 2002). Therefore, it is anticipated that under warmer climatic conditions, fruit and vegetable crops will be harvested with higher pulp temperatures, which will demand more energy for proper cooling and raise product prices. High temperatures on fruit surface caused by pronounced exposure to sunlight can hasten ripening and other associated events. Picton and Grierson (1988) observed that high temperature stresses inhibited ethylene production and cell wall softening in papaya and tomato fruits. On the other hand, cucumber fruits showed increased tolerance to high temperature stress (32.5 °C) with no change in in vitro ACC oxidase activity (Chan & Linse, 1989). Fruit firmness is also affected by high temperature conditions during growth. ‘Fuerte’ avocados exposed to direct sunlight (35 °C) were 2.5 times firmer than those positioned on the shaded side (20 °C) of the tree. Changes in cell wall composition, cell number, and cell turgor properties were postulated as being associated with the observed phenomenon (Woolf et al., 2000). Antioxidants in fruit and vegetable crops can also be altered by exposure to high temperatures during the growing season. Wang and Zheng (2001) observed that ‘Kent’ strawberries grown in warmer nights (18–22 °C) and warmer days (25 °C) had a higher antioxidant activity than berries

Hidden Harvest under Changing Climate

127

grown under cooler (12 °C) days. The investigators also observed that high temperature conditions significantly increased the levels of flavonoids and, consequently, antioxidant capacity. Practical effects of climate change have already been experienced in some parts of the globe. For example, increased temperatures in Sambalpur, India, have delayed the onset of winter. As a consequence, cauliflower yields have dropped significantly (Pani, 2008). Where growers commonly harvested 1-kg heads, inflorescences are now smaller, weighing 0.25–0.30 kg each. Reductions in yield drive up production costs, an effect also observed for tomato, radish and other native Indian vegetable crops. Effects of CO2 Exposure: The greenhouse effect is primarily a combination of the effects of water vapor, CO2 and minute amounts of other gases (methane, nitrous oxide, and ozone) that absorb the radiation leaving the Earth´s surface (IPCC, 2001). The warming effect is explained by the fact that CO2 and other gases absorb the Earth’s infrared radiation, trapping heat. Since a significant part of all the energy emanated from Earth occurs in the form of infrared radiation, increased CO2 concentrations mean that more energy will be retained in the atmosphere,contributing to global warming (Lloyd & Farquhar, 2008). CO2concentrations in the atmosphere have increased approximately 35% from pre-industrial times to 2005 (IPCC, 2007). The studies concluded, that increased atmospheric CO2 alters net photosynthesis, biomass production, sugars and organic acids contents, stomatal conductance, firmness, seed yield, light, water, and nutrient use efficiency and plant water potential. Högy and Fangmeier (2009) studied the effects of high CO2 concentrations on the physical and chemical quality of potato tubers. They observed that increases in atmospheric CO2 (50% higher) increased tuber malformation in approximately 63%, resulting in poor processing quality, and a trend towards lower tuber greening (around 12%). Higher CO2 levels (550 μmol CO2/mol) increased the occurrence of common scab by 134% but no significant changes in dry matter content, specific gravity and underwater weight were observed. Higher (550 μmol CO2/mol) concentrations of CO2 increased glucose (22%), fructose (21%) and reducing sugars (23%) concentrations, reducing tubers quality due to increased browning and acryl amide formation in French fries. high CO2 concentrations, indicating loss of nutritional and sensory quality. Effects of Ozone Exposure: The effects of ozone on vegetation have been studied both under laboratory and field experiments. Stomatal conductance and ambient concentrations are the most important factors associated with ozone uptake by plants. Ozone enters plant tissues through the stomates, causing direct cellular damage, especially in the palisade cells (Mauzerall& Wang, 2001). The damage is probably due to changes in membrane permeability and may or may not result in visible injury, reduced growth and, ultimately, reduced yield (Krupa & Manning, 1988). The review of the pertinent literature related to plant responses to ozone exposure reveals that there is considerable variation in species response. Greatest impacts in fruit and vegetable crops may occur from changes in carbon transport. Underground storage organs (e.g., roots, tubers, bulbs) normally accumulate carbon in the form of starch and sugars, both of which are important quality parameters for both fresh and processed crops. If carbon transport to these structures is restricted, there is great potential to lower quality in such important crops as potatoes, sweet potatoes, carrots, onions and garlic. Exposure of other crops to elevated concentrations of atmospheric ozone can induce external and internal disorders, which can occur simultaneously or independently. These physiological disorders can lower the postharvest quality of fruit and vegetable crops destined for both fresh market and processing by causing such symptoms as yellowing (chlorosis) in leafy vegetables, alterations in starch and sugars contents of fruits and in underground organs. Decreased biomass production directly affects the size, appearance and other important visual quality parameters. Furthermore, impaired stomatal conductance due to O3 exposure can reduce root growth, affecting crops such as carrots, sweet potatoes and beet roots (Felzer et al., 2007). Skog and Chu (2001) carried out a set of experiments to determine the effectiveness of O3 in preventing ethylene-mediated deterioration and postharvest decay in both ethylene-sensitive and ethylene-producing commodities, when stored at optimal and sub-optimal temperatures. On mushrooms, which have no known site of ethylene activity, effects from O3 would be antimicrobial only. O3 at the concentration of 0.04 μL/L appeared to have potential for extending the storage life of

128


broccoli and seedless cucumbers, both stored at 3 °C. When mushrooms were stored at 4 °C and cucumbers at 10 °C, response to O3 was minimal. O3 also showed the capability of removing ethylene from the environment, inside cold rooms. At concentrations of 0.4 μL/ L, O3 was effective in removing ethylene (1.5 2.0 μL/L) from an apple and pear storage room. Apples and pears submitted to O3-enriched atmospheres showed no difference on fruits quality. Strawberries cv. Camarosa stored for three days under refrigerated storage (2 C) in a O3enriched atmosphere (0.35 μL/L)showed a 3-fold increase in vitamin C content when compared to berries stored at the same temperature under normal atmosphere as well as a 40% reduction in emissions of volatile esters in ozonized fruits (Perez, Sanz, Rios, Olias, & Olias, 1999). On the other hand, Kute, Zhou and Barth (1995) reported that strawberries stored in atmospheres with O3 ranging from 0.3 to 0.7 μL/L showed no effect on ascorbic acid levels after 7 days of storage under refrigerated conditions. Quality attributes and sensory characteristics were evaluated on tomato fruits cv. Carousel after O3 exposure (concentration ranging from 0.005 to 1.0 μmol/mol) at 13 C and 95% RH. Soluble sugars (glucose, fructose), fruit firmness, weight loss, antioxidant status, CO2/H2O exchange, ethylene production, citric acid, vitamin C (pulp and seed) and total phenolic content were not significantly affected by O3 treatment when compared to fruits kept under O3-free air. A transient increase in bcarotene, lutein and lycopene content was observed in O3-treated fruit, though the effect was not consistent. Sensory evaluation revealed a significant preference for fruits subjected to low-level O3enrichment (0.15 μmol/mol) (Tzortzakisa, Borlanda, Singletona, & Barnes, 2007). The quality of persimmon (Diospyros kaki L. F.) fruits (cv. Fuyu) harvested at two different harvest dates was evaluated after O3 exposure. Fruits were exposed to 0.15 μmol/mol (vol/vol) of O3 for 30 days at 15 °C and 90% relative humidity (RH). Astringency removal treatment (24 h at 20 °C, 98% CO2) was performed and fruits were then stored for 7 days at 20 °C (90% RH), imitating commercial conditions. Flesh softening was the most important disorder that appeared when fruit were transferred from 15 °C to commercial conditions. O3 exposure was capable to maintain firmness of second harvested fruits, which were naturally softer that first harvested fruits, over commercial limits even after 30 days at 15 °C plus shelf-life. O3-treated fruit showed the highest values of weight loss and maximum electrolyte leakage. However, O3 exposure had no significant effect on colour, ethanol, soluble solids and pH. Furthermore, O3-treated fruits showed no signs of phytotoxic injuries (Salvador et al., 2006). Conclusions: Temperature, CO2 and O3 directly and indirectly influence the production as well as quality of fruit and vegetable crops grown under different climates around the globe. Temperature change can directly affect crop anabolic activities, and a rise in temperatures be expected to have significant affect on postharvest quality by changing important quality attributes such as sugars, organic acids, secondary metabolites and fruit firmness. Rising levels of CO2 also contribute to global warming, by entrapping heat in the atmosphere. Prolonged exposure to CO2 levels could induce higher incidences of tuber malformation and increased levels of sugars in potato and decreased protein and mineral contents, leading to loss of nutritional and sensory quality. Increased levels of O3 in the troposphere can lead to detrimental effects on postharvest quality of fruit and vegetable crops. Elevated levels of O3 can induce visual injury and physiological disorders in different species, as well as significant changes in dry matter, reducing sugars, citric and malic acid, among other important quality parameters. References Adams, R. M., Rosenzweig, C., Peart, R. M., Ritchie, J. T., McCarl, B. A., Glyer, J. D., et al. (1990). Global climate change and US agriculture. Nature, 345: 219–224. Assad, E. D., Pinto, H. S., Zullo, J., Jr., & Ávila, A. M. H. (2004). Impacto das mudançasclimáticas no zoneamentoagroclimático do café no Brasil. PesquisaAgropecuáriaBrasileira, 39: 1057–1064. Bewley, J. D. (1997). Seed germination and dormancy. The Plant Cell, 9(7): 1055–1066. Bieto, J. A., & Talon, M. (1996). Fisiologia y bioquimica vegetal. Madrid: Interamericana, McGraw-Hill. 581 p. Bindi, M., Fibbi, L., &Miglietta, F. (2001). Free air carbon dioxide Enrichment (FACE) of grapevine (Vitisvinifera L.): II. Growth and quality of grape and wine in response to elevated carbon dioxide concentrations. European Journal of Agronomy, 14: 145–155. Chan, H. T., &Linse, E. (1989). Conditioning cucumbers to increase heat resistance in the EFE system. Journal of Food Science, 54: 1375–1376.

Hidden Harvest under Changing Climate

129

Felzer, B. S., Cronin, T., Reilly, J. M., Melillo, J. M., & Wang, X. (2007). Impacts of ozone on trees and crops. ComptersRendus Geoscience, 339: 784–798. Henson, R. (2008). The rough guide to climate change (2nd ed.). London: Penguim Books (p. 384). Högy, P., &Fangmeier, A. (2009). Atmospheric CO2 enrichment affects potatoes: 2 tuber quality traits. European Journal of Agronomy, 30: 85–94. IPCC. Climate change (2001). Working group II: Impacts, adaptations and vulnerability. Accessed 13.10.16. IPCC. Climate change (2007). In: S. Solomon, D. Qin, M. Manning, Z. Chen, M. Marquis, K. B. Averyt, M. Tignor, H. L. Miller (Eds.), The physical science basis. contribution of working group I to the fourth assessment report of the intergovernmental panel on climate change (996 p.). Cambridge, United Kingdom: Cambridge University Press. Kays, S. J. (1997). Postharvest physiology of perishable plant products. Athens: AVI. p.532 Krupa, S. V., & Manning, W. J. (1988). Atmospheric ozone: Formation and effects on vegetation. Environmental Pollution, 50: 101–137. Kute, K.M., Zhou, C., & Barth, M.M. (1995). The effect of ozone exposure on total ascorbic acid activity and soluble solids contents in strawberry tissue. In Proceedings of the Annual Meeting of the Institute of Food Technologists (IFT) (pp. 82). LA: New Orleans. Lloyd, J., & Farquhar, G. D. (2008). Effects of rising temperatures and [CO2] on the physiology of tropical forest trees. Philosophical Transactions of the Royal Society of Biological Sciences, 363: 1811–1817. Mauzerall, D. L., & Wang, X. (2001). Protecting agricultural crops from the effects of tropospheric ozone exposure: Reconciling science and standard setting in the United States, Europe, and Asia. Annual Review of Energy and the Environment, 26: 237–268. Mearns, L. O. (2000). Climatic change and variability. In K. R. Reddy & H. F. Hodges (Eds.), Climate change and global crop productivity (pp. 7–35). Wallingford, UK: CABI Publishing. Pani, R. K. (2008). Climate change hits vegetable crop. Accessed 22.10.16. Perez, A. G., Sanz, C., Rios, J. J., Olias, R., &Olias, J. M. (1999). Effects of ozone treatment on postharvest strawberry quality. Journal of Agricultural and Food Chemistry, 47(4): 1652–1656. Petit, J. R., Jouzel, J., Raynaud, D., Barkov, N. I., Barnola, J. M., Basile, I., et al. (1999). Climate and atmospheric history of the past 420, 000 years from the Vostok ice core, Antarctica. Nature, 399, 429–436. Picton, S., & Grierson, D. (1988). Inhibition of expression of tomato-ripening genes at high temperature. Plant Cell and Environment, 11: 265–272. Sage, R. F., &Kubien, D. (2007). The temperature response of C3 and C4 photosynthesis. PlantCell and Environment, 30: 1086–1106. Saltveit, M. E. (2002). Respiratory metabolism. Accessed 22.10.16. Salvador, A., Abad, I., Arnal, L., & Martinez-Javegam, J. M. (2006). Effect of ozone on postharvest quality of persimmon. Journal of Food Science, 71(6): 443–446. Sargent, S. A., & Moretti, C. L. (2002). Tomato. Accessed 22.10.16. Skog, L. J., & Chu, C. L. (2001). Effect of ozone on qualities of fruits and vegetables in cold storage. Canadian Journal of Plant Science, 81: 773–778. Thompson, J. E. (2002). Cooling horticultural commodities. In A. A. Kader (Ed.), Postharvest technology of horticultural crops (3rd ed., pp. 97–112). Oakland: Univ. of Calif. Agric. and Natural Resources. Tzortzakisa, N., Borlanda, A., Singletona, I., & Barnes, J. (2007). Impact of atmospheric ozone-enrichment on quality-related attributes of tomato fruit. Postharvest Biology and Technology, 45(3): 317–325. Wang, S. Y., & Zheng, W. (2001). Effect of plant growth temperature on antioxidant capacity in strawberry. Journal of Agricultural Food Chemistry, 49: 4977–4982. Went, F. W. (1953). The Effect of Temperature on Plant Growth. Annual Review of Plant Physiology, 4, 347– 362. Woolf, A. B., & Ferguson, I. B. (2000). Postharvest responses to high fruit temperatures in the field. Postharvest Biology and Technology, 21: 7–20.

CLIMATE CHANGE AND HUMAN RIGHTS VIOLATION Vivek Shukla Research Scholar, Faculty of Law, BHU, Varanasi, E-mail: [email protected]

C

limate change is the disastrous fallout of the profit-making actions of largely Western-controlled governments and multinational corporations. It has the biggest impact on the countries of those people who have no role or a very nominal role in the carbon emission, excessive fossil fuel use and global warming but are getting most affected and facing the consequences of it. Poor people of these countries live in poor areas where they are deprived of basic facilities and they engage in activities like farming and fishing which gets badly affected by drought, flood, cyclone, because of climate change and is dependent on climate. International human-rights law states that, ‘In no case may a people be deprived of its own means of subsistence.’ But–as the Intergovernmental Panel on Climate Change (IPCC) has documented in detail–excessive greenhouse-gas emissions, primarily from rich countries, are depriving millions of people of water, food, soil, and land on which they subsist. Twenty-three rich countries – including the USA, western Europe, Canada, Australia and Japan – are home to just 14 per cent of the world’s population, but have produced 60 per cent of the world’s carbon emissions since 1850, and they still produce 40 per cent of annual carbon emissions today. In 1992, these countries committed to return their annual emissions to 1990 levels by 2000. Instead, by 2005 they had allowed their collective emissions to rise more than 10 per cent above 1990 levels – with increases exceeding 15 per cent in Canada, Greece, Ireland, New Zealand, Portugal, Spain, and the USA. Their collective failure to act has raised the scientific risk – and the political risk – of global warming exceeding the critical threshold of 2°C (http://www.oxfam.org/en/policy/bp117-climate-wrongs-human-rights-080). In 1948 when the Universal Declaration of Human Rights was passed, those involved in the framing of these rights would not have had even an iota of this thought and not have had imagined ever that 60 years later Climate Change would pose such a serious and challenging threat. The intricacies and impact of climate change is having strong and serious repercussions thereby causing grave and massive violations of human rights. It is posing serious threat to Fundamental Rights like Right to Food, Shelter, Livelihood and Right to have a better life. While both United Nations and National governments of the countries and private companies accept climate change and its impact on violation of human rights, they still need to work together to address this problem. Linkage between Human Rights and Climate: An effort to establish a link between human rights and environment has been going on from last two decade. In 1994, the U.N. Special Reporter Fatima Zohra Seniti prepared a final report titled “Human Rights and the Environment” in which she formulated strong and comprehensive linkages between human rights and the environment and provided environmental dimension of fundamental human rights—to life, health, and culture (Comm. on Human Rights, 1994). In 2002, under the organization of the U.N. High Commissioner on Human Rights and the Executive Director of the U.N. Environmental Programme, a group of experts convened for an Export Seminar on Human Rights and the Environment (Expert Seminar on Human Rights and the Environment, 2002). The expert participants, reached broad agreement on the growing interconnectedness between the fields of human rights and environmental protection. In their Conclusions the experts noted: Linkage of human rights and environmental concerns, approaches and techniques is reflected in developments relating to procedural and substantive rights, in the activities of international organizations, and in the drafting and application of national constitutions. . . . In the last decade a substantial body of case law and decisions has recognized the violation of a fundamental human right as the cause, or result, of environmental degradation. A significant number of decisions at the national and international levels have identified environmental harm to individuals or communities, especially indigenous peoples, arising as a result of violations of the rights to health, to life, to self-determination, to food and water, and to housing (Expert Seminar on Human Rights and the Environment, 2002). Human Rights Violated by Climate Change: “Climate change, human-induced climate change, is obviously an assault on the ecosystem that we all share, but it also has the added feature of undercutting rights, important rights like the right to health, the right to food, to water and sanitation, to adequate housing, and, in a number of small island States and coastal communities, the very right

Climate Change and Human Rights Violation

131

to self-determination and existence.” Flavia Pansieri, United Nations Deputy High Commissioner for Human Rights (Understanding Human Rights and Climate Change, Submission of the Office of the High Commissioner for Human Rights to the 21st Conference of the Parties to the United Nations Framework Convention on Climate Change). Right To Life: According to the Universal Declaration of Human Rights Article 3 “everyone has the right to life, liberty and security of person.” The International Covenant on Civil and Political Rights (ICCPR) reiterates that “every human being has the inherent right to life.” All States have committed to respect, protect, promote, and fulfill the right to life. This entails, at the very least, that States should take effective measures against foreseeable and preventable loss of life. Because of the impact of Climate Change deaths, diseases will increase because of the increase in frequency and intensity of heat waves, floods, storms, fires, and droughts. There will be a spur in drowning and flood cases which will affect the worlds population living in river basins and coastal areas. Similarly increase in global warming would lead to increase in heat waves because of which sick people, old people, young children and those who are isolated will be prone to deaths because of heat waves. It will also effect the livelihood of fisherman living in coastal areas.http://www.scientificamerican.com/article.cfm?id =climate-change-refugees-bangladesh Impoverished fishing villages along the Bay of Bengal with more frequent, more powerful cyclones and flooding had let villagers to migrate to other places. There, out of desperation, the rural poor live in slums where the air, water and earth are so polluted by chemicals, tin roofing corrodes in months rather than years and severe health afflictions are the norm. The Right to Food: The right to food is enshrined in the Universal Declaration of Human Rights and the ICESCR. Article 11 of the ICESCR upholds the “fundamental right of everyone to be free from hunger” and calls upon States acting individually and through international co-operation, “to ensure an equitable distribution of world food supplies in relation to need.” According to the IPCC, climate change undermines food security therefore, it threatens realization of the right to food. The World Bank has estimated that a 2°C increase in average global temperature (the proposed target for international climate mitigation efforts) would put “between 100 million and 400 million more people at risk of hunger and could result in over 3 million additional deaths from malnutrition each year (The World Bank, 2010). Moreover, persons, groups and peoples in vulnerable situations are at a greater risk. The Right to Health: ‘The State Parties to the present Covenant recognize the right of everyone to the enjoyment of the highest attainable standard of physical and mental health.’ (ICESCR, Article 12) Climate change leads to an uneven flood, drought situations which give birth to infectious diseases spreading in new areas. Diseases like diarrhea, cholera, malaria, dengue, chicken guinea will spread its tentacles more affecting people. It will also increase child malnutrition and child diseases. The Right to Subsistence: ‘Everyone has the right to a standard of living adequate for the health and well-being of himself and of his family, including food, clothing, housing…’. (UDHR, Article 25). By 2020, between 75 million and 250 million people in Africa are likely to face greater water stress due to climate change. Reduced water flow from mountain glaciers could affect up to one billion people in Asia by the 2050s. Approximately 20–30 per cent of plant and animal species assessed so far are likely to be at increased risk of extinction if average global temperatures rise more than 1.5– 2.5C. Coral bleaching and coastal erosion will affect fish stocks–currently the primary source of animal protein for one billion people. Millions more people risk facing annual floods due to sea-level rise by the 2080s, mostly in the mega-deltas of Asia and Africa. On small islands, too, sea-level rise is expected to exacerbate inundation, storm surge, and erosion, threatening vital infrastructure, settlements, and facilities that support the livelihoods of island communities (The World Bank, 2010). The Right to Education: According to the Universal Declaration of Human Rights, “everyone has the right to education.” Article 13 of the ICESCR elaborates upon this right, guaranteeing to all persons, free, compulsory primary education and calling on States to progressively realize free secondary education for all. However, the impacts of climate change and the exigencies which it creates threaten the ability of States to expend maximum available resources for the progressive realization of the right to education and can press children into the labor pool prematurely. In his 2011 report to the General Assembly, the United Nations Special Rapporteur on the right to food stated that the impacts of successive droughts had caused some children to be “removed from schools because education became unaffordable and because their work was needed by the family as a source of revenue”(United Nations General Assembly, 2011).

132


The Right to Housing: According to Article 11 of the ICESCR all persons are entitled to an adequate standard of living for themselves and their families including adequate housing. The scope and application of the right to housing is elaborated upon in General Comment No. 4 of the Committee on Economic, Social and Cultural Rights, which states that “the human right to adequate housing…is of central importance for the enjoyment of all economic, social and cultural rights” (United Nations Committee on Economic, 1991). Climate change threatens the right to housing in a number of ways. Extreme weather events can destroy homes displacing multitudes of people. Drought, erosion and flooding can gradually render territories inhabitable resulting in displacement and migration. Sea level rise threatens the very land upon which houses in low-lying areas are situated and is expected to “continue for centuries even if the global mean temperature is stabilized.” Fueling more Conflict and Human Rights Violations: Researchers have found that a hotter, more unstable climate exacerbates three specific types of violence: personal violence (such as murder, rape and domestic violence), intergroup violence/political instability and institutional breakdowns (including the collapse of governing institutions and whole civilizations) (John Litman, How climate change destroys human rights). If climate change is going to be about impacting on the most marginalized, then it’s going to be an issue of discrimination…and whether or not existing resilience or mitigation measures that are put in place by governments or international mechanisms truly reflect the reality of whose suffering most on the ground. Climate change and global warming will lead to struggle between native people and migrated people as the former will oppose the later. It will end in making more people refugee and taking refuge in other countries which will be again the violation of human rights. Because people taking in shelter in the refugee will be devoid of their basic needs and requirements. Suggestion: It is the obligation of States to respect, protect, and fulfill human rights, and this includes obligations to mitigate domestic Green House Gases emissions, protect citizens against the harmful effects of climate Change, and ensure that responses to climate change do not result in human rights violations. The policies of developing countries shall give special emphasis on the most vulnerable people by putting poor communities at the heart of planning, addressing women’s needs and interests, and providing social protection schemes. On the other hand, rich countries must cut down their global emissions and shall provide the finance and technology needed to poor countries to help them in reducing emissions. Although States and United Nations are taking important steps towards mitigating the risk of climate change but still much needs to be done. Negligence on the part of those governments and corporations towards peoples who have been displaced or further impoverished by climate change is a form of violence. That negligence has included underfundinghttp:// www.dailymail.co.uk/wires/afp/article-2864951/Poorest-countries-left-climate-finance-eport.html for climate adaptation and mitigation efforts, and relative inaction or slow action on curbing overconsumption. State shall focus on focus on placing those who have been displaced because of drought, flood, etc. due to climate change. Its time to show strong solidarity with countries most vulnerable to the impacts of climate change, and underscore the need to support efforts aimed to enhance their adaptive capacity, strengthen resilience and reduce vulnerability. Parties shall strengthen and support efforts to eradicate poverty, ensure food security and to take stringent action to deal with climate change challenges in agriculture. References Comm. on Human Rights, Sub-Comm. on Prevention of Discrimination & Prot. of Minorities, Special Rapporteur , Human Rights and the Environment, Final Report, U.N. Doc. E/CN.4/Sub.2/1994/9 (July 6, 1994) (prepared by Mrs. Fatma Zohra Ksentini) [hereinafter Final Report] Expert Seminar on Human Rights and the Environment. (2002). Meeting of Experts’ Conclusions available at http://www.unhchr.ch/environment/conclusions.html. http://www.oxfam.org/en/policy/bp117-climate-wrongs-human-rights-080 John Litman, How climate change destroys human rights. http://www.aljazeera.com/ humanrights / 2013/12/ how-climate-change-destroys-human-rights-20131217174532837148.html The World Bank, World Development Report (2010).: Development and Climate Change, pp. 4 – 5. United Nations Committee on Economic, Social and Cultural Rights, General Comment No. 4 (New York, United Nations, 1991), Art. 1. United Nations General Assembly, A/HRC/16/49/Add.2: Report of the Special Rapporteur on the right to food, Olivier De Schutter (2011), para. 13.

DEVELOPMENT OF FINGERPRINTS OF LINSEED CULTIVARS AND GENETIC PURITY ASSESSMENT THROUGH MORPHOLOGICAL AND MOLECULAR MARKERS Vikas Pali1 and Nandan Mehta2 1

Scientist, Hill Millet Research Station, Anand Agricultural University, Dahod-389151 and 2Principal Scientist, Indira Gandhi Krishi Vishwavidyalaya, Raipur, Chhattisgarh-492012, Corresponding Author: Vikas Pali

F

lax (Linum usitatissimum L.), also called common flax or linseed, is an annual herb, which is the third largest natural fiber crop and one of the five major oilseed crops in the world. Flax is a small size and self-pollinated herb that has been thought to be the model plant for the bast fiber plants. At present, fiber flax cultivars are mainly grown in some regions of northern Europe, Russia and China, while distinct linseed flax varieties are widely grown in cool temperate regions of Argentina, India, China, Russia, the USA and Canada (Millam et al., 2005). It is well known that the success of improved variety/ hybrid in the farmer’s fields depend upon the availability of seeds with high genetic purity and a seed of provenance is the most critical input which decides the effect of all other inputs in increasing the productivity. Therefore, assessing the genetic purity is of utmost importance before the seed reaches to the farmer’s field. Also, in the context of IPR, identification of the cultivar has assumed great significance. Conventionally, the genetic purity of seed is assessed using morphological markers in the field based ‘Grow-Out-Test’. However, this method has several disadvantages including the environmental influence, limited variability observed for the characters and subjectivity, etc. Thus, DNA-based markers hold greater promise with several advantages, viz., high polymorphism, insensitivity to environment, stability and developmental stage independence etc. Several molecular markers have been developed and have been used successfully for varietal discrimination. Once, the specific molecular markers are identified for each variety or hybrid, they could be used successfully to assess the genetic purity and thus, could avoid the laborious GOT. The original variety along with its improved version needs to be protected in terms of plant breeder’s right in the present era of intellectual property protection. There is an eminent need to identify genotype specific markers for cultivars identity and trueness of varieties, so that such molecular markers can be utilized unambiguously to identify the variety and purity of seed-lots of the variety. During the seed production chain, the variety can get contaminated with the other varieties and such impurities may go on accumulating unnoticed, finally leading to deterioration of the genetic quality of the variety. It has been estimated that 1% impurity in seed lot may decrease the potential yield of varieties and hybrids by about 100 kg/ha (Mao et al., 1996). In a country like India, where contract farming is practised at many places for seed production with the active participation of private sector (Mishra et al., 2003), monitoring genetic purity at each stage of seed production becomes necessary. Assessment of seed purity is one of the most important quality control aspects in seed production. Traditionally, it has been the practice to carry out a grow-out test (GOT), based on morphological traits, for assessment of purity of seeds. GOT is time consuming (takes one full growing season for completion), space demanding and often does not allow the unequivocal identification of genotypes. Among the PCR based DNA markers, microsatellite or simple sequence repeats (SSRs) are well known for high level of polymorphism content, versatility and are preferred due to their reproducibility and amenability for automation (Mc Couch et al., 1997; McCouch et al., 2002; Nagaoka and Ogihara, 1997; Rafalski et al., 1996 and Salimah et al., 1995). Further, SSRs can be easily automated using florescent labeled primers on an automated sequencer and it is possible to multiplex (combine) several markers with non-overlapping size ranges on a single electrophoresis run (Edwards and McCouch, 2007). It has also been particularly indicated that the SSRs are more discriminative, reliable and repeatable and they could potentially be standardized more easily for Distinctness, Uniformity and Stability (DUS) testing (UPOV, 1997). SSR markers have been used in genetic analysis and fingerprinting of different linseed accessions (Thomson et al., 2007; Lu et al., 2010; Rampant et al., 2011). Fingerprinting of the commercial linseed cultivars based on molecular

134


markers is a crucial measure for quick identification of similar or closely-related cultivars. The present investigation was undertaken with an objective to identify distinguishable microsatellite markers to establish fingerprinting of linseed (Linum usitatissimum L.) varieties, assessing variation within varieties and testing the genetic purity of four varieties namely Kartika, Deepika, Indira Alsi-32 and RLC-92 with two major activities: (1) identification of informative SSR markers capable of distinguishing all four popular varieties of linseed and (2) seed purity assessment based on SSR marker and morphological characteristics. Materials and Methods The present study was carried out at Department of Genetics and Plant Breeding, Indira Gandhi Krishi Vishwavidyalaya, Raipur, India during 2011 - 2013.The plant material for this study comprised of SPS nucleus seeds of four popular cultivars of linseed (Table 1) collected from National Seed Project (NSP), IGKV, Raipur and certified seeds were collected from Chhattisgarh State Seed Certification Agency (CGSSCA), Raipur, Chhattisgarh, India. Table 1: Parentage, special features of four linseed varieties Variety Year of Release Parentage Kartika 2005 Kiran x LCK-88062

Deepika

2006

Kiran x Ayogi

Indira Alsi-32

2005

Kiran x RLC-29

RLC-92

2008

Jeevan x LCK-9209

Special features Dwarf in height, light brown coloured seed, moderately resistant to wilt, powdery mildew and bud fly, oil content- 42.93% Medium in height and early maturity, blue flower, brown seeded, resistant to powdery mildew, oil content- 41.39% Dwarf statured, blue flower, dark brown seeded, resistant to powdery mildew, oil content- 39.18% Tall in height, tinge blue flower, brown seeded, tolerant to bud fly and resistant to wilt, powdery mildew, oil content- 39%

Genomic DNA Extraction: Genomic DNA was extracted from young leaves of the linseed plants according to the modified CTAB method (Kang et al., 1998). The concentrations and quality of the genomic DNA samples were estimated on spectrophotometer ND-2000 (Nanodrop, USA). Finally, all the genomic DNA samples were diluted to a final concentration of 40 ng/μl with TE buffer (10 mM TrisHC1, pH 8.0; 1 mM EDTA) and stored at -20 0C for further use. SSR-PCR Amplification: A total of ninety linseed SSR primers covering all the chromosomes of linseed were used in this study. Polymerase chain reaction (PCR) amplification was conducted in a 20 μl volume containing 40 ng/μl of genomic DNA, 1 U/μl Taq DNA polymerase (Bangalore Genei), 10x buffer with 15mM Mgcl2, 1mM dNTPs and 5pmol/ml of each forward and reverse SSR primer. The PCR protocol consisted of an initial denaturation at 950C for 5 min, followed by 34 cycles of 94 0C for 1 min, annealing for 1 min at 580C, 720C for 1 min extension, and a final extension of 720C for 7 min. All PCR reactions were carried out in a Veriti Thermal Cycler (Applied Biosystems, USA). PCR products were separated using 5% PAGE, stained with ethidium bromide and photographed under UV light using Image Gel Doc LabTM software Version 2.0.1 (Bio-Rad, USA). Data Analysis: The band profiles were scored only for distinct, reproducible bands as present (1) or absent (0) for each SSR primer pair. Jaccard’s similarity coefficient values were calculated and dendrogram based on similarity coefficient values were generated using unweighted pair-group method with arithmetic means (UPGMA) by the NTSYSpc 2.10e software (Rohlf, 2000). The polymorphism information content (PIC) value of SSR markers was calculated using the following formula (Anderson et al., 1993).

k PIC = 1 -

Σ pi

2

i=1

Where k is the total number of alleles (bands) detected for one SSR locus and Pi is the frequency of the ith allele (band) in all the samples analyzed.

Development of Fingerprints of Linseed Cultivars and Genetic Purity Assessment……….

135

Genetic Purity Assessment through Morphological Characters and Genotype-specific SSR Markers: A total of 5 seed samples of each variety including SPS nucleus seed from National Seed Project, IGKV, Raipur, Chhattisgarh, India and certified seed from Chhattisgarh State Seed Certification Agency, Raipur, Chhattisgarh, India were used to determine the genetic purity of Kartika, Deepika, Indira Alsi-32 and RLC-92 based on both morphological and molecular descriptors. The experimental material was planted in randomized complete block design in three replications. Sixty plants were planted in each row with the spacing of 30 cm and between plants was 10 cm. Thus, a total of 360 plants were maintained in each variety. When the plants were 20 days old, leaf material was collected from each of the plant for DNA isolation and these were amplified through normal PCR and multiplex PCR using marker combination of LU-7 and LU-25, which can differentiate Kartika, Deepika, Indira Alsi-32 and RLC-92 from each other. The plants were grown till maturity and the genotype as deduced from marker profiles was verified with the phenotype as per the DUS test based on 18 characters (PPV&FRA, GOI, 2009). According to DUS guidelines, 30 plants of each variety were selected for Distinctiveness and Stability observations which were equally divided among 3 replications (10 plants per replication) while for Uniformity 100 plants were taken for observation. Of the 18 characters studied, eleven were qualitative in nature and seven were quantitative in nature. The details of 18 morphological characters and their stage of observation are shown in (Table 2). Impurities in the seed-lot were estimated based on visual examination of qualitative traits and by measuring the quantitative traits. Table 2: Eighteen DUS descriptors in linseed S.No. Descriptors Stage of observation 1 Time of flowering Beginning of flowering 2 Flower : size of corolla Beginning of flowering 3 Flower : shape (Sunrise to noon) Beginning of flowering 4 Flower : size (Petal to petal diameter ) Peak flowering 5 Petal : colour of corolla Peak flowering 6 Petal : aestivation (arrangement of petals) Peak flowering 7 Petel : venation colour (fully developed flower) Peak flowering 8 Stamen : filament colour (immediately after flower opening Peak flowering 9 Anther: colour (immediately after flower opening ) Peak flowering 10 Plant : growth habit Peak flowering 11 Plant : natural height including branches Harvest maturity 12 Capsule: size of fully developed capsule (diameter) Harvest maturity 13 Capsule : dehiscence Harvest maturity 14 Capsule : shape of tip Harvest maturity 15 Seed : colour Harvest maturity 16 Seed : size (length of seed) Harvest maturity 17 Seed : weight (1000 seeds) Harvest maturity 18 Oil content % Harvest maturity MG : Measurement by a single observation of a group of plants or parts of plants MS : Measurement of a numbers of individual plants or parts of plants VG : Visual assessment by a single observation of a group of plants or parts of plants VS : Visual assessment by observation of individual plants or parts of plants Descriptors in italics showed variation

Assessment VG MS VG VS VS VS VS VS VS VG MS MS VS VG VG MS MG MG

Results and Discussion DNA fingerprinting methods based on polymerase chain reaction have become methods of choice for germplasm characterization, diversity analysis and seed purity assays (Sundaram et al., 2008). A variety of DNA markers are now available for fingerprinting cultivars and for marker assisted selection. In the present study, DNA from 4 linseed genotypes namely Kartika, Deepika, Indira Alsi-32 and RLC-92 linseed varieties developed by IGKV, Raipur, India were subjected to SSR marker analysis for identification of genotypes specific markers/marker combinations. We have identified genotype specific SSR markers for all these four varieties which can distinguish the varieties from each other and demonstrated the utility of these markers in the assessment of purity in seed-lots and compared their efficiency with morphological markers. The result obtained in the study are presented and discussed below:

136


SSR Marker Polymorphism Among the Linseed Genotypes: Of the 90 SSR markers utilized in the present study, 28 displayed polymorphism among the 4 linseed genotypes analyzed and amplified a total of 61 alleles with an average of 2.17 alleles per marker. The number of alleles detected by the polymorphic SSR markers varied from 2 to 4. The polymorphic information content (PIC) value of each SSR primer pair ranged from 0.37 to 0.75 with an average of 0.41 (Table 3). The SSR markers LU-1 and LU-7 generated a maximum number of four alleles, while, LU-21 and LU-25 exhibited three polymorphic alleles and the rest of markers generated only two alleles. Table 3: List of SSR markers used for identification of genotype specific marker S.No Markers Forward Primer Reverse primer 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28

LU-1 LU-2 LU-3 LU-4 LU-5 LU-6 LU-7 LU-8 LU-9 LU-10 LU-11 LU-13 LU-14 LU-15 LU-16 LU-18 LU-20 LU-21 LU-22 LU-24 LU-25 LU-27 LU-29 LU-31 LU-32 LU-33 LU-34 LU-35

TCATTCATCTCCTTCCACTAAAA TCCGGACCCTTTCAATATCA GCTCGTGATCTCCTTCATCC TTATTTCCGGACCCTTTCAA GTCACTGGGTGTGTGTTTGC CCCCATTTCTACCATCTCCTT CATCCAACAAAGGGTGGTG TCCCGTAATATTCTATGTTCTTCC TTGCGTGATTATCTGCTTCG GCCTAAAGCTGATGCGTTTC ATGGCAGGTTCTGCTGTTTC AAGATGACGTCGGTGGTGAT GCTTGCGAGAAGAAGGAGAA TGGACGACGATGAAGATGAA TTATTCTTGCCTGCCAATCG AGAGGCGGAGGGCATTAC TTCAACCAGGCAAATTTCAA AAGGGTGGTGGTGGGAAC GATGGGGTTGAAGCCAGTAG ATGGCAGGTTCTGCTGTTTC TCTACAGAGTTCAATTCCCGTAA GTTTGAGAAGAGGGCATCCA GGGCAGTGATTGATTGGTTT TCTTTGTTTGGTGCCAAAGTT ACGCGTAAACTTTCCGTTTC TTCTCCATCATCTCACATCCA GGAAGAATTGGAAGAGGAAGG CCAACGGATCATCCTCTAGC

TTGAAAGCCCTAGTAGACACCA AACTACCGCCGGTGATGA AAAACCACGTCCAGATGCTC AAACTACCGCCGGTGATGAT AGCAGAAGAAGATGGCGAAA CAACAGCGGAACTGATGAAA GGAACAAAGGGTAGCCATGA TGAGTTGGACCTTACAAGACTCA ATGGCAGGTTCTGCTGTTTC TGTCAGGCTCCTTCTTTTGC TTGCGTGATTATCTGCTTCG CGGAACCTTCCATTTTCCTC TCACCAAAGGCATTCACAAA CCGCCGGGTACACTACTACT TCCAGCTCTTGCTCGTTCTT TTGGAGAGTTGGAATCGAGA CAAGAAGAGGCCCAGAATTG GTTGGGGTGAAGAGGAACAA CCCACCCCATCTATCATTTG TTGCGTGATTATCTGCTTCG GTTGGACCTTACAAGACTCACTG GTTGGGGTGAAGAGGAACAA GGCGGCAATTGCTACATT TTCATGATCTCACCTAACCTGA ATAATGTCGGCTGCTTCTGC CCAAATCAGAATGTGCGTGT CCTTCTCCCATGATCAAACAA GGACAGAAAGGGGAAAGGAA

Allele size (bp) 146-179 125-150 153-173 150-155 134-150 125-140 134-154 181-221 123-175 141-148 100-150 95-100 141-150 114-120 153-167 140-150 122-125 135-150 132-148 95-138 200-250 152-173 102-115 102-117 120-125 149-155 110-130 143-149

PIC value 0.750 0.375 0.375 0.375 0.375 0.375 0.750 0.375 0.375 0.375 0.375 0.375 0.375 0.375 0.375 0.375 0.375 0.625 0.375 0.375 0.625 0.375 0.375 0.375 0.375 0.375 0.375 0.375

Of the twenty-eight microsatellite markers, only two microsatellite markers viz., LU-1 and LU-7 differentiated all the four varieties at least with a single marker allele difference. The SSR markers LU-1, LU-2, LU-6, LU-22, LU-32, LU-7, LU-15, LU-5, LU-31, LU-21, LU-27 and LU-33 distinguished Deepika and Indira Alsi-32 while, LU-1, LU-2, LU-6, LU-9, LU-18, LU-25, LU-8, LU-7, LU-11, LU-20, LU-21, LU-27 and LU-33 were able to distinguish RLC-92 and Indira Alsi-32. The linseed variety RLC92 was distinguished from other varieties by markers like LU-1, LU-9, LU-18, LU-25, LU-8, LU-7, LU11, LU-20, LU-21, LU-24, LU-10 and LU-10. The SSR markers LU-1 and LU-7, targeting a (TTC)34 followed by (TTC)7 motif, clearly distinguished all four varieties from each other by amplifying a 146-179 and 134-154 bp fragment (Figure 1, 2 and 5), whereas another SSR markers LU-21 and LU-25 clearly distinguished at least 3 varieties from each other except one variety by amplifying a 135-150 and 200-250 bp fragment (Figure 3, 4 and 5). When markers were pre-PCR multiplexed in combinations, they could clearly distinguish varieties from each other and hence, the fragments amplified by both markers (i.e. in combination) could be considered as a molecular ID for Kartika, Deepika, Indira Alsi-32 and RLC-92 (Figure 6). This can be considered the first step towards DNA fingerprinting of linseed varieties like Kartika, Deepika, Indira Alsi-32 and RLC92 and thus, protect the IPR of the institutions developing such unique and well accepted varieties (Sundaram et al., 2008) also followed a similar multiplexing approach for checking the purity of hybrid rice parental lines.


137

Fig: 1

Fig: 2

Fig: 3

Fig: 4 Figure 1, 2, 3 and 4: Amplification pattern of Linseed SSR primers LU 1, LU 7, LU 21 and LU 21 (1=Kartika; 2=Deepika; 3=Indira Alsi 32; 4= RLC 92)

138


Figure 5: Graphical demonstration of SSR polymorphic markersLU 1 and LU 7 distinguished all four varieties from each other while LU 21 and LU 25 distinguished three varieties from each other

Figure 6: Amplification pattern of multiplex PCR (LU-22 and LU-25) Cluster Analysis: Cluster analysis was carried out based on the similarity index data derived from the SSR markers which grouped the 4 varieties into two major clusters (Figure 7). The Jaccard’s similarity ranged from 0.10 to 0.60 with an average similarity index of 0.34 indicating that three varieties used in the present study were having common ancenstors in their pedigree. Kartika shared maximum similarity with Deepika with a similarity index of 0.56 because both have the blood of Kiran as one of the parents in their pedigree. Cluster I comprised of only one genotypes (RLC-92) sharing a similarity of 15%. Cluster II consisted of three genotypes viz., Kartika, Deepika and Indira Alsi-32 which were further divided into two minor sub-clusters. Sub-cluster I with two genotypes (Kartika and Deepika) shared 56 per cent of genetic similarity, while sub-cluster II consisted of one genotypes (Indira Alsi-32) having 32 per cent. The average genetic similarity within four varieties was about 34% and the genetic diversity among these varieties was observed to be high. RLC-92 was observed to be divergent from Kartika, Deepika and Indira Alsi-32. However, phenotypically, RLC-92 is different for these three varieties due to its tall stature.

Figure 7: Dendrogram constructed using UPGMA based on Jaccard’s coefficient of four linseed cultivars (SSR Markers)


139

Based on these results, it can be concluded that the allelic diversity revealed by 28 SSR markers is sufficient to distinguish the varieties based on their genetic constitution. These results are on expected lines and could be explained based on a close pedigree and genetic relatedness of the varieties analysed. Genetic Purity Assessment of Kartika, Deepika, Indira Alsi-32 and RLC-92: An attempt was made to validate the utility of Kartika, Deepika, Indira Alsi-32 and RLC-92 amplified by the genotype specific SSR markers, LU-1 and LU-2, respectively for monitoring purity of different classes of seed of linseed variety. All the seed samples of Kartika, Deepika, Indira Alsi-32 and RLC-92 were analysed with the two SSR markers LU-1 and LU-2 and also by morphological characters. The percentage of purity and number of contaminants in different classes of seed was estimated by molecular and morphological markers are given in (Table 8). Impure plants in the certified seed of Deepika population are displayed in the figures (Figure 8, 9 and Table 9). Table 8: Comparison of percent purity on the basis of molecular and morphological data S.No

1

2

3

4

Variety

Kartika

Class of seed

Morphological Purity % No. of Purity contaminants %

Impure plant No

NSPSPS Nucleus seed

0

100

-

CSSCACertified seed

5

94.8

9,20,37,55,76

NSPSPS Nucleus seed

0

100

-

CSSCACertified seed

14

85.4

26,28,29,30,58, 59,60,61,62,63, 64,83,92,94

NSPSPS Nucleus seed

0

100

-

CSSCACertified seed

7

92.7

7,13,47,54,79, 83,95

NSPSPS Nucleus seed

0

100

-

CSSCACertified seed

6

93.7

5,21,33,49,61, 90

Molecular Purity % No. of Purity % contaminants

Impure plant No

0

100

-

Time of flowering, seed weight ----------

7

92.7

9,20,37,55, 76,81,93

0

100

-

Time of flowering, flower size, petal venation colour, anther colour, plant height, seed colour and seed weight -----------

16

83.3

26,27,28, 29,30,40, 58,59,60, 61,62,63, 64,83,92, 94

0

100

-

Time of flowering, petal venation colour, seed colour, and seed weight ----------

10

89.5

7,13,30,41, 47,54,61, 79,83,95

0

100

-

Time of flowering, plant height, anther colour and seed weight

7

92.7

5,21,33,49, 61,72,90

Variation in morphological character ----------

Deepika

Indira Alsi-32

RLC-92

Table 9: Matrix showing impure plants in field in Certified seeds of Deepika 1 2 3 4 5 6 7 8 9 10 17 18 19 20 21 22 23 24 25 26 33 34 35 36 37 38 39 40 41 42 49 50 51 52 53 54 55 56 57 58 65 66 67 68 69 70 71 72 73 74 81 82 84 85 86 87 88 89 90 83 Bold numbers represents off type or impure plants in the field

Fig: 8

11 27 43 59 75 91

12 28 44 60 76 92

13 29 45 61 77 93

14 30 46 62 78 94

15 31 47 63 79 95

16 32 48 64 80 96

140


Fig: 9 Figure 8 and 9: Amplification pattern of linseed SSR (LU 1) in certified seed population of Deepika Based on the molecular marker analysis, the purity ranged from 83.3% to 100%. Nucleus seed showed 100% purity without any contamination. The certified seed sample of Deepika showed the least genetic purity (83.3%) probably due to the genetic admixtures. As per the seed certification standards, nucleus seed should have 100%, whereas, certified seed should have a minimum of 99% seed purity, respectively (Seed Management, 2003-IRRI). Nucleus seed showed genetic purity as per the seed certification standards, but certified seed lots deviated significantly from the set standards. Since, these are progenies of breeder seed, some contamination might have occurred probably due to cross pollination, mistakes in bagging and tagging and lack of adequate care at the time of processing during seed production. Of the 18 morphological characters analysed, seven characters (time of flowering, flower size, petal venation colour, anther colour, plant height, seed colour and seed weight) differentiated the impurities in certified seed. Among these, time of flowering and seed weight exhibited maximum variation (Table 8). Genetic purity detected by morphological markers ranged from 85.4 to 100%. The variants plants identified on the basis of morphological characters also showed variation on molecular basis. Similar observations were made in rice (Kalaichelvan, 2009). The percentage of contaminants detected based on SSR marker analysis was higher than those detected by conventional GOT assay (Keshavalu, 2006). Molecular markers detected some additional impurities, which were not detected through morphological characters. For example in certified seed, some additional impure plants were detected based on SSR analysis, which was not detected by GOT analysis. This demonstrated the better discriminatory power and efficiency of SSR markers in genetic purity assessments and these markers could even accurately detect residual heterozygosity in the seed. Similar results have been reported by (Nanda Kumar et al., 2004; Sundaram et al., 2008 and Ye-Yun et al., 2005). Based on the results obtained from this study, it is clear that there is a need to critically assess the genetic purity of popular varieties of premium quality at each and every stage of seed multiplication and processing with the help of molecular markers so that the seeds cultivated by farmers are true-to-type and fetches premium price. An important aspect of the present study is deployment of the strategy of pre-PCR multiplexing for assessment of genetic impurity in seed-lots of Deepika. Pre-PCR multiplexing is a cost saving strategy, wherein analysis can be carried out simultaneously using two or more markers in a single PCR with negligible addition to the total cost of assay and with enhanced accuracy. Sometimes analysis using single markers (Nanda Kumar et al., 2004 and Yashitola et al., 2002) may not help in accurate estimation of seed impurities in certain cases, and wherever possible, it is better to deploy more than one marker through multiplex PCR to get authentic results (Sundaram et al., 2008). Conclusion: Based on the results of the present study, it can be concluded that SSR markers can be efficiently used to generate locus specific allelic information which can serve as molecular IDs for commercially popular linseed varieties (Kartika, Deepika, Indira Alsi-32 and RlC-92) and such information can be used effectively in assessment of seed purity as compared to conventional GOT, saving on time, resource and energy. The same strategy can be extended to other crops of economic importance, wherever SSR markers are available. The SSR marker information developed through this


141

study is also helpful in the assessment of genetic contaminants in seed supply chain and undertakes necessary corrective action to supply the high quality seed to farmers. Acknowledgements: We gratefully acknowledge the help and financial support provided by key project of Rashtriya Krishi Vikas Yogna (RKVY), Government of India. References Anderson, J.A., Churchill, G.A., Sutrique, J.E., Tanksley, S.D., Sorrells, M.E. (1993). Optimizing parental selection for genetic linkage maps.Genome,36: 181-186. Dangl, G.S., Yang, J., Golino, D.A., Gradziel, T. (2009). A practical method for almond cultivar identification and parental analysis using simple sequence repeat markers. Euphytica 168: 41-48. Deng, X., Long, S., Dongfeng, H., Xiang, L., Wang, Y.F., Hao, D.M., Qiu, C.S., Chen, X.B. (2011). Isolation and characterization of polymorphic microsatellite markers from flax. African J. of Biotech., 10(5): 734-739. Edwards, J.D., McCouch, S.R. (2007). Molecular markers for use in plant molecular breeding and germplasm evaluation. In: Marker assisted selection- Current status and future perspectives in crops, livestock, forestry and fish. FAO, UN, Rome. pp: 29–50. Kalaichelvan, C. (2009). Studies on identification of rice (Oryza sativa L.) cultivars using morphological and molecular markers. M.Sc thesis, Acharya N G Ranga Agricultural University, Rajendranagar, Hyderabad Pp: 25-63. Kang, H.W., Yong, G.C., Ung-han Y., Moo, Y.E. (1998). A Rapid DNA Extraction Method for RFLP and PCR Analysis from a Single DrySeed. Plant Mol. Biol. Rep., 16: 1-9. Keshavulu, K. (2006). Identification of microsatellite markers for distinguishing elite fine grain rice varieties and hybrids and their utilization in seed purity assessments. Ph.D. thesis, Tamil Nadu Agricultural University, Coimbatore. Lu, J.Y., Zhang, W.L., Xue, H., Pan, Y., Zhang, C.H., He, X.H., Liu, M. (2010). Changes in AFLP and SSR DNA polymorphisms induced by short-term space flight of rice seeds. Biol Plantarum, 54(1): 112-116. Mao, C.X., Virmani, S.S., Kumar, I. (1996). Technological innovations to lower the costs of hybrid rice seed production. In Virmani SS et al (eds) Advances in hybrid rice technology. Proceedings of Third International Symposium on Hybrid rice, Directorate of Rice Research, Hyderabad, India. McCouch, S.R., Chen, X., Panaud, O., Temnykh, S., Xu, Y., Cho, Y.G., Huang, N., Ishii, T., Blair, M. (1997). Microsatellite marker development, mapping and applications in rice genetics and breeding. Plant Molecular Biology, 35: 89-99. McCouch, S.R., Teytelman, L., Xu, Y., Lobos, K.B., Clare, K., Walton, M., Fu, B., Maghirang, R., Li, Z., Xing, Y., Zhang, Q., Kono, Z., Yano, M., Fjellstrom, R., Declerck, G., Schneider, D., Cartinhour, S.D., Ware, D., Stein, L. (2002). Development and Mapping of 2240 New SSR Markers for Rice (Oryza Sativa L.). DNA Res., 9: 199207. Millam, S., Obert, B., Pretova, A. (2005). Plant cell and biotechnology studies in Linum usitatissimum (A Review). Plant Cell Tissue Organ Cult., 82: 93-103. Mishra, B., Viraktamath, B.C., Ilyas-Ahmed, M., Ramesha, M.S., Vijayakumar, C.H.M. (2003). Hybrid rice research and development in India. In: Virmani SS, Mao CX, Hardy B (eds) Hybrid rice for food security, poveryallevation, and environmental protection. Proceedings of the 4th International Symposium on Hybrid Rice, 14-17 May 2002, Hanoi, Vietnam Los Banos (Philippines): International Rice Research Institute, pp 265283. Nagaoka, T., Ogihara, Y. (1997). Applicability of inter-simple sequence repeat polymorphisms in wheat for use as DNA markers in comparison to RFLP and RAPD markers. TheorAppl Genet., 94: 597-602. Nandakumar, N., Singh, A.K., Sharma, R.K., Mohapatra, T., Prabhu, K.V., Zaman, F.U. (2004). Molecular fingerprinting of hybrids and assessment of genetic purity of hybrid seeds in rice using microsatellite markers. Euphytica, 136: 257-264 Rafalski, J.A., Vogel, J.M., Morgnate, M., Powell, W., Andre, C., Tingey, S.V. (1996). Generating and using DNA markers in plants. In: Birren B and Lai E (eds) Analysis of non-mammalian genomes- Apractical guide. Academic press, New York, pp 75-134. Rampant, O.F., Bruschi, G., Abbruscato, P., Cavigiolo, S., Picco, A.M., Borgo, L., Lupotto, E., Piffanelli, P. (2011). Assessment of genetic diversity in Italian rice germplasm related to agronomic traits and blast resistance (Magnaporthe oryzae). Mol Breeding, 27: 233-246. Rohlf, F.J. (2000). NTSYS-pc: Numerical taxonomy and multivariate analysis system, version 2.10e. Exeter Publications, New York.

142


Salimah, S.S., De Oliveira, A.C., Godwin, I.D. (1995). Assessment of genomic origin and genetic diversity in the genus Eleusine with DNA markers.Genomics, 38: 757-763. Sundaram, R.M., Naveenkumar, B., Biradar, S.K., Balachandran, S.M., Mishra, B., Ilyas Ahmed, M., Viraktamath, B.C., Ramesha, M.S., Sharma, N.P. (2008). Identification of informative SSR markers capable of distinguishing hybrid rice parental lines and their utilization in seed purity assessment. Euphytica, 163: 215-224. Thomson, M.J., Septiningsih, E.M., Suwardjo, F., Santoso, T.J., Silitonga, T.S., McCouch, S.R. (2007). Genetic diversity analysis of traditional and improved Indonesian rice (Oryza sativa L.) germplasm using microsatellite markers. TheorAppl Genet.,114: 559-568 UPOV. (1997). Working group on biochemical and molecular techniques and DNA profiling in particular document BMT/4/21 – Fourth session – Cambridge. UK., UPOV, Geneva. Yashitola, J., Thirumurugan, T., Sundaram, R.M., Naseerullah, M.K., Ramesh, M.S., Sharma, N.P., Sonti, R.V. (2002). Assessment of purity of rice hybrids using microsatellite and STS markers. Crop Sci., 42: 1369-1373. Ye-Yun, X., Zhan, Z., Yi-Ping, X., Long-Ping, Y. (2005). Identification and purity test of super hybrid rice with SSR molecular markers. Rice Sci., 12(1) 7-12.

RECENT TREND OF MONSOON RAINFALL IN THE DRY LAND ZONE OF WEST BENGAL AND ITS IMPACT ON AGRICULTURE Asutosh Goswami Faculty, P.G. Department of Geography, Bhairab Ganguly College

T

he western tract of west Bengal is generally identified as the most backward and under developed region of the state. After 68 years of independence, adverse climatic condition, land form and soil condition are generally identified as the main reasons of under development. If we consider the average per capita income, the ratio of the persons living below the poverty level to the total population, the production and productivity per hectare, cropping intensity, current fallow land, the sign of backwardness is everywhere. According to the criteria followed by the India Meteorological Department, this region cannot be termed as the drought prone. But the dryness of the region is the hard reality. Average annual rainfall of this region is 1446.4 mm which varies from 1218.8 mm at Burrabazar in Purulia to 1704.0 mm at Pingla in Paschim Medinipure (Mishra, S., 2012). The adverse climatic condition of this region generally satisfies the following points: 1) So called very low rainfall 2) Drought proneness 3) Extremity of weather and climate 4) Unfavourable climate for agriculture. Monsoon is the main feature of weather and climate in West Bengal. The major objective of the study is to find out the trend and variation of rainfall during first, second and mid monsoon period and rescheduling of crop calendar accordingly. To mitigate the negative impact of changing character of monsoon we must synchronize the cycle of weather with the normal weather requirement of crops during its life cycle. In the frequent changing rainfall condition the long duration variety of crops should be substituted by medium and short duration variety. Objectives: The study has been initiated to fulfill the following objectives: 1. To find out the trend of rainfall of the area. 2. To reveal the impact of variable rainfall characteristics on agriculture of the area. 3. To identify the need of effective use of available water. 4. To identify rainfall variability of the area during June, July, August and September which are basically the monsoon months Materials and Methods The study is based on both secondary as well as primary sources of data. Relevant data have collected through field survey and published literature. The preliminary knowledge about the study area has been collected from district gazetteers. Relevant data regarding the study area has been collected from published literatures in the form of books and journals. For the purpose of identifying the trend of monsoonal rainfall, 40 years (1971-2010) data of rainfall have been collected from Agricultural Meteorology Division of the State Agriculture Department, Government of West Bengal and India Meteorological Department, Alipur. To prepare water budget of the study area, the data of potential evapotranspiration has been collected from India Meteorological Department, Alipur. A number of statistical techniques have been employed to identify the recent trend of monsoon rainfall. Moving average and semi average method have been applied to identify the trend of rainfall during June, July, August and September (monsoon months). STUDY AREA The western tract of West Bengal, extending between 21°47’N-24⁰15’N and 85°49’E-88°2’E covers 32% of the total area of the State. It actually spreads over 99 CD blocks located in 13 sub-divisions of 5 districts viz- Purulia, Bankura, Birbhum, Asansol and Durgapur sub-division of Barddhaman and Paschim Medinipure excluding Ghatal sub-division. But for the present study, three districts have been selected namely Purulia, Bankura and Paschim Medinipure.

144


LOCATION MAP OF THE STUDY AREA

Mile

Purulia

Bankura

Paschim Medinipure

Analysis Part of the Study Trend of Rainfall from June to September (1971-2010)

Trend of Rainfall in the Month of June (1971-2010)

Trend of Rainfall in the Month of July (1971-2010)

Recent Trend of Monsoon Rainfall in the Dry Land Zone of West Bengal………….

145

Trend of Rainfall in the Month of August (1971-2010)

Trend of Rainfall in the Month of September (1971-2010)

Trend of Rainy Days (1971-2010)

Results and Discussion District: Purulia Observation Rainfall (mm) Rainy days

1st half of monsoon Moderate increase Marginal increase

2nd half of monsoon Moderate decrease No appreciable change

Mid monsoon Marginal decrease Marginal decrease

Total monsoon Marginal decrease

1st half of monsoon Moderate increase

2nd half of monsoon Moderate decrease

Mid monsoon Marginal decrease

No appreciable change

Marginal increase



Total monsoon Marginal increase Marginal increase

June

July

August

September

No significant change No significant change

Marginal increase Marginal increase

Moderate decline No significant change

Marginal increase No significant change

June

July

August

September

Marginal increase

No significant change

Moderate decline





District: Bankura Observation Rainfall (mm) Rainy days

District: Paschim Medinipure Observation Rainfall(mm) Rainy days

Total monsoon Marginal increase Marginal increase

1st half of monsoon Moderate increase Marginal increase

2nd half of monsoon Moderate decrease No appreciable change

Mid monsoon

June

July

August

September

Marginal decrease Marginal increase


Marginal increase Marginal increase

Moderate decline No significant change

Marginal increase No significant change

Impact on Agriculture: The dry land zone or the western tract of West Bengal is entirely dependent on the monsoon rainfall for the agricultural activities like the entire state. The decline of rainfall during the mid monsoon period is very much harmful for the standing crops. In some cases abnormally low rainfall during June hampers the progress of seed bed preparation. If the rainfall during first half of monsoon is not sufficient then the farmer will go for dry seed bed preparation. Sufficient rainfall during mid monsoon period is congenial for the cultivation of kharif crops in the state. But all the aforesaid districts show the declining trend of rainfall during August which is basically a mid monsoon period. Low rainfall during August causes serious setback in the progress of transplantation of Aman paddy. Fortunately in the month of September there is no significant change

146


of rainfall in the dry land zone of west Bengal. Though the western tract is not suitable for rice cultivation throughout the year but this area is suitable for cotton cultivation due to some favourable environmental conditions. With the introduction of proper agro-climatic techniques the high quality cotton production can be achieved. The prospect of cotton cultivation is practically insignificant compared to the other states of the country. There are some favourable conditions which are mainly responsible for the proper cotton cultivation in the state. 1. Physiographically the region is the zone of transition between eastern fringe of Chhota Nagpur Plateau to the west and lower Ganga plain to the east. This region is mainly characterized by undulating topography which does not allow the water logging condition. Soils are the red and lateritic with old alluvium. This soil is very much helpful for the cotton cultivation in this district 2. Average annual rainfall of the district is 1321.9 mm which varies from 1218.8 mm at Burrabazar in the south western part to 1426.6 mm at Bagmundi on the foot of Ajodhya Pahar which comes in between 68 and 79 rainy days. This sufficient amount of rainfall is suitable to achieve the desired level of cotton cultivation. 3. Purulia enjoys a more or less favourable temperature regime for successful cotton cultivation from June to November. The temperature remains 40⁰c during the time of pre monsoon but the temperature declines with the introduction of the monsoon. During the time of October the region enjoys large diurnal range of temperature which is very much helpful for cotton cultivation. Average daily bright sunshine hours of about 7-8 hours per day during October are also very much helpful for cotton cultivation. Water Budget: Like the other parts of the country as well as the state, the western tract comes under the grip of south west monsoon rainfall. This region receives 75 to 85% of the normal rainfall during the south west monsoon season from June to September. This region receives 3%, 12% and 8-9% of the total rainfall during winter (December-February), summer (March-May) and post monsoon (October-November) respectively. If we consider rainfall as the water income and potential evapotranspiration as the water loss, we find that 500-800 mm of rainfall after satisfying the evaporation need goes mainly in the form of surface run off. If a major portion of this amount of surface run off is arrested, the problem of water scarcity will be solved to a considerable extent. Conclusion: In the dry land zone of West Bengal drought is a regular phenomena. But as per the criteria followed by India Meteorological Department, this zone cannot be designated as the drought prone area. But the region is dry due to its undulating terrain, which results speedy runoff coupled with coarse grained soil with very little moisture holding capacity, making the top soil dry very soon. If a major portion of this amount of surface runoff is arrested, the problem of water scarcity will be solved to a considerable extend (Mishra, S., 2012). A few more suggestions for water conservation and drought management in this region are as follows: (1) Plot to plot runoff control, (2) Water conservation in plots, (3) Creation of small reservoir. Acknowledgement: The author is grateful to Agricultural Meteorology Division of the State Agriculture Department, Government of West Bengal and India Meteorological Department, Alipur. The author would also like to offer his deepest sense of gratitude to Dr. Ashis Kr. Paul (Professor, Dept. of Geography, Vidyasagar University), Dr. Swadesh Mishra (Former Agro-Meteorologist, Govt. of West Bengal) and Dr. Asitendu Roychoudhury (Associate Professor, Dept. of Geography, Bhairab Ganguly College) for giving valuable suggestions, guidance and supervision during his entire field study. References India Meteorological Department. (1970). Agri-Met. Technical Circular No. 17. Meteorological Data Handbooks. (2003-2012). India Meteorological Department, Government of India, Alipur. Mishra, S. (2006). Deposition of Dew and Its Measurement in West Bengal, Landscape Systems, Vol.27, no. 1, Kolkata, pp. 21-30. Mishra, S. (2006). Deposition of Dew and Its Measurement in West Bengal, Landscape Systems, Vol.27, no. 1, Kolkata, pp. 21-30. Mishra, S. (2012). Drought and Its Management in West Bengal, Indian Journal of Landscape and Ecological Studies, Vol.35, no. 1, Kolkata, pp. 20-28.

POTENTIALITY, ROLE AND CONSTRAINTS OF BIO-FERTILIZERS IN SUSTAINING AGRICULTURE PRODUCTION Abhishek Singh, Sudhanshu Verma, Sandeep Kumar, V. K. Verma, Uppu Sai Sravan Department of Agronomy, Institute of Agricultural sciences, Banaras Hindu University, Varanasi, India, 221005, E-mail: [email protected], Corresponding Author: Abhishek Singh

I

ndiscriminate use of synthetic fertilizers has led to the pollution and contamination of the soil, has polluted water basins, destroyed micro-organisms and friendly insects, making the crop more prone to diseases and reduced soil fertility. • Demand is much higher than the availability. It is estimated that by 2020, to achieve the targeted production of 321 million tonnes of food grain, the requirement of nutrient will be 28.8 million tonnes, while their availability will be only 21.6 million tones being a deficit of about 7.2 million tones. • Depleting feedstock/fossil fuels (energy crisis) and increasing cost of fertilizers. This is becoming unaffordable by small and marginal farmers. • Depleting soil fertility due to widening gap between nutrient removal and supplies. • Growing concern about environmental hazards. • Increasing threat to sustainable agriculture. Besides above facts, the long term use of bio-fertilizers is economical, eco-friendly, more efficient, productive and accessible to marginal and small farmers over chemical fertilizers. Potential Characteristic Features of Some Bio-fertilizers Nitrogen Fixers Rhizobium: belongs to family Rhizobiaceae, symbiotic in nature, fix nitrogen 50-100 kg ha-1 with legumes only. It is useful for pulse legumes like chickpea, red-gram, pea, lentil, black gram, etc., oilseed legumes like soybean and groundnut and forage legumes like berseem and lucerne. Successful nodulation of leguminous crops by Rhizobium largely depends on the availability of compatible strain for a particular legume. It colonizes the roots of specific legumes to form tumor like growths called root nodules, which acts as factories of ammonia production. Rhizobium has ability to fix atmospheric nitrogen in symbiotic association with legumes and certain nonlegumes like Parasponia. Rhizobium population in the soil depends on the presence of legume crops in the field. In absence of legumes, the population decreases. Artificial seed inoculation is often needed to restore the population of effective strains of the Rhizobium near the rhizosphere to hasten N-fixation. Each legume requires a specific species of Rhozobium to form effective nodules. Many legumes may be nodulated by diverse strains of Rhizobia, but growth is enhanced only when nodules are produced by effective strains of Rhizobia. It is thus extremely important to match microsymbionts prudently for maximum nitrogen fixation. A strain of Rhizobia that nodulates and fixes a large amount of nitrogen in association with one legume species may also do the same in association with certain other legume species. This must be verified by testing. Leguminous plants that demonstrate this tendency to respond similarly to particular strains of Rhizobia are considered “effectiveness” group (Wani and Lee 2002). Azospirillum: belongs to family Spirilaceae, heterotrophic and associative in nature. In addition to their nitrogen fixing ability of about 20-40 kg ha-1, they also produce growth regulating substances. Although there are many species under this genus like, A.amazonense, A.halopraeferens, A.brasilense, but, worldwide distribution and benefits of inoculation have been proved mainly with the A.lipoferumand A.brasilense. The Azospirillum form associative symbiosis with many plants particularly with those having the C4-dicarboxyliac path way of photosynthesis (Hatch and Slack pathway), because they grow and fix nitrogen on salts of organic acids such as malic, aspartic acid (Arun, 2007). Thus it is mainly recommended for maize, sugarcane, sorghum, pearl millet etc. The Azotobacter colonizing the roots not only remains on the root surface but also a sizable proportion of them penetrates into the root tissues and lives in harmony with the plants. They do not, however, produce any visible nodules or out growth on root tissue. Azotobacter: belongs to family Azotobacteriaceae, aerobic, free living, and heterotrophic in nature. Azotobacters are present in neutral or alkaline soils and A.chroococcum is the most commonly occurring species in arable soils. A. vinelandii, A. beijerinckii, A. insignis and A. macrocytogenes are

148


other reported species. The number of Azotobacter rarely exceeds of 104 to 105 g-1 of soil due to lack of organic matter and presence of antagonistic microorganisms in soil. The bacterium produces antifungal antibiotics which inhibits the growth of several pathogenic fungi in the root region there by preventing seedling mortality to a certain extent (Subba Rao, 2001a). The isolated culture of Azotobacter fixes about 10 mg nitrogen g-1 of carbon source under in vitro conditions. Azotobacter also to known to synthesize biologically active growth promoting substances such as vitamins of Bgroup, indole acetic acid (IAA) and gibberellins. Fusarium, Alternariaand Helminthosporium. The population of Azotobacter is generally low in the rhizosphere of the many strains of Azotobacter also exhibited fungi static properties against plant pathogens such as crop plants and in uncultivated soils. The occurrence of this organism has been reported from the rhizosphere of a number of crop plants such as rice, maize, sugarcane, bajra, vegetables and plantation crops (Arun, 2007). Blue Green Algae (Cyanobacteria) and Azolla: These belongs to eight different families, phototrophic in nature and produce Auxin, Indole acetic acid and Gibberllic acid, fix 20-30 kg N ha-1 in submerged rice fields as they are abundant in paddy, so also referred as ‘paddy organisms’. N is the key input required in large quantities for low land rice production. Soil N and BNF by associated organisms are major sources of N for low land rice. The 50-60% N requirement is met through the combination of mineralization of soil organic N and BNF by free living and rice plant associated bacteria (Roger and Ladha, 1992). To achieve food security through sustainable agriculture, the requirement for fixed nitrogen must beincreasingly met by BNF rather than by industrial nitrogen fixation. Most N fixing BGA are filamentous, consisting of chain of vegetative cells including specialized cells called heterocyst which function as micro nodule for synthesis and N fixing machinery. BGA forms symbiotic association capable of fixing nitrogen with fungi, liverworts, ferns and flowering plants, but the most common symbiotic association has been found between a free floating aquatic fern, the Azolla and Anabaena azollae (BGA). Azolla contains 4-5% N on dry basis and 0.2-0.4% on wet basis and can be the potential source of organic manure and nitrogen in rice production. The important factor in using Azolla as bio-fertilizer for rice crop is its quick decomposition in the soil and efficient availability of its nitrogen to rice plants (Kannaiyan, 1990). Besides N-fixation, these bio-fertilizers or biomanures also contribute significant amounts of P, K, S, Zn, Fe, Mb and other micronutrient. The fern forms a green mat over water with a branched stem, deeply bilobed leaves and roots. The dorsal fleshy lobe of the leaf contains the algal symbiont within the central cavity. Azolla can be applied as green manure by incorporating in the fields prior to rice planting. The most common species occurring in India is A. pinnata and same can be propagated on commercial scale by vegetative means. It may yield on average about 1.5 kg per square meter in a week. India has recently introduced some species of Azolla for their large biomass production, which are A.caroliniana, A. microphylla, A. filiculoidesand A. mexicana. Phosphate Solubilizers: Several reports have examined the ability of different bacterial species to solubilize insoluble inorganic phosphate compounds, such as tricalcium phosphate, dicalcium phosphate, hydroxyapatite, and rock phosphate. Among the bacterial genera with this capacity are pseudomonas, Bacillus, Rhizobium, Burkholderia, Achromobacter, Agrobacterium, Microccocus, Aereobacter, FlavobacteriumandErwinia. There are considerable populations of phosphatesolubilizing bacteria in soil and in plant rhizospheres. These include both aerobic and anaerobic strains, with a prevalence of aerobic strains in submerged soils. A considerably higher concentration of phosphate solubilizing bacteria is commonly found in the rhizosphere in comparison withnon rhizosphere soil (Raghu and Macrae, 2000). The soil bacteria belonging to the genera Pseudomonas and Bacillus and Fungi are more common. The major microbiological means by which insoluble-P compounds are mobilized by the production of organic acids, accompanied by acidification of the medium. The organic and inorganic acids convert tricalcium phosphate to di- and monobasic phosphates with the net result of an enhanced availability of the element to the plant. The type of organic acid produced and their amounts differ with different organisms. Tri- and dicarboxylic acids are more effective as compared to mono basic and aromatic acids. Aliphatic acids are also found to be more effective in Psolubilization compared to phenolic, citric and fumaric acids. The analysis of culture filtrates of PSMs has shown the presence of number of organic acids including citric, fumaric, lactic, 2-ketogluconic, gluconic, glyoxylic and ketobutyric acids.

Potentiality, Role and Constraints of Bio-Fertilizers in Sustaining Agriculture Production

149

Phosphate Absorbers Mycorrhiza (An Ancient Symbiosis in Organic Agriculture): The term Mycorrhiza denotes “fungus roots”. It is a symbiotic association between host plants and certain group of fungi at the root system, in which the fungal partner is benefited by obtaining its carbon requirements from the photosynthates of the host and the host in turn is benefited by obtaining the much needed nutrientsespecially phosphorus, calcium, copper, zinc etc., which are otherwise inaccessible to it, with the help of the fine absorbing hyphae of the fungus. These fungi are associated with majority of agricultural crops, except with those crops/plants belonging to families of Chenopodiaceae, Amaranthaceae, Caryophyllaceae, Polygonaceae, Brassicaceae, Commelinaceae,Juncaceae and Cyperaceae. They are ubiquitous in geographic distribution occurring with plants growing in artic, temperate and tropical regions alike. VAM occur over a broad ecological range from aquatic to desert environments. Of 150 species of fungi that have been described in order Glomales of class Zygomycetes, only small proportions arepresumed to be mycorrhizal. There are sixgenera of fungi that contain species, whichare known to produce Arbuscularmycorrhizalfungi (AMF) with plants. Two of these genera, Glomus and Sclerocytis produce chlamydospores only. Four genera form spores that are similar to azygospores: Gigaspora,Scutellospora, Acaulospora and Entrophospora. The oldest and most prevalent of these associations are the arbuscularmycorrhizal (AM) symbioses that first evolved 400 million years ago, coinciding with the appearance of the first land plants. Crop domestication, in comparison, is a relatively recent event, beginning 10, 000 years ago. Zinc Solubilizers: The nitrogen fixers like Rhizobium, Azospirillum,Azotobacter, BGA and Phosphate solubilizing bacteria like B. magaterium, Pseudomonas striata, and phosphate mobilizing Mycorrhiza have been widely accepted as bio-fertilizers (SubbaRoa, 2001). However these supply only major nutrients but a host of microorganism that can transform micronutrients are there in soil that can be used as bio-fertilizers to supply micronutrients like zinc, iron, copper etc., zinc being utmost important is found in the earth’s crust to the tune of 0.008 per cent but more than 50 per cent of Indian soils exhibit deficiency of zinc with content must below the critical level of 1.5 ppm of available zinc. The plant constraints in absorbing zinc from the soilare overcome by external application of soluble zinc sulphate (ZnSO4). But the fate of applied zinc in the submerged soil conditions is pathetic and only 1-4% of total available zinc is utilized by the crop and 75% of applied zinc is transformed into different mineral fractions (Zn-fixation) which are not available for plant absorption (crystalline iron oxide bound and residual zinc). There appears to be two main mechanisms of zinc fixation, one operates in acidic soils and is closely related with cat ion exchange and other operates in alkaline conditions where fixation takes by means of chemisorptions, ( chemisorptions of zinc on calcium carbonate formed a solid-solution of ZnCaCO3) and bycomplexation by organic ligands (Alloway, 2008). The zinc can be solubilized by microorganismsviz., B. subtilis, Thiobacillusthioxidans and Saccharomyces sp. These microorganisms can be used as bio-fertilizers for solubilization of fixed micronutrients like zinc. The results have shown that a Bacillus sp. (Zn solubilizing bacteria) can be used as bio-fertilizer for zinc or in soils where native zinc is higher or in conjunction with insoluble cheaper zinc compounds like zinc oxide (ZnO), zinc carbonate (ZnCO3) and zinc sulphide (ZnS) instead of costly zinc sulphate (Mahdi et al., 2010). Potential Role of Bio-fertilizers in Agriculture Nitrogen-fixers (NF) and Phosphate Solubilizers (PSBs): The incorporation of bio-fertilizers (Nfixers) plays major role in improving soil fertility, yield attributing characters and thereby final yield has been increased. In addition, their application in soil improves soil biota and minimizes the sole use of chemical fertilizers. Under temperate conditions, inoculation of Rhizobium increases yield of legume crops. In rice under low land conditions, the application of BGA + Azospirillum maximizes profits. Grain yield and harvest index also exhibit a discernable increase with use of bio-fertilizers. It has demonstrated that under certain environmental and soil conditions,inoculation with Azotobacteria has beneficialeffects on plant yields. Inoculation with Azotobacter + Rhizobium + VAM gave the highest increase in straw and grain yield of wheat with rock phosphate as a Pfertilizer (Fares, 1997). It is an established fact that the efficiencyof phosphatic fertilizers is very low (15-20%)due to its fixation in acidic and alkaline soils and unfortunately both soil types are predominating in India accounting more than 34% acidity affected and more than seven million hectares of productive land salinity/alkaline affected. Therefore, the inoculations with PSB and other useful microbial inoculants in these soils become mandatory to restore and maintain the effective microbial populations for

150


solubilization of chemically fixed phosphorus and availability of other macro and micronutrients to harvest good sustainable yield of various crops. Commercial exploitation of phosphaticmicrobial inoculants can play an important role particularly in making the direct use of abundantly available low grade phosphatepossible. Among the bacterial genera with this capacity are pseudomonas, Bacillus, Rhizobium, Burkholderia, Achromobacter, Agrobacterium, Microccocus, Aereobacter, FlavobacteriumandErwinia. Beside N-fixation and P-solubilization, the incorporation of nitrogen fixing bacteria (Azotobacter spp.) under the commercial name ‘cerealien’ and phosphate dissolving bacteria (Bacillus megaterium) ‘phosphorien’ has shown the highest degree in inducing the degree of the physiological tolerance to salinity which enables the stressed plants of the Seets cultivar of wheat to be adapted and keep better performance against all applied levels of salinity (3000, 6000 and 9000 ppm). Improved Nutrient Uptake (Macro and Micronutrients): The improvement ofP nutrition of plants has been the most recognized beneficial effect of mycorrhiza. The mechanism that is generally accepted for this mycorrhizal roleconsist of a wider physical exploration of the soil by mycorrhizal fungi (hyphae) than by roots. A speculative mechanism to explain P uptake by mycorrhizal fungi involves the production of glomalin. Glomalin contains very substantial amounts of iron. Bolan et al. (1987) had already proposed that mycorrhizal fungi may break the bond between Fe and P, but they did not suggest a mechanism. Further research into the physiological and ecological roles of glomalin is needed to address this question. AM plants have been reported to improve nutrition of the other macronutrients N and K. In acid soils, AM fungi may be important for the uptake of ammonium (NH4+), which is less mobile than nitrate (NO3-) and where diffusion may limit its uptake rate. Although nitrate is much more mobile than ammonium (uptake is regulated through mass flow). Because of their small size, fungal hyphae are better able than plant roots to penetrate decomposing organic material and are therefore better competitors for recently mineralized N (Hodge, 2003). By capturing simple organic nitrogen compounds, AM fungi can short-circuit the N-cycle. It is also reported that the AM- fungi also increases the uptake of K, and concentration of K has been found more in mycorrhizalthan non-mycorrhizal plants (Bressanet al.,2001). Apart from this, the AM-fungi also increases the uptake and efficiency of micronutrients like Zn, Cu, Fe etc. by secreting the enzymes, organic acids which makes fixed macro and micronutrients mobile and as such are available for the plant. Better Water Relation and Drought Tolerance: AM fungi play an important role in the water economy of plants. Their association improves the hydraulic conductivity of theroot at lower soil water potentials and this improvement is one of the factors contributing towards better uptake of waterby plants. Also, leaf wilting after soil drying, did not occur in mycorrhizal plants until soil water potential was considerably lowered (approx. 1.0 M. Pa). Leaflets of Leucaenaplants inoculated with VA mycorrhizae did not wilt at a xylem pressure potential as lowas -2.0 MPa. Mycorrhiza induced droughttolerance can be related to factors associated with AM colonization such as improved leaf water and turgor potentials and maintenance of stomatal functioning and transpiration, greater hydraulic conductivities and increased root length and development. Enhanced Phytohormone Activity: The activity of phytohormones like cytokinin and indole acetic acid is significantly higher in plants inoculated with AM. Higher hormone production results in better growth and development of the plant. Crop Protection (Interaction with Soil Pathogens): AM fungi have the potential to reduce damage caused by soil-borne pathogenic fungi, nematodes, and bacteria. Meta-analysis showed that AM fungi generally decreased the effects of fungal pathogens. A variety of mechanisms have been proposed to explain the protective role of mycorrhizalfungi. A major mechanism is nutritional, because plants with a good phosphorus status are less sensitive to pathogen damage. Non-nutritional mechanisms are also important, becausemycorrhizal and nonmycorrhizalplants with the same internal phosphorus concentration may still be differentially affected by pathogens. Such non-nutritional mechanisms include activation of plant defense systems, changes in exudation patterns and concomitantchanges in mycorrhizospherepopulations, increased lignification of cell walls, and competition for space for colonization and infection sites (Kaisamdaret al., 2001). It is also reported that increased production and activity of phenolic and phytoalexiencompounds with due to AM-inoculation considerably increases the defense mechanism there by imparts the resistance to plants.

Potentiality, Role and Constraints of Bio-Fertilizers in Sustaining Agriculture Production

151

Constraints in Bio-fertilizer Use Production Constraints: Despite significant improvement/ refinement in BF technology over the years, the progress in the field of BF production technology is below satisfaction due to the followings: Unavailability of Appropriate and Efficient Strains: Lack of region specific strains is one of the major constraints as bio-fertilizers are not only crop specific but soil specific too. Moreover, the selected strains should havecompetitive ability over other strains, Nfixingability over a range of environmental conditions, ability to survive in broth and in inoculants carrier. Unavailability of Suitable Carrier: Unavailability of suitable carrier (media in which bacteria are allowed to multiply) due to which shelf life of bio-fertilizers is short is a major constraint. Peat of a good quality (more than 75% carbon) is a rare commodity in India. Nilgiri peat is of poor quality (below 50% carbon). According to the availability and cost at production site, choice is only with lignite and charcoal in India. As per the suitability the order is peat >lignite > charcoal > FYM > soil >rice husk. Good quality carrier must have good moisture holding capacity, free from toxic substances, sterilizable and readily adjustable pH to 6.5-7.0. Under Indian conditions where extremes of soil and weather conditions prevail, there is yet no suitable carrier material identified capable of supporting the growth of bio-fertilizers. Better growth of bacteria is obtained in sterile carrier and the best method is Gamma irradiation ofsterilization (while using autoclave, lime mixed lignite is filled up to two third capacity of steel trays for 1-2 hours for three days and sterilized at 121 0C ) for carrier material. Mutation during Fermentation: Bio-fertilizers tend to mutate during fermentation and thereby raising production and quality control cost. Extensive research work on this aspect is urgently needed to eliminate such undesirable changes. Market Level Constraints Lack of Awareness of Farmers: Inspite of considerable efforts in recent years, majority of farmers in India are not aware of bio-fertilizers, their usefulness in increasing crop yields sustainably. Inadequate and Inexperienced Staff: Because of inadequate staff and that too not technically qualified who can attend to technical problems. Farmers are not given proper instructions about the application aspects. Lack of Quality Assurance: The sale of poor quality bio-fertilizers through corrupt marketing practices results in loss of faith among farmers, to regain the faith once is very difficult and challenging. Seasonal and Un-assured Demand: The bio-fertilizer use is seasonal and both production and distribution is done only in few months of year, as such production units particularly private sectors are not sure of their demand. Liquid Bio-fertilizers (Break through in BF Technology): Liquid bio-fertilizers are special liquid formulation containing not only the desired microorganisms and their nutrients but also special cell protectants or chemicals that promote formation of resting spores or cysts for longer shelf life and tolerance to adverse conditions. (Hegde, 2008). Bio-fertilizers manufactured in India are mostly carrier based and in the carrier-based (solid) bio-fertilizers, the microorganisms have a shelf life of only six months. They are not tolerant to UV rays and temperatures more than 30 0C. The population density of these microbes is only 108 (10 crores) c.f.u. ml-1at the time of production. This count reduces day by day. In the fourth month it reduces to 106 (10 lakhs) c.f.u. ml-1 and at the end of 6 months the count is almost nil. That’s why the carrier-based bio-fertilizers were not effective and did not become popular among the farmers. These defects are rectified and fulfilled in the case of Liquid bio-fertilizers. The shelf life of the microbes in these liquid bio-fertilizers is two years. They are tolerant to high temperatures (55 0C) and ultra violet radiations. The count is as high as 109c.f.u. ml-1, which is maintained constant up to two years. So, the application of 1 ml of liquid bio-fertilizers is equivalent to the application of 1 Kg of 5 months old carrierbased bio-fertilizers (1000 times). Since these are liquid formulations the application in the field is also very simple and easy. They are applied using hand sprayers, power sprayers,fertigation tanks and as basal manure mixed along with FYM etc. References Alloway, B.J. (2008). Zinc in soils and crop nutrition. Second edition, IZA and IFA publishers, Brussels, Belgium and Paris, France. pp.21-22. Arun K.S. (2007). Bio-fertilizers for sustainable agriculture. Mechanism of P-solubilization. Sixth edition, Agribios publishers, Jodhpur, India, pp.196-197.

152


Bolan, N.S., Robson, A.D., Barrow, N.J. (1987). Effects of vesicular–arbuscularmycorrhiza on the availability of iron phosphates to plants. Plant Soil., 99: 401–410. Bressan, W., Siqueira, J.O., Vasconcellos, C.A., Purcino, A.A.C. (2001). Fungosmicorrizicosefosforo, no crescimento, nosteores de nutrientsenaproduçao do sorgo e sojaconsorciados. Pesqui. Agropecu. Bras. 36: 315–323. Fares C.N. (1997). Growth and yield of wheat plant as affected by biofertilisation with associative, symbiotic N2-fixers and endomycorrhizae in the presence of the different P-fertilizers. Ann. Agr. Sci., 42: 51-60. Hegde, S.V. (2008). Liquid bio-fertilizers in Indian agriculture. Bio-fertilizer news letter, pp.17-22. Hodge, A. (2003). Plant nitrogen capture from organic matter as affected by spatial dispersion, interspecific competition and mycorrhizal colonization. New Phytol., 157: 303–314. Kannaiyan, S. (1990). Blue green algae biofertilizers. The biotechnology of biofertilizers for rice crops. (ed) S. Kannaiyan, Tamil Nadu Agric. University publications, Coimbatore, T.N.India.pp.225. Kasiamdari, R.S., Smith, S.E., Smith, F.A., Scott, E.S. (2001). Influence of the mycorrhizal fungus, Glomuscoronatum, and soil phosphorus on infection and disease caused by binucleateRhizoctonia and Rhizoctoniasolani on mung bean (Vignaradiata). Plant Soil, 238: 235–244. Mahdi, S.S., Dar, S. A., Ahmad, S. & Hassan, G.I. (2010). Zinc availability- A major issue in agriculture. Research Journal Agricultural Sciences, 3(3): 78-79. Raghu, K. & Macrae, I.C. (2000). Occurrence ofphosphate-dissolving microorganisms in therhizosphere of rice Plants and in submergedsoils. J. Appl. Bacteriol, 29: 582–6. Roger, P.A.&Ladha J.K. (1992). Biological N2 fixation in wetland rice fields: estimation andcontribution to nitrogen balance. Plant Soil, 141: 41-5. Subba Roa, N.S. (2001). An appraisal of biofertilizers in India. The biotechnology of biofertilizers,(ed.) S.Kannaiyan, Narosa Pub. House, New Delhi (in press). Wani, S.P. & Lee, K.K. (1995). Microorganisms as biological inputs for sustainable agriculture in Organic Agriculture (Thampan, P.K.ed.) Peekay Tree Crops Development Foundation, Cochin, India. pp-39-76.

WATER BALANCE AND MOISTURE ADEQUACY REGION OF EASTERN UTTAR PRADESH Anamika Singh1 and B. N. Singh2 1

2

Post Doctoral Fellow, Professor, Department of Geography, Banaras Hindu University, Varanasi-221005 E-mail: [email protected], Corresponding Author: Anamika Singh

W

eather and climate are the integral parts of the agricultural production system that are reflected in the dependence of the economy and food grain output on monsoon activity year after year. Weather is an important component not only for crop production but also for horticultural crops, livestocks, fisheries, forestry and other areas such as transport, storage and marketing of agricultural products (IMD Vision, 2030). Probably, agriculture is the most weather dependent economic activity of all human occupation in the entire world. For the growth and development of vegetation, heat and moisture are the two most important requirements in which moisture is a major limiting factor for successful agricultural (Subrahmaniam and Keshvarao, 1982). In agro-climatic studies water balance is a key factor to evaluate the amount of continual interchange of water between root zones of soil to the atmosphere. The interdependence and continuous movement of all forms of water provide the basis for the concept of hydrological cycle. (Singh, 1977). In this context the numerical estimate of hydrological cycle in time and space leads to the concept of water balance. The term water balance means the accounting of all water in all its various forms and states at a particular place. (Mather,1974). The process water balance may be expressed as a long term balance of water and moisture relationship over an area. The precipitation and temperature are the two main factors which are essential for biological needs as well as plant growth. It is earlier demonstrated by ecologists that when the thermal conditions are optimal and invariant, other aspects being the same, there is a direct relationship between vegetation development and precipitation effectivity. (Subrahmanyam,1983). In this process when the water reaches on the land surface through rainfall, part of it diverted as runoff, soon after the soils are saturated and the infiltered rain water returned in the upper layer of the soil atmosphere which is utilized for vegetation or crop growth.(Sharma and Lakshmikumar,2006). Temperature is the another climatic element which plays a major role in the circulation of water in atmosphere. Solar radiation as a major source of atmospheric temperature significantly affects the magnitude of soil temperature. Amount of radiation determine the extent of evaporation, soil temperature as well as soil moisture. So the availability of moisture in the root zone of soil increases by rainfall and decreases by evapotranspiration. The accurate climatic information of a particular area helps to determine suitable cropping pattern for better crop yields to secure food security for people (Singh and Singh,2011). Therefore, in Agroclimatological studies a clear understanding about the spatio-temporal occurrence and distribution of precipitation (water supply), actual evapotranspiration (the amount of water that actually evaporates and transpires), potential evapotranspiration (water need), the water deficiency (water requirements) and water surplus (irrigation potential) are required for various agricultural operations. The Knowledge of water balance elements in space and time is essential not only for the hydrological processes but also to the agricultural practices. In farming practices it provides information of water requirement for crops and vegetations as well as the water availability for the crop plant uses. It also provides knowledge about the assessment of supplementary irrigation for the standing crops. In recent years the growing demand of water in various sectors of economy for different purposes has drawn much attention of the scientist of many disciplines like applied climatology, agronomy, hydrology, industries, water management, geophysics etc to make better use of this precious resource for welfare of the human being. Specially, in agro-climatic studies a clear understanding of water balance parameters has become an important consideration. Moisture Adequacy Index provides the exact information of moisture status in soils during wet and dry season in the region. Such type of information gives a better idea to determination of cropping pattern. . Thus Ima might be useful indicator for irrigation planning in the study of agriculture droughts and land use planning in applied climatology.

154


Therefore in the present study an attempt has been made to evaluate water balance parameters on the basis of tables and monograms presented by Thornthwaite’s and Mather (1955) and then by using the ratio of PE/AE, Moisture Adequacy Index (Ima) haven calculated for different meteorological stations of Eastern Uttar Pradesh. Study Area: Eastern Utter Pradesh is situated in a sub-tropical interior of well defined geographical region of the middle Ganga Plain having sub-recent deposition of Pleistocene period. It is one of the largest stretches of alluvial deposits of northern India. Eastern Uttar Pradesh occupies somewhat continental location and lies between 23 0 45’ N to 28030’ N latitudes and 80 0 45’ E to 84046’ E longitudes. It covers an area of 85845 km 2 which is 27.6 % of the total geographical area of Uttar Pradesh. The region is bounded by the international boundary of Nepal in the north while Bihar and Jharkhand state delineates its eastern boundary. Usually 100m contour delineates its western boundary as a dividing line between western and middle Gangetic plain. In the Study area there are 12 meteorological stations recognized by India Meteorological Department, located at different altitude and latitude Fig.1

Fig.1 Data Sources and Methodology: The required data of climatic elements like rainfall, temperature, were obtained from the Director, IMD, Pune for the period of 25-30 years for all the twelve meteorological stations on request. Some other important informations were collected through online published research papers and journals. The modified scheme of Thornthwaite and Mather (1955) have applied for computation of various water balance parameters like PE, AE, WS, and WD. The Ima values have

Water Balance and Moisture Adequacy Region of Eastern Uttar Pradesh

155

computed taking the ratio of AET and PET as suggested by J. O. Ayoade (1972) and V.P. Subramanyam (1983). Evaluation of Water Balance Parameters in Eastern Uttar Pradesh: The water balance gives a good insight of ecologically sensitive parameters. It provides useful information about the existing moisture condition of an area. The water balance parameters for 12 meteorological stations have been calculated according to the revised scheme of Thornthwaite and Mather (1955, 1957). Figures 2.1, 2.2 and 2.3 represents the graphical representations of different water balance elements like PE, AE, WD and WS for all the 12 stations .These graphs depict the monthly variation and nature of water balance components of each station. The amount of PE rapidly rises in summer months corresponding to rise in temperature thus May is marked by its highest amount. While it begins gradually to decrease in rainy months. These values observed lowest in winter months due to low temperature. AE is closely related to the water supply through soil moisture and precipitation received. When P exceeds PE it equals to PE, when moisture deficiency occurs P drops below to PE. Excepting four excess rainfall months remaining months of the year are covered by a period of SMU and WD. The highest water deficiency occurs in summer months. The largest amount of WD is observed at Allahabad, Jaunpur, Pipri and Ballia districts in the region. These two components of water balance observed at the beginning of pre and post monsoon months and even in winter months. At the beginning of rainy season rainfall initially recharges the soil moisture. When the soil has been fully saturated and reached at its field capacity due to abundant moisture supply, any excess water emerged as surplus. Usually the water surplus is found in the last two monsoon months of August and September almost at all the stations. The monsoon surplus at Bahraich, Gonda, Gorakhpur, Faizabad and Varanasi is greater than the other stations. Allahabad station significantly shows no any surplus of water in the entire region.

Figure-2.1

Figure-2.2

Figure-2.3

Areal Distribution of Water Balance Parameters 1. Potential Evapotranspiration: As discussed on preceding pages that PE is the amount of water that would evaporate and transpire from a well vegetated surface if soil moisture were always available in

156


sufficient amount for optimum use. Basically it depends on the amount of solar radiation resulting in the form of observed latitudinal temperature and the day length (average number of hours of bright sunshine per day). The values of PE represent the quantity of water required for each month for the losses through optimum evapotranspiration. So the annual and seasonal patterns of PE exhibit a close resemblance to the distribution of temperature. Table 1 represents the monthly and annual distribution of potential evapotranspiration in the region. The average annual PE varies from a maximum of 1661mm at Pipri to a minimum of 1422mm at Ghazipur. Fig 3A shows the annual distribution of PE in the region. The isoline of 1600mm of PE lies over southern part of the region in Sonbhadra district due to high temperature and high vegetal cover. The northern Tarai and Gangapar regions are almost covered by 1500 mm. isolines of PE. The southeastern part of Ghazipur district. Generally, the values of isolines increase towards southern and northern portion according to the corresponding increasing trend of temperature. On an average, the maximum water need is observed in the month of May and the minimum in January. Usually the monthly value starts to increase from February onward until June. Where, after from the monsoon months it begins to decline till the end of winter season. Table 5 represents the seasonal distribution of PE in the region. The average seasonal PE values are highest in SW monsoon season (713mm) because of high temperature, longer day duration and highest vegetal covers. However it is found lowest in winter months due to low temperature. It is clear from the observation that the total PE during monsoon season is much high than winter and post monsoon season even higher than the summer season. The careful observation of seasonal fluctuation of PE values shows that the intensity of solar radiation thus temperature and the length of the days are the major determinants for this kind of seasonal variation. Table 1: Monthly and Annual Potential Evapotranspiration in mm Districts Jan. Feb. Mar. Apr. May Jun. Bahraich 22 40 99 167 200 198 Gonda 22 34 96 167 195 197 Faizabad 19 37 99 167 198 197 Gorakhpur 22 40 102 170 198 197 Sultanpur 17 40 96 170 202 197 Azamgarh 26 40 102 170 195 197 Allahabad 25 43 114 178 207 205 Jaunpur 25 40 114 180 209 207 Ghazipur 24 38 97 165 195 200 Varanasi 25 40 102 172 204 202 Ballia 14 32 90 164 198 194 Pipri 42 67 142 184 211 205 Average E.U.P. 24 41 104 171 201 200

Jul. 191 184 188 188 186 172 193 190 179 186 186 184 186

Aug. 180 176 166 180 178 162 178 178 165 175 176 175 174

Sep. 161 153 143 156 156 145 159 156 147 156 153 159 154

Oct. 135 128 134 137 134 122 137 143 120 134 129 152 134

Nov. 68 65 65 76 68 68 71 85 67 68 66 90 71

Dec. 32 27 27 32 25 27 33 36 25 30 25 50 31

Annual 1493 1444 1440 1498 1469 1426 1543 1563 1422 1494 1427 1661 1490

2. Actual Evapotranspiration: Actual evapotranspiration is the most important water balance parameter which may be expressed as the actual amount of water lost to the atmosphere under the existing climatic condition and moisture stored in the soil. It is directly related to the available moisture supply and indirectly dependent upon such factors like soil types, soil field capacity, nature and distribution of plant cover and method of land cultivation (Sharma, 1974) Actual water loss from soil surface and vegetation is closely related to the type, density and maturity of existing vegetation, the soil storage and amount of P at a particular area. Ferguson (1965) observed that it is that it is positively correlated with rainfall. So its distribution is highly controled by the amount of rainfall in the region. Table 2 and Fig 3B reveals the monthly and annual distribution of AE in the region. It varies between 867mm at Ballia to 1059mm. at Gonda. On an average it is lowest in the month of December (18mm) and highest in the July (186mm) in the study region. Expecting small portion lying in the Middle East of the study region covering districts of Ghazipur and Ballia other areas have more or less the similar AE value shown with isolines Table 2 and 5 represents the monthly and average seasonal distribution of AE. The amount of actual water loss is highly variable from season to season. In SWmonsoon season (JJAS) it is highest (641mm) than the other seasons. In this period AE increases due to adequate moisture supply through rainfall. Thereafter it started to decrease from the months of Post-monsoon season till the end of winter season. From the beginning of summer months the amount of actual water loss gradually increases with rising temperature. It is lower in


157

winter due to low temperature and summer season due to deficient or no rain with gradual decline in soil moisture storage. Table 2: Monthly and Annual Actual Evapotranspiration in mm Districts Jan. Feb. Mar. Apr. May Jun. Bahraich 20 26 36 37 49 166 Gonda 15 20 35 62 43 196 Faizabad 15 22 39 39 47 130 Gorakhpur 17 23 31 32 50 186 Sultanpur 12 31 35 40 43 130 Azamgarh 23 23 32 35 22 77 Allahabad 22 35 40 38 30 113 Jaunpur 23 29 38 37 19 79 Ghazipur 19 21 42 47 38 103 Varanasi 22 29 48 47 36 109 Ballia 8 18 27 30 31 99 Pipri 28 33 41 30 26 143 Average E.U.P. 19 26 37 40 36 128

Jul. 191 184 188 188 186 172 193 190 179 186 186 184 186

Aug. 180 176 166 180 178 162 178 178 165 175 176 175 174

Sep. 161 153 143 156 156 145 159 156 147 156 153 159 154

Oct. 117 117 117 117 115 107 117 119 110 117 92 132 115

Nov. 39 40 41 41 40 45 51 46 45 44 34 53 43

Dec. 21 18 16 19 15 10 16 17 18 23 13 26 18

Annual 1043 1059 963 1040 981 853 992 931 934 992 867 1030 974

3. Water Deficit: The water deficit is expressed as the difference between water need (PE) and actual evapotranspiration (AE). It is simply the shortage of moisture that is not available for utilization. In monsoonal climate where the seasonal rainfall variability is high, the climate becomes drier at the end of moist period. On an average the deficiency occurs highest (356mm) in dry summer season due to low or no rainfall. On the other hand even the SW monsoon season experiences a moderate (80mm) deficiency followed by a short Post monsoon period (47mm). Due to negligible or meager amount of rainfall and low evapotranapiration winter season observes least amount of water deficit. Table 3 and Fig 3C shows the annual variation in WD of the region. It ranges between 365mm. at Gonda to 651mm. at Allahabad. The southwestern and southern parts of the study area come under more water deficient region. In the entire region, deficiency usually occurs in dry months. Excepting three months of rainy (JAS) season, remaining other months experience varying amount of deficiency in the year. Due to low evapotranspiration little or moderate deficiency occurs in winter season. The summer months experience large WD because of no or meager amount of rainfall and high high rate of evapotranspiration. It is one of the important water balance parameter which indicates the time of irrigation scheduling for the standing agricultural crops. Table 3: Monthly and Annual Water Deficit in mm Districts Jan. Feb. Mar. Apr. Bahraich 2 14 63 130 Gonda 7 14 61 105 Faizabad 4 15 60 128 Gorakhpur 5 17 71 138 Sultanpur 5 9 61 130 Azamgarh 2 17 70 35 Allahabad 3 8 74 140 Jaunpur 2 11 76 143 Ghazipur 5 17 55 118 Varanasi 3 11 54 125 Ballia 6 14 63 134 Pipri 14 34 101 154 Average E.U.P. 5 15 67 123

May 151 152 151 148 159 173 177 190 157 168 167 185 165

Jun. 32 1 67 11 67 120 192 128 97 93 94 62 80

Jul. 0 0 0 0 0 0 0 0 0 0 0 0 0

Aug. 0 0 0 0 0 0 0 0 0 0 0 0 0

Sep. 0 0 0 0 0 0 0 0 0 0 0 0 0

Oct. 18 11 17 20 19 15 20 24 10 17 36 20 19

Nov. 29 25 24 35 28 23 20 39 22 24 32 37 28

Dec. 11 9 11 13 10 17 17 19 7 7 12 24 13

Annual 450 385 477 458 488 472 651 632 488 502 558 631 516

4. Water Surplus: The surplus water is the amount of moisture that is excess from the evapotranspiraion and soil storage capacity. Therefore the water surplus represents the amount of water that is left after fulfilling the demands of the atmosphere and the soil. The comparison of monthly P and PE gives the information on the moisture surplus of the region. In the region July, August and September are the rainiest month of the year. When the soil is fulfilled with rain water after retaining the moisture to its field capacity surplus occurs usually in the month of August and September. It varies from almost nil at Allahabad to 199mm at Bahraich. The Tarai region falls into high surplus area due to adequate moisture. It gradually decreases proceeding towards plain area (Table 4, 5 and Fig 3D).

158


Table 4: Monthly and Annual Water Surplus in mm Districts Jan. Feb. Mar. Apr. May Bahraich 0 0 0 0 0 Gonda 0 0 0 0 0 Faizabad 0 0 0 0 0 Gorakhpur 0 0 0 0 0 Sultanpur 0 0 0 0 0 Azamgarh 0 0 0 0 0 Allahabad 0 0 0 0 0 Jaunpur 0 0 0 0 0 Ghazipur 0 0 0 0 0 Varanasi 0 0 0 0 0 Ballia 0 0 0 0 0 Pipri 0 0 0 0 0 Average E.U.P. 0 0 0 0 0 Table 5: Seasonal Distribution of Water Balance Parameters in mm Winter Season

Jun. 0 0 0 0 0 0 0 0 0 0 0 0 0

Summer Season

Jul. 0 0 0 0 0 0 0 0 0 0 0 0 0

Aug. 81 123 75 73 0 0 0 0 0 19 0 0 31

Sep. 118 51 72 80 36 49 0 10 48 114 10 30 52

Oct. 0 0 0 0 0 0 0 0 0 0 0 0 0

SW Monsoon Season

Nov. 0 0 0 0 0 0 0 0 0 0 0 0 0

Dec. 0 0 0 0 0 0 0 0 0 0 0 0 0

Annual 199 174 147 153 36 49 0 10 48 133 10 30 82

Post Monsoon Season

Districts

Bahraich Gonda Faizabad Gorakhpur Sultanpur Azamgarh Allahabad Jaunpur Ghazipur Varanasi Ballia Pipri Ave EasternnU.P.

RF

PE

AE

WD

WS

RF

PE

AE

WD

WS

RF

PE

AE

WD

WS

RF

PE

AE

WD

WS

48 30 27 37 31 16 41 45 36 54 20 44

94 83 83 94 82 93 101 101 87 95 71 159

67 53 53 59 58 56 73 69 58 74 39 87

27 30 30 35 24 36 28 32 29 21 32 72

0 0 0 0 0 0 0 0 0 0 0 0

60 74 40 58 34 10 28 19 27 39 20 34

466 458 464 470 468 467 499 503 457 478 452 537

122 140 125 113 118 89 108 94 127 131 88 97

344 318 339 357 350 278 391 409 330 347 364 440

0 0 0 0 0 0 0 0 0 0 0 0

1088 1072 1005 1053 918 839 811 871 871 1002 791 932

730 710 694 721 717 676 735 731 691 719 709 723

698 709 627 710 650 556 643 603 594 626 614 661

32 1 67 11 67 120 192 128 97 93 94 62

199 174 147 153 36 49 0 10 48 133 10 30

46 57 38 43 30 37 39 24 48 42 36 50

203 193 199 213 202 190 208 228 187 202 195 242

156 157 158 158 155 152 168 165 155 161 126 185

47 36 41 55 47 38 40 63 32 41 68 57

0 0 0 0 0 0 0 0 0 0 0 0

36

95

62

33

0

37

477

113

356

0

938

713

641

80

82

41

205

158

47

0

Figure-3


159

Ayoade’s Moisture Adequacy Index (1972): In 1972 Ayoade presented a new concept of climatic classification which is primarily based on Moisture Adequacy Index. It is an attempt to modify the definition of Thornthwaite‟s moisture index. He suggested the ratio of Actual Evapotranspiration to Potential Evapotranspiration in percent as a better measure of moisture availability of a region. The Moisture Adequacy Index (Ima) thus, is defined as the ratio between actual evapotranspiration (AE) and potential evapotranspiration (PE) expressed in percent. It is a good indicator of the available moisture in the soil in relation to water need. Thus Ima might be useful indicator for irrigation planning in the study of agriculture droughts and land use planning in applied climatology as well as in demarcating the Agroclimatic zones. In the study region Ima values computed for all the 12 meteorological stations are shown in Table 6 showing types of climate on the basis of Moisture Adequacy Index. Fig. 4 depicts Moisture Adequacy index and climatic types of Eastern Uttar Pradesh. It ranges from 59.6% in Jaunpur to 73.3% in Gonda district. The two districts of the region i.e. Jaunpur (59.6%) and Azamgarh (59.7%) experience Dry subhumid type of climate (C). Remaining other districts enjoy Moist sub-humid type of climate due to higher Ima values. Table 6: Derived Water Balance Parameters (AE and PE), Moisture Adequacy Index (Ima) and climatic types of Eastern Utter Pradesh Scheme of Climatic Classification Moisture Adequacy Index for stations in Eastern Uttar Pradesh according to Ayoade Moisture Adequacy Index (1972) PE AE Ima% Climatic Moiosture Climatic Station Climatic types (mm) (mm) 100[AE/PE] Climatic types code Adequacy code Index (%) Bahraich 1493 1013 67.8 B Moist sub - humid

A

Gonda

1444

1059

73.3

B

Moist sub - humid

Faizabad

1460

983

67.3

B

Moist sub - humid

Gorakhpur

1498

1040

69.4

B

Moist sub - humid

Moist sub-humid Sultanpur

1469

981

66.7

B

Moist sub - humid

Azamgarh

1426

891

59.7

C

Dry sub - humid

Allahabad

1543

992

64.3

B

Moist sub - humid

Jaunpur

1563

931

59.6

C

Dry sub - humid

Ghazipur

1422

915

65.7

B

Moist sub - humid

Varanasi

1494

999

66.9

B

Moist sub - humid

Ballia

1428

867

60.7

B

Moist sub - humid

Pipri

1661

1030

62

B

Moist sub - humid

Humid

80 B 60 C

Dry sub-humid

40 D

Semi-arid

20 E

Arid

The above discussed water balance parameters, help us to recognize the prevailing climatic condition over the region. These parameters have been used to find out the various indices on the basis of which climatic types are identified. Conclusion: The above discussed water balance parameters, help us to recognize the prevailing climatic condition over the area. In farming practices water balance provides knowledge about the assessment of supplementary irrigation for the standing crops. The spatio-temporal occurrence and distribution of precipitation (water supply) are discussed from observed data while actual evapotranspiration (the amount of water that actually evaporates and transpires), potential evapotranspiration (water need), the water deficiency (water requirements) and water surplus (irrigation potential) have been assessed in the present work using Thornthwaite‟s water balance procedure. On the basis of these parameters, it has tried to determine the degree of dryness and wetness of the study area to find out the humidity and aridity indices. Moisture Adequacy Index provides the exact information of moisture status in soils during wet and dry season in the region. Such type of information gives a better idea to determination of cropping pattern. Thus Ima might be useful indicator for irrigation planning in the study of agriculture droughts and land use planning in applied climatology.

160


References Ferguson,W.S. (1965), Relationship between Evapotranspiration and the Stage of Crop Development, Bellani Plate Evaporation and Soil Moisture Content, Canadian Journal of Soil Sciences(45) pp.33-388 IMD Vision, 2030, On Operational Agrometeorological Advisory Services, Agricultural meteorology Division, India Meteorological Department, Pune, p.2 Mather, J.R. (1974). Climatology: Fundamentals and Applications, McGraw, Hill, Inc., p.87 Sharma, A.A.L.N. and Kumar, L.T.V. (2006). Studies on Crop Growing Period and NDVI in relation to Water Balance Components, Indian Journal of Radio and Space Physics, Vol.35, p. 426 Sharma, A.A.L.N. (1974). Drought Climatology of South Indian Region, unpublished Ph.D Thesis submitted to Andhra University, Waltair Singh, A and Singh, B.N. (2011), Delineation of Agro-climatic Regions in Eastern Uttar Pradesh, National Geographical Journal of India, 57(4): p. 53. Singh, K. (1977). Water Balance in Eastern Uttar Pradesh and Its Bearing on Irrigation and Agriculture Including Future Prospectus, Ph.D.Thesis submitted to the Department Of Geography, Banaras Hindu University, Varanasi. Subrahmaniam, A.R and Keshvarao, A.V.R. (1982). Water balance and crops in Karnataka,MAUSAM,35, P.1, p.55 Thornthwaite, C.W. and Mather, J.R. (1955). The Water Balance, Publication in Climatology, Laboratory of Climatology, Centerton (NJ), Vol.8, No.1, p.104 Thornthwaite, C.W. and Mather, J.R. (1957). Instruction and Tables for Computing Potential Evapotranspiration and Water Balance, Publication in Climatology, Laboratory of Climatology, Centerton (NJ), Vol.10, No.3

COST EFFECTIVE PROTECTED CULTIVATION OF STRAWBERRY UNDER SUBTROPICAL LUCKNOW CONDITIONS Ashok Kumar, Tarun Adak, Muralidhara B.M., Atul Singha and Veena G. L. ICAR-Central Institute for Subtropical Horticulture, Rehman Khera, P.O.- Kakori, Lucknow, Uttar Pradesh-226101, Email: [email protected], Corresponding Author: Ashok Kumar

F

armers are gradually shifting towards high-value, particularly horticultural crops which offer immense scope to increase income levels of smallholders and improve the productivity of scarce resources (Subramanian et al., 2000; Joshi et al., 2003). With a view to take advantage of opportunities arising out of agricultural diversification, it is important to assess their utility for smallholders. The benefits of agricultural diversification to smallholders and the likely obstacles that may come in the way of substituting food grain crops with high-value commodities need to be assessed (Joshi et al., 2006). Protected cultivation technology is a viable option for sustainable crop production in the regions of adverse climatic condition because it has been evolved to create favorable micro-climates, which favors the crop production could be possible all through the year or part of the year as required. The spread of Protected cultivation industries located at diverse climate conditions has been driven by the increased demand for high quality and healthier products in a year- round fashion, by the availability of efficient transportation systems, by the increased development of green-house technologies, and by the accessibility of glazing and building materials. The primary environmental parameter traditionally controlled is temperature, usually providing heat to overcome extreme cold conditions. However, environmental control can also include cooling to mitigate excessive temperatures, light control either shading or adding supplemental light, carbon dioxide levels, relative humidity, water, plant nutrients and pest control. High summer temperature and higher establishment cost of green house is a major setback for successful crop production throughout year. Low cost protected structures can be used for high quality vegetable cultivation for long duration (6-10 months) mainly in peri-urban areas of the country. Polytrenches have also been proved extremely useful for growing vegetables under cold desert conditions in upper Himalayas in the country. However, in hot and sunny regions, cooling the greenhouse air is a more difficult challenge than heating due to the fact that advances in the greenhouse cooling technology are still limited compared with heating systems. The present experiment was laid out with the objective to find out the suitable low cost protected structure for cultivation of strawberry under subtropical conditions of North India. Status of Strawberry Production in India: Protected cultivation of horticultural crops is production of high quality produce for internal and domestic markets. There are different types of protected structures being adopted by the growers based on the agro-climatic conditions and the availability of agro inputs. Some of the most ideal regions in the country are the western and eastern India. In this region this technology is under maximum adoption for growing export quality gerberas, carnation, roses, etc. In vegetables, crops like pepper, tomato, cucumber, musk melon, baby corn etc. are successfully grown. Strawberry var. Chandler could be planted in mid September under sub tropical semi arid zones of India with micro irrigation facility (Singh et. al. 2005, 2007 and 2009). Disease incidence of leaf spot, blight and fruit rot was found to be the lowest under the low tunnel system of cultivation in Chandler. Maximum disease incidence was observed under open conditions in Ofra where as the maximum incidence of blight diseases were recorded in Chandler than Ofra under the Open conditions. (Kumar et. al. 2011). Greenhouses are being used in the northern hilly states of India for extending the growing season of vegetables from 3 to 8 months. In North-East, greenhouses are popular for protecting crops from excessive rain. In the Northern plains, seedlings of vegetables and flowers are being raised in the greenhouses either for capturing the early markets or to improve the quality of the seedlings. Several commercial floriculture ventures are coming up in Maharashtra, Tamil Nadu and Karnataka to meet the demands of both domestic and export markets. From smallholders’ perspective, fruits and vegetables are important constituents of high-value agriculture. In northern states, low poly tunnel are used to produce quality strawberries and high value vegetables (Chadha and Chaudhary, 2007).

162


Cost Effective Production System: A Case Study: Strawberry runners in open conditions exhibited complete mortality till the month of August, while the runners planted in naturally ventilated polyhouse with roof top covered with transparent polythene exhibited survival during rainy season in the well irrigated field during summer season. Strawberry var. Sweet Charlie, exhibited advancement of 20 days harvesting period in ventilated polytunnel in the winter strawberry production. Open condition recorded higher morning temperature while shade net showed higher one in the afternoon hours. Lower soil temperatures in the afternoon hours were also recorded in ventilated poly cover system. Fruit quality and yield was influenced by the protected structures and maximum yield (260 q/ha.) was recorded under ventilated tunnel in var. Sweet Charlie. Almost uniform fruit size throughout harvest and higher Vit. C content was observed under ventilated polytunnel.

Cost effective structures

Fruit size in ventilated cover

Early fruiting in ventilated cover Heavy and extended season fruiting Appraisal of Soil Properties in Strawberry Production: The soil samples were collected from bed and open conditions in the experiment on stress management in strawberry using ventilated poly cover, shade net, covered polytunnel and open condition. Undisturbed core soil samples were collected at 0-10, 10-20 and 20-30 cm soil depths. Soil physical parameters were determined in the laboratory using standard methodology and other chemical properties were also estimated. The average bulk density and particle density was around 1.4 and 2.5 g cm-3 respectively. The mean water holding capacity and porosity was 20.7 and 43.9 per cent respectively. The soil organic carbon (SOC), P, K and DTPA-extractable micronutrients (Fe, Cu, Mn and Zn) were recorded higher at the top soil layer with decreasing trend at the bottom layer. The mean SOC was 0.36 per cent while N, P and K were 93.3, 16.1 and 146.4 ppm respectively. A range of 1.08-3.66, 1.52-5.34, 6.04-12.16 and 2.686.08 ppm Zn, Cu, Mn and Fe were estimated across depths and systems. Soil temperatures were monitored at 10 and 20 cm soil depths both at the morning and afternoon periods in different stress mitigation structures. Clear differences in soil temperature across different systems were noted. A range of 7 to 24.3 in the morning and 10 to 34°C in afternoon was recorded across structures. Significant differences in the maximum and minimum soil temperatures were also observed.

Cost Effective Protected Cultivation of Strawberry under Subtropical Lucknow Conditions 163 40 Morning

35

Afternoon Soil temperature (0C)

30 25 20 15 10 5 0 1

15 29

43 57 71 85 99 113 127 141 155 169 183 197 211 225 239 253 No of observations

Strawberry grown under the treatment viz., open condition had recorded higher morning temperature while shade net showed higher one in the afternoon hours. Lower soil temperatures in the afternoon hours were also recorded in ventilated poly cover system. 30

T1

T2

T3

40.0

T4

T1

T2

T3

T4

35.0

25

Soil Temperature (0C)

Soil Temperature (0 C)

30.0

20

15

10

Morning

25.0 20.0 15.0

Afternoon

10.0

5 5.0

0 1

6

11

16

21

26

31

36

Number of days

41

46

51

56

61

66

0.0 1

6

11

16

21

26

31

36

41

46

51

56

61

66

Number of days

Soil dehydrogenase activity had been measured under field moisture level. Ventilated polytunnel promoted greater difference in microbial activity between cropped and non cropped soil as compared to shade net system. Control field had no cover showed highest microbial activity because of very high surface soil temperature.

Fig.: Soil dehydrogenase activity in strawberry field under different conditions; T1: Full Cover, T2: Side ventilated, T3: Shade net, T4: Control; BP: Before planting of strawberry, AP: After planting of strawberry Summary and Future Perspectives: Different cost effective strawberry production systems were tried for strawberry cultivation under subtropical climatic condition of Lucknow region of Uttar Pradesh, India. Encouraging results were obtained with these systems. Strawberry runners planted in naturally ventilated polyhouse with roof top covered with transparent polythene exhibited survival during rainy season. Advancement in flowering and fruit harvest was recorded with strawberry variety Sweet Charlie in ventilated polytunnel in annual production system. Higher productivity was observed in this climatic condition as compared to traditionally growing areas in India. For early production of strawberry in subtropical conditions, Infra-short day varieties of strawberry should be explored. Cost

164


effective structure may be tried at farmer’s field for its potential use under adverse climatic conditions. References Chadha, K.L. and Chaudhary, M.L. (2007). Report of the Working Group on Horticulture, Plantation Crops and Organic Farming for the XI Five Year Plan (2007-12). Planning commission, GOI. 484. Joshi P.K., Joshi, L. and Birthal, P. S. (2006). Diversification and Its Impact on Smallholders: Evidence from a Study on Vegetable Production. Agricultural Economics Research Review. 19(2).219-236. Joshi, P.K., Gulati, A., Birthal, P.S. and Tewari, L. (2003). Agricultural diversification in South Asia: Patterns, determinants and policy implications. MTID Discussion Paper No. 57, International Food Policy Research Institute, Washington DC, USA. Kumar Ashok, R. K. Avasthe, K. Rameash, Brijesh Pandey, Tasvina R. Borah, Rinchen Denzongpa and Rahman, H. (2011). Influence of growth conditions on yield, quality and diseases of strawberry (Fragaria x ananassa Duch.) var Ofra and Chandler under mid hills of Sikkim Himalaya. Scientia Horticulturae, 130: 43-48. Singh Rajbir, Sharma, R.R., Goyal, R.K. (2007). Interactive effects of planting time and mulching on ‘Chandler’strawberry (Fragaria ananassa Duch.). Scientia Horticulturae. 111 344-351. Singh Rajbir, Sharma, R.R., Jain, R.K. (2005). Planting time and mulching influenced vegetative and reproductive traits in strawberry (Fragaria ananassa Duch.) in India. Fruits 60 (6) 395-403. Singh, R., Sharma, R.R., Kumar, A. and Singh, D.B. (2009). Package of practices for strawberry cultivation with modern techniques under northern Indian plains. Acta Hort., 842: 607-610. Subramanian, S.R., Varadarajan, S. and Asokan, M. (2000). India. In: Dynamics of Vegetable Production and Consumption in Asia, Ed: Mubarak Ali. Taiwan: Asian Vegetable Research and Development Centre.

ADOPTION OF MODERN PLANT BREEDING APPROACHES FOR CROP IMPROVEMENT Dan Singh Jakhar, Amit Kumar, Saket Kumar and Rajesh Singh Department of Genetics and Plant Breeding, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi–221 005, UP, India, E-mail: [email protected], Corresponding Author: Dan Singh Jakhar

P

lant breeding methods have contributed immensely to the development of genetically improved crop varieties. These methods continue to enrich the crop germplasm base by evolving genetically superior varieties for cultivation. Existing germplasm resources may not be adequate to meet the food needs of an ever-increasing human population, estimated to swell to nine billion by 2050 (Green et al. 2005). Further increase in agricultural productivity, equitably and in an environmentally sustainable manner, in the face of limiting resources, is a challenging task. Although both domestication and modern breeding have led to present-day crops that are far superior in agronomic traits to their wild counterparts, in many cases these also resulted in a narrowed genetic diversity (Tanksley and McCouch 1997; Lee 1998). It is estimated that for most crop species, less than 5 % of the biodiversity known to exist is being utilised in agriculture, particularly in the case of self pollinated crops (Tanksley and McCouch 1997). Over the past 100 years, the world population has grown exponentially from 1.75 to today 7.2 billion, creating an ever increasing demand for plant based raw materials for food and feed as well as industrial uses. Based on the discoveries of Mendel of the reproductive biology and inheritance of traits of plant species in the mid-19th century, a highly specialised plant breeding sector evolved. Plant breeders created new varieties based on crossing and selecting desired, valuable traits that increase yields, improve resistances against pests and diseases and that are adapted to new or adverse growing conditions. Together with a growing mechanization, professional use of fertilisers and crop protection and other innovations, this has allowed for a stunning increase of agricultural production that has increased global food security, spared wild habitats from being cleared for food production, and that contributes to social stability and societal development. Yet, while the achievements are impressive, in the light of continued rapid population growth and growing worldwide demand for a varied, high quality food supply, further progress in plant breeding innovation has unprecedented importance. Furthermore, this progress must not only deliver higher yields or nutritional values but is also expected to contribute to environmental protection, preservation of natural resources and public health. Further discoveries and advanced understanding of the biology, physiology, genetics and chemistry of plants and their interaction with the environment will continue to fuel the flow of plant breeding innovations. Modern Plant Breeding: Modern plant breeding may use techniques of molecular biology to select, or in the case of genetic modification, to insert, desirable traits into plants. Application of biotechnology or molecular biology is also known as molecular breeding. Steps of Plant Breeding: The following are the major activities of plant breeding:  Collection of variation  Selection  Evaluation  Release  Multiplication  Distribution of the new variety  selling to people Modern Plant Breeding Approaches Mutation Breeding: Genetic variation is the mainstay which plant breeders require to produce new and improved cultivars. The opportunity of obtaining novel traits exists through induction of mutations. Induced mutations have played a significant role in meeting challenges related to world food and nutritional security by way of mutant germplasm enhancement and their utilisation for the development of new mutant varieties. A wide range of genetic variability has been induced by physical and chemical mutagens. In the past several decades, induced mutations have contributed immensely to the development of improved varieties in several crop plants. Cellular and molecular

166


biology tools have led to enhanced efficiency of induction, detection and deployment of mutations. Till date, 3,218 mutant varieties have been released worldwide. More than 60 % of officially released mutant varieties are from Asia with China, India and Japan topping the list. The mutant varieties developed and released in major crops have been cultivated by farmers in large areas and have resulted in increased food production, thus contributing to food security. Tilling: Targeting Induced Local Lesions IN Genomes (TILLING) was introduced in 2000. It is a cost effective reverse genetics tool that detects point mutations induced artificially usually using chemical mutagens (EMS). EMS is the most efficient mutant and it produces G/C to A/T transition. TILLING can be used as a functional genomics tool to discover the genes involved in biotic and abiotic stress tolerance. Eco-TILLING is a kind of TILLING (Fig 1) that provides the advantage of single nucleotide polymorphism (SNP) in natural mutants to screen the plant populations for different biotic and abiotic stresses.

Fig 1. Schematic diagram of Targeting Induced Local Lesions IN Genomes (TILLING).

Eco-TILLING was used in barley to study the genetic variation in Mla and Mlo resistance genes at allele level, which conferred resistance against powdery mildew (Mejlhede et al., 2006). The genetic variation lost during domestication and other breeding programs has traditionally been recovered by plant breeders through utilizing land races and wild relatives as parents in breeding procedures. However, a low success rate and transfer of non desirable genes along with resistance genes are problems that can be covered by using TILLING (Rashid et al., 2011). Marker-assisted Breeding and Genomics: Marker-assisted (or molecular-assisted) breeding provides a dramatic improvement in the efficiency with which breeders can select plants with desirable combinations of genes. A marker is a “genetic tag” that identifies a particular location within a plant’s DNA sequences. Markers can be used in transferring a single gene into a new cultivar or in testing plants for the inheritance of many genes at once. Markers can be based upon either DNA or proteins. DNA markers identify locations where the sequences differ among varieties or breeding lines. These can be locations within genes or in the DNA between genes, so long as they are unique sequences and differ between the plants of interest. Differences of this type are called polymorphisms, and there are a variety of ways to detect and use these signposts within the chromosomes.

Adoption of Modern Plant Breeding Approaches for Crop Improvement

167

Genetic Modification: To genetically modify a plant, a genetic construct must be designed so that the gene to be added or removed will be expressed by the plant. To do this, a promoter to drive transcription and a termination sequence to stop transcription of the new gene, and the gene or genes of interest must be introduced to the plant. A marker for the selection of transformed plants is also included. In the laboratory, antibiotic resistance is a commonly used marker: Plants that have been successfully transformed will grow on media containing antibiotics; plants that have not been transformed will die. In some instances markers for selection are removed by backcrossing with the parent plant prior to commercial release. The construct can be inserted in the plant genome by genetic recombination using the bacteria Agrobacterium tumefaciens or A. rhizogenes, or by direct methods like the gene gun or microinjection. Using plant viruses to insert genetic constructs into plants is also a possibility, but the technique is limited by the host range of the virus. For example, Cauliflower mosaic virus (CaMV) only infects cauliflower and related species. Another limitation of viral vectors is that the virus is not usually passed on the progeny, so every plant has to be inoculated. The majority of commercially released transgenic plants are currently limited to plants that have introduced resistance to insect pests and herbicides. Insect resistance is achieved through incorporation of a gene from Bacillus thuringiensis (Bt) that encodes a protein that is toxic to some insects. For example, the cotton bollworm, a common cotton pest, feeds on Bt cotton it will ingest the toxin and die. Herbicides usually work by binding to certain plant enzymes and inhibiting their action. The enzymes that the herbicide inhibits are known as the herbicides target site. Herbicide resistance can be engineered into crops by expressing a version of target site protein that is not inhibited by the herbicide. This is the method used to produce glyphosate resistant crop plants. Virus Induced Gene Silencing (VIGS): RNA interference was once considered a gene expression regulation mechanism in eukaryotes as it involved degradation of mRNA resulting in inhibition of translation after transcription, and so was termed post-transcriptional gene silencing or RNA interference (RNAi).

Fig. 2. Schematic diagram of Virus induced gene silencing (VIGS).

168


The mechanism of RNAi starts with degradation of dsRNA by Dicer enzyme into miRNAs or siRNAs of 21–24 nucleotides. These smaller RNAs are recruited by RISC complex (an effecter complex) to their target sequence of mRNAs, which results in its degradation (Ding, 2010). In addition to its gene regulatory role, siRNA based RNAi also plays a role in innate antiviral defense in plants and the process is termed virus induced gene silencing (Fig 2) (Beclin et al., 2002; Ding, 2010). References Beclin, C., Boutet, S., Waterhouse, P. and Vaucheret, H. (2002). A branched pathway for transgene-induced RNA silencing in plants. Curr Biol, 12: 684-688. Ding, S.W. (2010). RNA-based antiviral immunity. Nat Rev Immunol, 10: 632-644. Green, R.E., Cornell, S.J., Scharlemann, J.P. and Balmford, A. (2005). Farming and the fate of wild nature. Science, 307: 550-555. Lee, M. (1998). Genome projects and gene pools: new germplasm for plant breeding? Proc Natl Acad Sci USA, 95: 2001-2004. Mejlhede, N., Kyjovska, Z., Backes, G., Burhenne, K., Rasmussen, S.K. and Jahoor, A. (2006). Eco-TILLING for the identification of allelic variation in the powdery mildew resistance genes Mlo and Mla of barley. Plant Breed, 125: 461-467. Rashid, M., He, G., Guanxiao, Y. and Khurram, Z. (2011). Relevance of tilling in plant genomics. Australian J Crop Sci, 5: 411-420. Tanksley, S.D. and McCouch, S.R. (1997). Seed banks and molecular maps: unlocking genetic potential from the wild. Science, 277: 1063-1066.

SOIL SOLARIZATION: AN EFFICIENT AND ECO FRIENDLY APPROACH FOR PLANT PROTECTION UNDER SUSTAINABLE AGRICULTURAL SYSTEM Kiran Rana1, Manoj Parihar1, Sunil Kumar1, H.S.Jatav2 and S.S. Jatav2 1

Department of Agronomy, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi-221005, India, E-mail: [email protected] and 2Department of Soil Science & Agricultural Chemistry, Institute of Agricultural Sciences, B.H.U., Varanasi 221005, India, Corresponding Author: Kiran Rana

T

he increasing concern about the impact of mineral fertilizers, fungicides and herbicides on the environment and human health requires the development of alternative agronomic techniques that may reduce the use of these products. This need is further emphasized by the occurrence in pests of resistance to fungicides, the breakdown of host resistance by natural populations (McDonald and Linde, 2002), and the phasing out of methyl bromide in 2005 for its negative impact on the ozone layer (Martin, 2003). Among the alternative strategies, soil solarization is a technique used by covering soil with clear polyethylene sheets, during summer months, to trap the solar radiation to heat soil (Horouwitz et al., 1983; Abdallah, 1991). The improvement of plant growth, using solarized soil technique, was reported by Abdallah (2000) and soil solarization also provides excellent control of soil-borne pathogens with resultant increase in growth, yield, and quality of pepper and other crop plants (Kurt and Emir, 2004; Cimen et al., 2010). Solarization was originally developed to control soil-borne pathogens as first reported by Katan et al. (1976), but it was soon found as an effective treatment against a wide range of other soil-borne pests and weeds including more than 40 fungal plant pathogens, a few bacterial pathogens, 25 species of nematodes and many weeds (Stapleton, 1997). In solarized soils, control of pests is imputable to multiple mechanisms which primarily involve thermal inactivation of plant pathogens, because of increased soil temperature under plastic films (Katan et al., 1976), or weakening of the pathogen propagules that become more susceptible to competition or antagonistic activity of the native soil microflora (Stapleton, 2000). SS has been proved to be effective in controlling populations of many important soil borne fungal pathogens such as Verticillium dahliae, the causal agent of vascular diseases of many plants (Pinkerton et al., 2000), certain Fusarium spp. that cause Fusarium root-rot and wilt in several crops (Bourbos et al.,1997; Tamietti and Valentino, 2006), and Rhizoctonia solani and S. minor that cause lettuce drop (Sinigaglia et al., 2001).

Fig.1: A weed mulcher is being used to lay plastic mulch for soil solarization.

Principles of Soil Solarization: Soil solarization work on same principles of green house effect where the short wavelengths of visible light from the sun pass through a transparent medium and are absorbed, but the longer wavelengths of the infrared re-radiation from the heated objects are unable to pass through that medium. The trapping of the long wavelength radiation leads to more heating and a higher resultant temperature. In general for soil solarization we use transparent polythene film which serve as a medium. The formation

170


of water droplets on the inner surface of the polyethylene film also reduces the transmissivity to long wave infrared radiation substantially, resulting in better heating due to an increase in its greenhouse effect (Malik and Tran, 1973). The following are to be borne in mind for maximum benefit from soil solarization (Yaduraju and Mishra, 2004) 1. Transparent not black polyethylene should be used since the former transmits most of the solar radiation that heats the soil. 2. Soil mulching should be carried out during the period of high temperatures and intense solar radiation. 3. Soil should be kept wet during mulching to increase thermal sensitivity of resting structures and improve heat conduction. 4. The thinnest polyethylene tarp possible (25-30 µm) is recommended, since it is both cheaper and somewhat more effective in heating due to better radiation transmittance, than thicker films. 5. The mulching period should be sufficiently extended, usually four weeks or longer, to heat the soil at deeper layers. Mechanism of Soil Solarization Physical Mechanism: Direct thermal inactivation of soil borne pathogens and pests is the most obvious and important mechanism of the solarization process. Under suitable conditions, soil undergoing solarization is heated to temperatures which are lethal to many plant pathogens and pests. Thermal inactivation requirements have been experimentally calculated for a number of important plant pathogens and pests (Katan, 1987; Stapleton and DeVay, 1995). Although most mesophilic organisms in soil have thermal damage thresholds beginning around 39-400C, some thermophilic and thermo tolerant organisms can survive temperatures achieved in most types of solarization treatment (Stapleton and DeVay, 1995). During solarization of open fields or greenhouse floors, destruction of soil borne pest inoculum usually is greatest near the surface and efficacy decreases with increasing depth (Stapleton, 1997). There are a number of physical factors which influence the extent of soil heating during solarization. First, solarization is dependent on high levels of solar energy, as influenced by both climate and weather. Cloud cover, cool air temperatures, and precipitation events during the treatment period will reduce solarization efficiency (Chellemi et al., 1997). Solarization is commercially practiced mainly in areas with Mediterranean, desert, and tropical climates which are characterized by high summer air temperatures. In order to maximize solar heating of soil, transparent plastic film is most commonly used for solarization. Transparent film allows passage of solar energy into the soil, where it is converted into longer wavelength infrared energy. This long wave energy is trapped beneath the film, creating a greenhouse effect. Apart from solar irradiation intensity, air temperature, and plastic film color, other factors play roles in determining the extent of soil heating via solarization. These include soil moisture and humidity at the soil/tarp interface, properties of the plastic, soil properties, color and tilth, and wind conditions. The procedure of covering of very moist soil with plastic film to produce microaerobic or anaerobic soil conditions, but without lethal solar heating, can by itself produce varying degrees of soil disinfestation (Katan, 1987; Stapleton and DeVay, 1995). Chemical Mechanism: In addition to direct physical destruction of soil borne pest inoculum, other changes to the physical soil environment occur during solarization. Among the most striking of these is the increase in concentration of soluble mineral nutrients commonly observed following treatment. For example, the concentrations of ammonium- and nitrate nitrogen are consistently increased across a range of soil types after solarization. Results of a study in California showed that in soil types ranging from loamy sand to silty clay, NH4-N and NO3-N concentration in the top 15cm soil depth increased 26-177 kg/ha (Katan, 1987; Stapleton and DeVay, 1995). Concentrations of other soluble mineral nutrients, including

Soil Solarization: An Efficient and Eco Friendly Approach for Plant Protection………..

171

calcium, magnesium, phosphorus, potassium, and others also sometimes increased, but less consistently. Increases in available mineral nutrients in soil can play a major role in the effect of solarization, leading to increased plant health and growth, and reduced fertilization requirements. Increases in some of the mineral nutrient concentrations can be attributed to decomposition of organic components of soil during treatment, while other minerals, such as potassium, may be virtually cooked off the mineral soil particles undergoing solarization. Improved mineral nutrition is also often associated with chemical soil fumigation (Chen et al., 1991). Biological Mechanism: In addition to direct physical and chemical effects, solarization causes important biological changes in treated soils. The destruction of many mesophilic microorganisms during solarization creates a partial biological vacuum in which substrate and nutrients in soil are made available for recolonization following treatment (Katan, 1987; Stapleton and DeVay, 1995). Many soil borne plant parasites and pathogens are not able to compete as successfully for those resources as other microorganisms which are adapted to surviving in the soil environment. This latter group, which includes many antagonists of plant pests, is more likely to survive solarization, or to rapidly colonize the soil substrate made available following treatment. Bacteria including Bacillus and Pseudomonas spp., fungi such as Trichoderma, and some free-living nematodes have been shown to be present in higher numbers than pathogens following solarization. Their enhanced presence may provide a short- or long-term shift in the biological equilibrium in solarized soils which prevents recolonization by pests, and provides a healthier environment for root and overall plant productivity (Katan, 1987; Stapleton and DeVay, 1995; Gamliel and Stapleton, 1993a). Factor Affecting Soil Solarization 1. Addition of Soil Amendments: Addition of different types of organic matter, e.g., animal manures and crop residues, to the soil before soil solarization increases efficacy of soil-borne pathogen and weed management by soil solarization. Organic matter addition increases the rate of decomposition of these materials in the soil and thereby the rate of heat generation during decomposition; it also increases the heat-carrying capacity of the soil. Volatile biotoxic compounds are released when organic matter is heated during the process of solarization. Thus, organic amendments augment the biocidal activity of the soil solarization. In addition, organic and inorganic ammonia-based fertilizers applied to the soil and followed by soil solarization may be effective against natural soil populations of the damping off fungus (Pythium ultimum), Verticillium dahliae (in some cases), and root-knot nematode (Meloidogyne incognita). Organic soil amendments can protect soil microbial biomass and enzymatic activities from the detrimental effect of heating. Different plant residues or manure incorporated into solarized soil may generate measurable amounts of volatiles such as ammonia, methanethiol, dimethyl sulfide, allylisothiocyanate, phenylisothiocyanate and aldehyde. Many plants such as several Brassica species produce such chemicals, including isothiocyanates in their tissues in various levels and forms including sulfur-containing compounds. 2. Soil Preparation: The heating of the soil is best when the polyethylene film is laid close to the soil with a minimum of airspace to reduce the insulating effect of an air layer. Hence, good land preparation is essential to provide a smooth even surface. A rotary hoe or roto-tiller will eliminate clods or other debris that create air pockets that slow soil heating and keep the tarp from fitting tightly over the soil surface. 3. Soil Moisture: Soil moisture is a critical variable in soil solarization because it makes organisms more sensitive to heat and also transfers heat to living organisms (including weed seeds) in soil. The success of soil solarization depends on moisture for maximum heat transfer; maximization of heat in soil increases with increasing soil moisture. Soil moisture favors cellular activities and growth of soilborne microorganisms and weed seeds, thereby making them more vulnerable to the lethal effects of high soil temperatures associated with soil solarization. 4. Plastic Tarp: Transparent polyethylene films are more efficient than black films in trapping solar radiation (Horowitz et al., 1983; Bhasker et al., 1998; Mudalagiriappa et al., 1999) and reducing weed emergence (Table 1). Chase et al. (1998) found that soil solarization through transparent polyethylene reduced the emergence of purple nutsedge ( Cyperus rotundus L.) (5 plants/m2) as compared to black

172


low-density polyethylene (35.7 plants/m2) after 5 weeks. The lower emergence was attributed to lethal soil temperature resulting from solarization, which killed Cyperus tubers. Besides clear transparent polyethylene costs less and has high strength. It also allows maximum transmittance of radiation from 0.4 µm to 36 µm (Waggoner et al., 1960). Thinner films, 19-25 µm are more effective for solar heating than thicker films (50-100 µm) and are proportionately less expensive (Stapleton and DeVay, 1986). Higher soil temperature under thin films could be attributed to favourable properties such as higher transmission and lower reflection (Stapleton, 1997). Basavaraju and Nanjappa (1999) observed that soil solarization for 45 days with thin films (25µm) recorded significantly lower weed population in chilli and delayed the emergence of crabgrass (Digitaria marginata L.) to an extent of 40 days Table 1. Effect of solarization with black and transparent plastic on weed emergence after plastic removal (Horowitz et al, 1983). Species emerged Weed emergence (No./0.5 m2) Control Black Transparent Pigweed (Amaranthus spp.) 30a 12b 4bc a a Common purslane (Portulaca 78 68 4b a oleracea L.) 146 0b 4b a b Henbit (Lamium amplexicaule L.) 330 107 16c a b Bull mallow (Malva niceaensis All.) 524 0 0b Compositae* 1294a 194b 44c Total annuals 40a 9b 0b *Mainly daisy (Chrysanthemum segetum L.) and annual sowthistle (Sonchus oleraceus L.). Figures in the same line followed by the same letter do not differ at 5% level of significance

Gill et al. (2009) setup an experiment with four clear plastic films including: ISO, VeriPack, Poly Pack, Bromostop, and a white plastic control. Total exposed area was greater with white plastic and Bromostop (81.5 ft2 / bed) compared with other plastic films (21.5 ft2/bed) due to their durability. Poly Pak, ISO, and Veri Pack suppressed nutsedge more than Bromostop and white plastic (table 2). The edges of the sheets must be buried 13 to 15 cm (5 to 6 inches) deep in the soil to prevent wind from blowing or tearing the tarp. Thinner sheets (0.5 to 1 mil) are less costly, but they tear or puncture more easily. Thinner plastic is mostly damaged by birds and self shattering from UV light. Table 2. Density of common weeds at 10 weeks after treatment with different plastic films (Gill et al., 2009) Treatments

Purslane

Cudweed

Hairy indigo Grassy Broadleaf (weeds/bed)x ISO film 0.0a 0.0b 0.0b 0.0b bromostop 1.2a 1.8ab 2.0a 9.8ab veripack 0.0a 0.4b 0.0b 1.8b Poly pack 0.0a 0.0b 0.6ab 1.4b white plastic 3.4a 5.2a 1.4ab 27.6a Mean values within the same column followed by same letter are not significantly different according difference test at P ≤ 0.05

0.0b 8.8a 0.4b 0.0b 11.2a to least significant

5. Timing: The longer the soil is heated, the better and deeper the control of all soil pests and weeds will be. Thus, long, hot, sunny days work best to kill soil borne pathogens and weed seed. However, duration of 4-6 weeks would be adequate under many situations (Yaduraju, 1993; Habeeburrahman and Hosmani, 1996; Singh et al., 2000). Shorter duration is often sufficient in tropical countries. In India, April-May in the south and May-June in northern areas experience intense radiation and are best suited for solarization (Yaduraju and Kamra, 1997). The land is also ideal during this period, which is important, as many farmers do not like to lose a crop in favour of soil solarization. Soil solarization for 40 days was found more effective in controlling weeds as compared to 20 days (Bhasker et al., 1998). Solarization is most effective in the upper 10 cm of soil; however, pest control at greater depths may be achieved sometimes, with extended periods of polyethylene mulching. Egley (1983) found that just one week of solarization treatment significantly reduced the number of viable seeds of prickly sida (Sida spinosa L.), common cocklebur (Xanthium pensylvanicum Wallr.), velvetleaf (Abutilon theophrasti Medic.) and spurred anoda (Anoda cristata L. Schlecht.). When the duration was increased to 2 weeks, additional species were controlled. In India, Singh et al., (2000) observed that solarization for a period of 3 weeks during May to June was enough to control most of the annual weeds in soybean (Table 3).


173

Table 3: Effect of period of solarization on population and dry weight of weeds and seed yield of soybean (Singh et al., 2000). Period of solarization Weed density/m2 Weed dry weight (g/m2) 30 DAS 60 DAS 30 DAS 60 DAS Control 96.9 122.9 43.9 69.6 Solarization for 3 weeks 0.0 43.6 0.0 46.1 Solarization for 4 weeks 0.0 40.1 0.0 32.2 Solarization for 5 weeks 0.0 38.8 0.0 32.1 Summer ploughing 83.6 79.4 20.8 76.4 Figures in the same column followed by the same letter do not differ at 5% level of significance. DAS = Days after sowing

Importance of Soil Solarization 1. Effect on Soil Microorganism and Pathogen: Mild temperature increases during soil solarization are more selective towards thermophilic and thermotolerant (above 113°F or 45°C) biota, including actinomycetes. These may survive and even flourish under soil solarization, but poor soil competitors, such as many pathogens, are killed by soil solarization. Nitrogen-fixing Rhizobium bacteria are also sensitive to high soil temperatures, and reduction in root nodulation of legumes such as peas or beans in solarized soils is also temporary. Applying inoculum to legumes planted in solarized soil may be beneficial. Several investigations have been conducted on the effect of solarization on native as well as inoculated Rhizobium. The native populations in pigeonpea and chickpea were decreased with solarization (Linke et al., 1990; Rupela and Sudershana, 1990). A population of Rhizobium, sufficient to cause heavy nodulation of bean roots, survived solarization in Israel (Katan, 1981). Improved yields of mungbean, soybean and groundnut in response to seed inoculation of Rhizobium (Table 4) were observed in New Delhi (Yaduraju, 1993). Soil solarization is effective against fungal pathogens such as Verticillium spp. (wilt), Fusarium spp. (several diseases), and Phytophthora cinnamomi (Phytophthora root rot), and bacterial pathogens such as Streptomyces scabies (potato scab), Agrobacterium tumefaciens (crown gall), and Clavibacter michiganensis (tomato canker). It also reduces soil populations of different plant parasitic nematodes, especially Meloidogyne spp. (rootknot) and Pratylenchus thornei (root lesion), Pratylenchus (root lesion) and Xiphinema (dagger) nematodes. Schreiner et al. (2001) found that solarization did not reduce the infectivity of AM fungi immediately after the solarization period, but infectivity was greatly reduced 8 months after solarization. Solarization apparently reduced AM fungi in soil indirectly by reducing weed populations that maintained ineffective propagules. Solarization reduced the population of plant parasitic nematodes including Tylenchus, Heterodera, Xiphinema, Hoplolaimus, Pratylenchus by about 42 to 100% (Kumar et al., 1993; Katan, 1984; Barbercheck and Von Broembsen, 1986; Stapleton and DeVay, 1984), but the nematode levels had largely recovered after 70 days (Kumar et al., 1993). With regards to soil-borne mites, solarization has been used to control the plant-parasitic mite, Rhizoglyplus robini, in Israel (Katan, 1984). Soil solarization significantly reduced ant and earthworm numbers but had no effect on millipede population (Ricci et al., 1999) Table 4 Fungal pathogens controlled by soil solarisation (Reddy, 2013) Scientific name Disease caused (crop) Didymella lycopersici Didymella stem rot (tomato) Fusarium oxysporum f. sp. conglutinans Fusarium wilt (cucumber) F. oxysporum f. sp. fragariae Fusarium wilt (strawberry) F. oxysporum f. sp. lycopersici Fusarium wilt (tomato) F. oxysporum f. sp. vasinfectum Fusarium wilt (cotton) Plasmodiophora brassicae Club root (cruciferae) Phoma terrestris Pink root (onion) Phytophthora cinnamomi Phytophthora root rot(many crops) Pyrenochaeta lycopersici Corky root (tomato) Pythium ultimum, Pythium spp. Seed rot or seedling disease (many crops) P. myrothecium Pod rot (peanut) Rhizoctonia solani Seed rot or seedling disease (many crops) Sclerotinia minor Lettuce drop Sclerotium cepivorum White rot (garlic andonions) S. rolfsii Southern bight (many crops) Thielaviopsis basicola Black root rot (many crops) Verticillium dahliae Verticillium wilt (many crops)

174


Table 5 Bacterial pathogens controlled by soil solarisation (Reddy, 2013) Scientific name Disease caused (crop) Agrobacterium tumefaciens Crown gall (many crops) Clavibacter michiganensis Canker (tomato) Streptomyces scabies Scab (potato) Table 6. Effect of solarization and Rhizobium inoculation on seed yield (kg/ha) of some legumes (Yaduraju, 1993) Solarized Nonsolarized Crop - Inoculation + Inoculation - Inoculation + Inoculation Soyabean 1833 2683 717 1383 Groundnut 1489 1756 844 1112 Maize 1191 1315 547 556

2. Effect on Weeds: It is theorized that solarization controls weeds in the following ways: (1) direct thermal killing of propagules, (2) high temperatures interact with toxic volatiles from decaying organic matter to weaken weed propagules so they are predisposed to microbial infection, and (3) breaking propagule dormancy followed by scorching of trapped weeds (Rubin and Benjamin 1984). Haidar et al. (1999) reported that all solarization treatments significantly reduced the seed germination of dodder seeds at 0 cm deep in comparison to nonsolarized controls. Under field conditions, seed aging of weeds is also accelerated through the soil solarization, which is a physical technique used for weed and plant disease control in regions receiving high levels of solar radiation (El-Keblawy, 2003). Soil solarization was most effective at controlling broad-leaved weeds than sedges and grasses (Reddy et al., 1998). Abdullah (1998) also found that seed bed solarization gave 100, 80 and 16% weed reduction for annual broad leaf weeds, annual grasses and perennial weeds, respectively in onion. In general terms, annual weeds are more effectively controlled than perennial weeds by solarization (Chase et al. 1998; Stevens et al. 1990). However, several studies have shown that perennial weeds can also be controlled by solarization. In perennials with an established underground system of deep roots, rhizomes or tubers, the failure of solarization is probably due to the limited penetration of heat in soil beyond 10 cm depth (Horowitz et al., 1983). Most perennials are capable of regenerating rapidly from partially damaged underground organs. The survival of purple nutsedge tubers in the soil has been reported by several workers (Kumar et al., 1993; Horowitz et al., 1983; Rubin and Benjamin, 1984) and it has been attributed to heat resistance of the tubers. As the solarization effect diminishes with soil depth, weeds that are capable of emergence from deeper layers survive the treatment. Although, solarization did not control purple nutsedge directly, it weakened. Soil solarization at 99°F (37°C) for 2-4 weeks almost completely prevents the emergence of many annual weeds, especially at the top layer because temperature increases more slowly at deeper depths. Soil solarization effectively controls broomrapes (Orobanche spp.) and many other weeds, but not Cuscuta species, bindweed, or purple nutsedge. Efficacy of soil solarization for weed control in the field is increased by providing irrigation at least 2-3 week prior to solarization, letting the weeds grow, and incorporating them in soil before establishing the solarization treatment. Table 7: Susceptibility of winter annual weeds to soil solarisation (Reddy, 2013) Weed species Reported Location Anagallis coerulea Sensitive Israel Avena fatua Moderately sensitive Israel, California (USA) Centaurea iberica Sensitive Israel Emex spinosa Sensitive Israel Capsella bursa-pastoris Sensitive Israel, California (USA) Lactuca scariola Sensitive Israel Mercurialis annua Sensitive Israel Lamium amplexicaule Sensitive Israel, California (USA) Poa annua Sensitive California (USA), Louisiana (USA) Raphanus raphanistrum Sensitive California (USA), Louisiana (USA) Sonchus oleraceae Sensitive Israel, California (USA) Senecio vulgaris Sensitive California (USA) Montia perfoliata Sensitive California (USA) Urtica urens Sensitive Israel Erodium sp. Sensitive Australia Table 8: Susceptibility of perennial weed species to soil solarisation (Reddy, 2013) Weed species Reported Location Conyza canadensis Moderately resistant Israel Echinochloa crusgalli Sensitive Louisiana (USA), California (USA), Australia Ipomoea lacunosa Sensitive Mississippi (USA)


175

Malva nicaeensis Moderately sensitive Israel M. parviflora Sensitive California (USA) Melilotus sulcatus Resistant Israel Orobanche crenata Sensitive Israel, Egypt O. aegyptiaca Sensitive Israel Portulaca oleracea Moderately sensitive-sensitive Egypt, Israel, California (USA), Australia Digitaria sanguinalis Sensitive Israel, California (USA) Sida spinosa Sensitive Mississippi (USA) Tribulus terrestris Sensitive Israel Xanthium spinosum Sensitive Israel Astragalus boeticus Moderately sensitive Israel Solanum nigrum Sensitive Egypt, California (USA), Israel, Australia Table 9 Susceptibility of perennial weed species to soil solarisation (Reddy, 2013) Weed species Reported Location Convolvulus arvensis Moderately resistant-resistant Israel, California (USA) Cyperus esculentus Resistant Florida (USA), California (USA) C. rotundus Resistant Egypt, Israel, Mississippi (USA) Cynodon dactylon Moderately sensitive Israel, California (USA), Texas (USA) Sorghum halepense Moderately sensitive Israel, California (USA)

3. Effect on Plant Nutrients: Plastic-mulched and steamed soils usually contain higher levels of soluble mineral nutrients than untreated soils (Baker and Cook, 1974). This phenomenon was also found in soils treated by solarization in Israel (Chen and Katan, 1980) and in California (Stapleton, Quick and DeVay, 1985). The kinds of nutrients increased by solarization in soils in both Israel and California were similar. Significant increases in ammonium-nitrogen, nitrate nitrogen, Ca2+ Mg2+ and electrical conductivity were consistently found. Phosphorus, Potassium and Chlorine increased in some soils. Other micronutrients (Fe3+, Mn2+ Zn2+ and Cu2+) were not increased. Wet soil which was covered with polyethylene film but protected from solar heating did not differ in chemical properties from untreated control soil (Stapleton et al., 1985), indicating that heating released soluble mineral nutrients from organic material and heat-killed soil biota. An increase in nitrate-N and ammonical-N was observed in New Delhi soils but organic carbon content was not altered (Kumar and Yaduraju, 1992). However, with extensive studies in different soils types and nutrient sources, it has been shown that the increases in the levels of soil nutrients are transient and do not persist long (Yaduraju and Kamra, 1997). Applicability of Soil Solarization: The technology for applying plastic films to large acreages already exists (Pullman et al., 1984) and is similar to use of soil fumigation. Solarization is also ideal for treating nurseries. Duxbury (2002) found that the combination of vitavax-200 and solarization of soil in the rice nursery controlled the root-knot nematode Meloidogyne graminicola and increased the rice yield upto 45%. He further noted that around 30-40% rice yield was increased just by solarizing the soil in the rice nursery. It is widely used in raising nurseries of tobacco and vegetables in India (Patel et al., 1995; Sudha et al., 1998; Reddy et al., 1998). Vizantinopoulos and Katrains (1993) reported that solarization gave better weed control than preemergence pendimethalin+atrazine, imazaquin+metolachlor, metribuzin+alachlor or acetachlor + atrazine at their recommended rates in maize in Greece. It can reduce the use of toxic soil fumigants. This technology may be more promising in high value crops, such as in vegetable growing, floriculture, etc. In India, pre-plant solarization films may be left in place, after plant emergence, as post-plant mulch. Soil solarization has been shown to enhance degradation of pesticide residues in soil (Gopal et al., 1997), hence could be employed for decontamination of polluted soils. Climatic conditions permitting, the home garden may benefit greatly from soil solarization. Most home gardens are planted in the same site year after year without periodic soil disinfestation treatments. Solarization could be done between crops, and in addition to providing control of garden diseases and pests, could result in earlier stand establishment, improved crop quality, and greater yields. These same benefits would apply to landscaping applications. The growth promotion of young woody perennials by solarization (Stapleton and DeVay, 1982, 1985) and the control of soil-borne diseases in established plantings have been reported (Ashworth and Gaona, 1982).

Limitations of Soil Solarization 1. There are geographical limitations on where the method can be used in terms of solar radiation availability;

176


2. The soil is occupied for at least one month with the mulch; 3. Although cheaper than most chemicals used for soil fumigation, not all crops can afford the PE prices; 4. It is difficult to protect the PE sheets from damage caused by wind and animals; 5. There is no full environmentally-accepted solution for the used PE however we can use biodegradable plastic film; 6. Not all soil-borne pests and weeds are sufficiently controlled that supplemental control methods are often needed, particularly in crops that occupy a field for a long duration; 7. Difficult to retain the films intact during period of heavy winds; 8. Removal and reuse of the film is not feasible in large-scale operations that utilize machines to lay plastic films. Conclusion: Soil solarization is an innovative idea to control different soil borne pathogen, disease, weeds, nematodes and other harmful microbes by using plastic polythene film or different type of organic mulch. Covering the moist soil for a period of 2-6 weeks during hot summer months can elevate the surface soil temperature by about 6-16 °C depending upon the soil type, moisture content, thickness of polyethylene films and the intensity of solar radiation. The possible uses of soil solarization, both pre-plant and post-plant, are being explored in field, orchard, nursery, greenhouse garden situations, and in environmental and landscape improvement. Soil solarization can be used with integration of agricultural chemicals and biological control agents. It is environmentally safe and pollution free method to control weeds and pathogen. However, the large-scale adoption of this technology has not taken place primarily due to economic reasons. Disposal and non-biodegradation of plastic in the environment are the major concerns, which need to be seriously addressed. However we can resolve the degradation problem of plastic film by using biodegradable polythene or organic material as a mulch.

References Abd-Allah, M.M.F. (1998). Improving vegetable transplant using soil solarization. II. Onion, "Allium cepa Proceedings of the Seventh Conference of Agricultural Development Research, Cario, Egypt, 15-17 December, 1998. Abdallah, M.M.F. (2000). Improving vegetable transplants using soil solarization. III. Tomato ‘‘Lycopersicon esculentum’’. Arab Univ. J. Agric. Sci., Ain. Shams Univ., Cairo 8 (3), 719–733. Ashworth, Jr.L.J. and Gaona, S.A. (1982). Evaluation of clear polyethylene mulch for controlling Verticillium wilt in established pistachio nut groves. Phytopathology 72: 243-246. Baker, K.F. and Cook, R.J. (1974). Biological control of plant pathogens. Freeman, San Francisco. Barbercheck, M.E. and Von Broembsen, S.L. (1986). Effect of soil solarization on plant-parasitic nematodes and Phytophthora cinnamomi in South Africa. Plant Dis, 70:945-450. Basavaraju, H.K. and Nanjappa, H.V. (1999). Weed dynamics in chilli-maize cropping sequences as influenced by solarization. Indian J Weed Sci 31:183-186. Bhasker, K.V., Nanjappa, H.V. and Ramachandrappa, B.K. (1998). Solarization for weed control in sunflower (Helianthus annuus L.). Mysore J Agric Sci, 32:142-147. Bourbos, V.A., Skoudridakis, M.T., Darakis, G.A. and Koulizakis, M. (1997). Calcium cyanamide and soil solarization for the control of Fusarium solani f.sp. cucurbitae in greenhouse cucumber. Crop Protection, 16:383–386. Chase, C.A., Sinclair, T.R., Shilling, D.G., Gilreath, P. and Locascio, S.J. (1998). Light effect on rhizome morphogenesis in nut sedges (Cyperus spp.): implications for control by soil solarization. Weed Sci, 46:575580. Chellemi, D.O., Olson, S.M., Mitchell, D.J., Secker, I. and McSorley, R. (1997). Adaptation of soil solarization to the integrated management of soilborne pests of tomato under humid conditions. Phytopathology, 87: 250-258. Chen, Y. and Katan, J. (1980). Effect of solar heating of soils by transparent polyethylene mulching on their chemical properties. Soil Science, 130: 271-277. Chen, Y., Gamliel, A., Stapleton, J.J. and Aviad, T. (1991). Chemical, physical, and microbial changes related to plant growth in disinfested soils. In: Katan, J., DeVay, J.E. (Eds.), Soil Solarization. CRC Press, Boca Raton, pp. 103-129. Cimen, I., Turgay, B. and Pirinc, V. (2010). Effect of solarization and vesicular arbuscular mychorrizal on weed density and yield of lettuce (Lactuca sativa L.) in autumn season. Afr. J. Biotechnol. 9 (24): 3520–3526.


177

Duxbur, J.M. (2002). Improving crop productivity and sustainability in rice (Oryza sativa)-wheat (Triticum aestivum) cropping system. Extended Summaries Vol. I. 2nd International Agronomy Congress, New Delhi, India :31-32. Eagly, G.H. (1983). weed seed and seedling reduction by solarization with transparent polythene sheet. Weed science, 31: 404:409 El-Keblawy, A. (2003). Effects of artificial accelerated aging on germination behavior of the cosmopolitan weed Chenopodium album: Implications for weed control. Pakistan Journal of Weed Science Research, 9:125– 134. Gamliel ,A. and Stapleton, J.J. (1993a). E!ect of soil amendment with chicken compost or ammonium phosphate and solarization on pathogen control, rhizosphere microorganisms, and lettuce growth. Plant Dis., 77:886891. Gill, H.K., McSorley, R. and Treadwell, D.D. (2009). Comparative Performance of Different Plastic Films for Soil Solarization and Weed Suppression. Hortechnology, (19) 4: 769-774. Gopa.l, M., Mukherjee, I. and Yaduraju, N.T. (1997). Soil solarization: A tool for decontamination of soil pesticides. Proceedings of National Seminar on Plant Protection in India. Plant Protection Association of India, December 22-24, 1997, Hyderabad, India. Habeeburrahman, P.V. and Hosmani, M.M. (1996). Effect of soil solarization on weed growth and yield of succeeding rainy season sorghum (Sorghum bicolor). Indian J Agron 41 :54-57. Haida,r M.A., Iskandarani, N., Sidahmed, M. and Baalbaki, R. (1999). Response of “field dodder” (Cuscuta campestris) seeds to soil solarization and chicken manure. Crop Protection 18: 253–258. Horowitz, M., Regve ,Y. and Herzlinger, G. (1983). Solarization for weed control. Weed Sci, 131 : 170-179. Katan, J. (1981). Solar heating (solarization) of soil for control of soil-borne pests. Annu Rev Phytopathol, 19: 211-236. Katan, J. (1984). "Soil solarization." In Second International Symposium on Soil Disinfestation. Acta Hortic No. 152, C. Van Assche, ed. Leuven, Belgium, International Society for Horticultural Science, 1984,Wageningen, Netherlands, p. 227. Katan, J. (1987). Soil solarization. In: Chet, I. (Ed.), Innovative Approaches to Plant Disease Control. Wiley, New York, pp. 77-105. Katan, J., Greenberger, A., Alon, H. and Grinstein, A. (1976). Solar heating by polyethylene mulching for the control of diseases caused by soil-borne pathogens. Phytopathology, 66: 683-688. Kumar, B. and Yaduraju, N.T. (1992). Effect of soil solarization on the temperature and physico-chemical properties of soil. Plasticulture, 94: 13-20. Kumar, B., Yaduraju, N.T. Ahuja, K.N. and Prasad, D. (1993). Effect of soil solarization on weeds and nematodes under tropical Indian conditions. Weed Res, 33: 423-429. Kurt, K. and Emir, B. (2004). Effect of soil solarization, chicken litter and viscera on populations of soil borne fungal pathogens and pepper growth. Plant Pathol. J., 3(2), 118–124. Linke, K.H., Saxena, M.C., Sauerborn , J. and Marsi, H. (1990). Effect of soil solarization on the yield of food legumes and on pest control- Proceedings of the first International Conference on Soil Solarization, Amman, 139-147, 1990. Malik, M.A.S. and Tran, V. (1973). “A simple mathematical model for predicting the nocturnal output of a solar still”, Sol. Energy, 14: 371–385 Martin, F.N. (2003). Development of alternative strategies for management of soilborne pathogens currently controlled with methyl bromide. Annual Review of Phytopathology, 41: 325–350. McDonald, B.A. and Linde, C. (2002). Pathogen population genetics, evolutionary potential, and durable resistance. Annual Review of Phytopathology, 40: 349–379. Mudalagiriappa , N.H.V. and Ramachandrappa, B.K. (1999). Effect of soil solarization on weed growth and yield of kharifgroundnut (Arachis hypogaea). Indian J Agron 44: 396-399. Patel, H.R., Makwana, M.G. and Patel, B.N. (1995). The control of nematodes and weeds by soil solarization in tobacco nurseries. Plasticulture, 107:21-27 Pinkerton, J.N., Ivors , K.L., Miller, M.L. and Moore, L.W. (2000). Effect of soil solarization and cover crops on populations of selected soilborne plant pathogens in western Oregon. Plant Disease, 84: 952–960. Reddy, C.N., Reddy, M. D. and Devi, M.P. (1998). Solarization for weed control in vegetable nurseries. Indian J Weed Sci, 30:88-89. Reddy, C.N., Reddy, M.D. and Devi, M. P. (1998). Solarization for weed control in vegetable nurseries. Indian J Weed Sci, 30:88-89. Reddy, P.P. (2013). Recent Advances in Crop Protection. DOI 10.1007/978-81-322-0723-8_11, © Springer India Heidelberg New York Dordrecht, London, PP. 159-183. Ricci, M.D., De Almeida, D.L., Ribeiro, R.D.L., De Aquino, A.M., Pereira, J.C., De-Polli, H., Reis, V.M. and Eklund, C.R. (1999). Cyperus rotundus control by solarization. Biological Agriculture & Horticulture, 17(2): 151-157.

178


Rubin, B. and Benjamin, A. (1984). Solar heating of the soils: involvement of environmental factors in the weed control process. Weed Sci, 32:138-142. Rupela, O.P. and Sudarshana, M.R. (1990). Displacement of native rhizobia nodulating chickpea (Cicer arietinum L.) by an inoculant strain through soil solarization. Bioi. Fertil. Soils 10: 207-212. Schreiner, R.P., Ivors, K.L. and Pinkerton, J.N. (2001). Soil solarization reduces arbuscular mycorrhizal fungi as a consequence of weed suppression. Mycorrhiza, 11:273-277. Singh, V.P., Dixit, A., Mishra, J. S. and Yaduraju, N.T. (2004). Effect of period of soil solarization and weedcontrol measures on weed growth, and productivity of soybean (Glycine mart). Indian Journal of Agricultural Science, 74(6): 324-328. Sinigaglia, C., Patrıcio, F.R.A., Ghini, R., Malavolta, V.M.A., Tessarioli Neto, J., Freitas, S.S. and Stapleton, J.J. (1997). Mode of action of solarization and bio-fumigation. Proceedings of the 2"d International Conference on Soil Solarization and Integrated management of soil-borne pests, 16-21 March, 1997, Aleppo, Syria. Sinigaglia, C., Patrício, F.R.A., Ghini, R., Malavolta, V.M.A., Tessarioli, J. and Freitas, S.S. (2001). Controle de Sclerotinia minor, Rhizoctonia solani e plantas daninhas em alface pela solarização do solo e sua integração com controle químico. Summa Phytopathologica, 27(2): 229-235. Stapleton, J.J. and Devay, J.E. (1985). Soil solarization as a post-plant treatment to increase growth of nursery trees. Phytopathology, 75: 1179 (abstract). Stapleton, J.J. (1997). Soil solarization: an alternative soil disinfestation strategy comes of age. UC Plant Protection Quarterly, 7: 1-5. thogens. Phytopathology, 66: 683-688. Stapleton, J.J. (1997). Solarization: An implementable alternative for soil disinfestation. In: Canaday, C. (Ed.), Biological and Cultural Tests for Control of Plant Diseases, Vol. 12. APS Press, St. Paul, pp. 1-6. Stapleton, J.J. (2000). Soil solarization in various agricultural production systems. Crop Science, 37: 837-841. Stapleton, J.J. and DeVay, J.E. (1986). Soil solarization: a non-chemical approach for management of plant pathogens and pests. Crop Prot, 5:190-198. Stapleton, J.J. and DeVay, J.E . (1982). Effect of soil solarization on populations of selected soil-borne microorganisms and growth of deciduous fruit tree seedlings. Phytopathology , 72: 323-326. Stapleton, J.J. and DeVay, J.E. (1984). Thermal components of soil solarization as related to changes in soil and root microflora and increased plant growth response. Phytopathology, 74:255-259. Stapleton, J.J. and DeVay, J.E. (1995). Soil solarization: A natural mechanism of integrated pest management. In: Reuveni, R. (Ed.), Novel Approaches to Integrated Pest Management. Lewis Publishers, Boca Raton, pp. 309-322. Stapleton, J.J., Quick, J., and Devay, J.E . (1985). Soil solarization: effect on soil properties, crop fertilization and plant growth. Soil Biology and Biochemistry, 17: 369-373. Stevens, C.V., Khan, T., Okoronkwo, A.Y., Tang, M. A., Wilson, J.L. and Brown, E. (1990). Soil solarization and dacthal: Influence on weeds, growth, and root microflora of collards. HortScience, 25:1260–1262. Sudha, T., Nanjappa, H.V., and Udikeri, S.S. (1998). Influence of solarization on weed management in tomato and tobacco nursery. Mysore J Agric Sci, 32: 269-274. Tamietti, G., and Valentino, D. (2006). Soil solarization as an ecological method for the control of Fusarium wilt of melon in Italy. Crop Protection, 25: 389–397. Vizantinopoulos, S. and Katranis, N. (1993). Solarization in Greece. Weed Res, 33:225-230. Waggoner, P. E., Miller, P.M. and De Roo, H.C. (1960). Plastic mulching: principles and benefits. Conn Agric Exp Stn Bull., 634: 4.4 pp. Yaduraju, N.T. (1993). The role of soil-solarization in weed management. Proceedings of International Symposium. Indian Society of Weed Science, Hisar, November 18-20, 1993, 1:343-349 Yaduraju, N.T. (1993). The role of soil-solarization in weed management. Proceedings of International Symposium. Indian Society of Weed Science, Hisar, November 18-20, 1993; 1: 343-349. Yaduraju, N.T. and Kamra, A. (1997). Soil solarization-a novel non-chemical method of pest control. In Ecological Agriculture and Sustainable Development, Vol.2, Proceedings of the International Conference on Ecological Agriculture Towards Sustainable Development, Chandigarh, India, 15-17 November, 1997. (Edited by Dhaliwal, G.S., Arora, R.,Randhawa, N.S., Dhawan, A.K.). Indian Ecological society, Chandigarh, 2:189-201. Yaduraju, N.T. and Kamra, A. (1997). Soil solarization-a novel non-chemical method of pest control. In Ecological Agriculture and Sustainable Development, Vol.2, Proceedings of the International Conference on Ecological Agriculture Towards Sustainable Development, Chandigarh, India, 15-17 November, 1997. (Edited by Dhaliwal, G.S., Arora, R.,Randhawa, N.S., Dhawan, A.K.). Indian Ecological Society, Chandigarh, 2:189-201. Yaduraju, N.T. Mishra, J.S. (2004). Weed Biology and Management, Kluwer Academic Publishers.345-362.

EFFECT OF INTEGRATED NUTRIENT MANAGEMENT ON PHYSICOCHEMICAL PROPERTIES OF SOIL AND GROWTH AND YIELD OF HYBRID MAIZE (Zea mays L.) VAR. HYBRID 9637 T. Thomas, P. Smriti Rao, Gitesh Dewangan and Sinha Parshottam Department of Soil Science, Sam Higginbottom Institute of Agriculture, Technology & Sciences (Deemed-to-be-University), Allahabad, 211 007 U. P., India, Corresponding Author: T. Thomas

M

aize is one of the world’s leading crop cultivated over an area of 139 million ha. with a production of about 600 million tonnes of grain. USA leads the largest area, followed by Brazil, China, Mexico and India. Maize is grown in almost all states of India occupying an area of 6 m ha with the production and productivity of 9.7 million tonnes and 1.7 t ha-1, respectively (Kumar et. al.2007). Maize is one of the important cereal crops in the world agricultural economy both as food grains for human and fodder and feed for cattle and poultry. Maize grain contains about 72% starch, 10% protein, 4.8% oil, 5.8% fibre, 3.0% sugar and 1.7% ash (Choudhary, 1993). Along with this, it is rich in vitamin A, vitamin E, nicotinic acid, riboflavin and contains fairly high phosphorus than rice and sorghum. Its fodder and hay contain 7-10% protein, 15-36% fibre, 2.09 to 2.62% ether extract, 0.42-0.70% Calcium, 0.28-0.29% phosphorus, 0.45% Magnesium, 1.34% Potassium and 56% carbohydrate, therefore, it has very nutritive fodder and hay. Besides food grain, fodder and feed, it has prime importance in textile, starch and dye industries (Rai 2006). Nitrogen is a vitally important for plant nutrient. Nitrogen is essential constituent of protein and is present in many other compound of great physiological importance in plant metabolism. Nitrogen is called a basic constituent of life. Nitrogen also impart vigorous vegetative growth dark green colour to plant and it produce early growth of maize. Nitrogen governs the utilization of potassium, phosphorus and other elements in maize crop (Singh et al. 2010). Phosphorus has a great role in energy storage and transfer and closely related to cell division and development of maize. Phosphorus is a constituent of nucleic acid, phytin and phospho-lipid. Phosphorus compound act as “energy currency” within plants. Phosphorus is essential for transformation of energy, in carbohydrate metabolism, in fat metabolism, in respiration of plant and early maturity of maize (Singh et al. 2010). Potassium play important role in formation of protein and chlorophyll and it provide much of osmotic “pull” that draw water into plant roots. Potassium produces strong stiff straw in maize and reduce lodging in maize. Potassium imparts increase vigour and disease resistance to plant (Singh et al. 2010). Zinc play important role in the correct functioning of many enzyme systems, the synthesis of nucleic acids and auxins (plant hormones) metabolisms, protein analysis and normal crop development and growth (Mengel and Kirkby, 1982, Havlinet al., 2006). Phosphorus and zinc, though essential for plant growth, are antagonistic to each other in certain circumstances, such as when P is supplied in high levels and Zn uptake becomes slower or inadequate (Mengel and Kirkby, 1979). This may be as a result of slower rate of translocation of Zn from roots to tops, i.e. zinc accumulation in the roots and lower Zn uptake (Stukenholtzet al., 1966). Plants absorb Zn in the form of Zn2+. The functional role of Zn includes auxins metabolism, nitrogen metabolism, influence on the activities of enzymes, cytochrome c synthesis and stabilization of ribosomal fractions and protection of cells against oxidative stress (Tisdale et al., 1997; Obata et al., 1999). Poor growth, interveinalchlorosis and necrosis of lower leaves are the common symptoms of Zn deficiency in field crops (Paramasivanet al. 2011). FYM (Farm Yard Manure) helps to improve and conserve the fertility of soil. FYM imparts dark color of the soil and thereby help to maintain the temperature of soil. The activity and population of beneficial soil organisms increased on application of FYM in soil. FYM is one of the oldest manure used by the farmer is growing crops because of its early availability and presence of almost all the nutrient required by plant. The composition of FYM is 0.50 % N, 0.25 % P and 0.50 % K (Nair 2000). Azotobactorcan be used as a Biofertilizers for most non leguminous annual and perennial crops for the nutrition of nitrogen rice, cotton, sugarcane are some examples. Azotobactor act in

180


temperate zone soils having pH 6.5-8.0. It fixes the nitrogen @ 5-20 kg N ha-1/year in the soil. Seed treatment, seedling dipping and soil application methods are use for Azotobactor application. For seed treatment 200 g Azotobactor used for 10 kg seed. For seedling dipping prepare the suspension of required amount of inoculants in water in the ratio of 1: 10 and applied 3- 5 kg Azotobactor inoculums mix with 5 t FYM for one hectare soil application (Balyanet al. 2008). Phosphorus Solubilising bacteria and fungi play an important role in converting insoluble phosphatic compound such as rock phosphate, bone meal and basic slag particularly the chemically fixed soil phosphorus into available form. Materials ad Methods A field Experiment was conducted on research farm of department of Soil Science, Allahabad School of Agriculture, Sam Higginbottom Institute of Agriculture, Technology & Sciences (Deemedto-be-University) Allahabad,(U.P.) India. The soil of experimental area falls in order Inceptisol and the experimental field is alluvial in nature. The design applied for statistical analysis was carried out with 3x2x2factorial randomized block design having three factors with three levels of NPK @ 0, 50, and 100% ha-1, two levels of Zinc 0 and 100% ha-1 and two level of FYM, Azotobactor and PSB 0 and 100 ha-1 respectively. Treatments were T0-(L0+F0+Z0) @ 0% NPK ha-1 + @ 0% FYM, Azotobactor and PSB ha-1 + 0% Zinc ha-1, T1- (L0+F0+Z1) @ 0% NPK ha-1 + @ 0% FYM, Azotobactor and PSB ha-1 + 100%Zinc ha-1, T2-(L0+F1+Z0) @ 0%NPK ha-1 + @ 100% FYM, Azotobactor and PSB ha -1 + 0% Zinc ha-1,T3- (L0+F1+Z1) @0%NPK ha-1 + @ 100% FYM, Azotobactor and PSB ha-1 + 100% Zinc ha-1, T4-(L1+F0+Z0) @50%NPK ha-1+@ 0% FYM, Azotobactor and PSB ha-1 + 0% Zinc ha-1, T5- (L1+F0+Z1) @ 50%NPK ha -1 + @ 0% FYM, Azotobactor and PSB +100%Zinc ha-1,T6- (L1+F1+Z0) @ 50%NPK ha-1 + @ 100% FYM, Azotobactor and PSB ha-1 + 0% Zinc ha-1, T7- (L1+F1+Z1) @ 50% NPK ha-1 + @ 100%FYM, Azotobactor and PSB ha-1 + 100%Zinc ha-1,T8- (L2+F0+Z0) @100%NPK ha-1 + @ 0% FYM, Azotobactor and PSB ha-1 +@0%Zinc ha-1,T9-(L2+F0+Z1) @ 100% NPK ha-1 + @ 0% FYM, Azotobactor and PSB ha-1 + @100%Zinc ha-1,T10-(L2+F1+Z0) @100%NPK ha-1+@ 100% FYM, Azotobactor and PSB ha-1 +@ 0% Zinc ha-1, T11-(L2+F1+Z1) @100%NPK ha-1 + @ 100% FYM, Azotobactor and PSB ha-1 + @ 100% Zincha-1.The source of Nitrogen, Phosphorus, Potassium, Zinc, FYM, Azotobactor, PSB as Urea, SSP, MOP, Zinc Sulphate, FYM, azotobactor and Pseudomonas striata respectively. Basal dose of fertilizer was applied in respective plots according to treatment allocation unifurrows opened by about 5cm. depth before sowing seeds in soil at the same time sowing of seeds was sown on well prepared beds in shallow furrows, at the depth of 5cm, row to row distance was maintained at 50cm and plant to plant distance was 20cm, during the course of experiment, observations were recorded as mean values of the data. The soil analysis was done in the laboratory of Soil Science and Agriculture Chemistry, SHIATS.-DU, Allahabad with following standard methods, Results and Discussions The results given in table-1 indicate some of the important parameters of plant height (cm), No. of leaves per plant, leaf length (cm), in maize crop. The maximum Plant height, No. of leaves per plant, leaf length, cob lengthof maize increased significantly and progressively with the increasing level of N, P, K, Zn, and FYM, Azotobactor and PSB at 90 DAS was to be significant, the increased levels of N P K (@ L2- N120P60K60 kg ha-1) was recorded as 177.51, 13.39 , 68.96, 18.35 respectively with Zinc Sulphate in level Z1 (@20 kg ha-1) 156.36, 11.09, 64.75, 16.84 was found to be significant at 90 DAS to be significant and increasing level of farm yard manure Azotobactor and PSB F1 (FYM@ 10t ha-1, Azotobactor @ 200 gm/10kg seed and PSB @ 250 gm/ 10 kg seed) 158.46, 11.44, 65.07, 16.47 was found to be significant at 90 DAS. The results given in indicate some of the important seed yield, dry weight, test weight on maize crop. The interactive effects of N P K generally influenced the important seed yield, dry weight, test weight on maize crop. The seed yield ( q ha-1), dry weight (g), test weight (g), no. of grain per cobof maize increased significantly and progressively with the increasing level of of N, P, K, Zn, and FYM, Azotobactor and PSB at 90 DAS was to be significant, the increased levels of N P K (@ L2- N120P 60K60 kg ha-1) maximum seed yield, dry weight, test weight, no. of grain per cob 49.76, 175.66, 218.17, 331.69 was recordedas respectively, with Zinc Sulphate in level Z1 (@ 20 kg ha-1) maximum seed yield, dry weight, test weight no. of grain per cob was recorded 42.17, 163.84, 211.61, 292.83 was found to be

Effect of Integrated Nutrient Management on Physico-Chemical Properties of Soil……

181

significant at 90 DAS respectively. Increasing level of farm yard manure Azotobactor and PSB F1 (FYM@ 10 t ha-1, Azotobactor @ 200 g 10 kg-1 seed and PSB @ 250 g 10 kg-1 seed) maximum seed yield, dry weight, test weight no. of grain per cob was recorded 42.67, 165.37, 212.61, 297.33 was to be found significant respectively. Table 1: Effect 90 days after sowing field of different levels of N, P, K, Zn, and FYM, Azotobactor and PSB on growth and yield of maize (Zea mays L.) var. hybrid 9637. Treatment combination T0 (L0+F0+Z0) T1(L0+F0+Z1) T2(L0+F1+Z0) T3(L0+F1+Z1) T4(L1+F0+Z0) T5(L1+F0+Z1) T6(L1+F1+Z0) T7(L1+F1+Z1) T8(L2+F0+Z0) T9(L2+F0+Z1) T10(L2+F1+Z0) T11(L2+F1+Z1) F- test S. Em () C. D. at 5%

Plant Height (cm) 132.56 135.34 137.64 140.52 143.55 145.94 148.87 156.08 168.55 173.81 181.17 186.50 S 0.47 0.96

No. of Leaves 7.89 8.33 8.89 9.22 9.44 9.77 10.33 11.00 11.78 12.55 13.55 15.66 S 0.07 0.15

Leaf Length (cm) 52.34 59.14 59.86 60.19 62.04 63.88 63.58 66.03 66.93 68.12 69.63 71.15 S 0.64 1.30

Cob Length (cm) 11.90 12.89 14.30 14.91 15.31 16.34 16.65 17.59 17.79 18.01 18.50 19.12 S 0.0096 0.0047

Dry weight (g) 146.00 147.55 151.66 153.77 156.22 158.89 160.44 163.55 167.33 172.55 176.22 186.55 S 0.28 0.58

Test weight (g) 192.33 201.00 203.67 205.33 208.33 210.00 212.33 213.67 214.00 218.00 219.00 221.67 S 0.93 1.88

Seed yield (q ha-1) 26.33 30.56 30.70 35.12 36.84 39.60 42.01 43.93 45.98 48.82 49.27 55.00 S 0.24 0.48

No. of grain Per Cob 247.66 252.55 256.88 257.33 266.88 268.55 278.22 294.00 304.55 324.66 337.66 359.89 S 1.24 2.51

(C:B) Ratio 1 : 2.00 1 : 1.98 1 : 1.69 1 : 1.72 1 : 2.61 1 : 2.45 1 : 2.15 1 : 2.04 1 : 3.05 1 : 2.83 1 : 2.45 1 : 2.51

Physical Properties: The results given in (table-2) indicate some of the important on Physical Properties on maize crop. The interactive effects of N P K generally influenced the important in Physical Properties on maize crop. The effect of N P K fertilizer on Pore space was non-significant and Bulk density, Particle density, water retaining capacity was significant. The maximum Particle density (gcm-3), Bulk density (gcm-3), Pore space (%), water retaining capacity (%) of after crop harvest soil was recorded 2.60, 1.28, 49.13, 54.82 (@ L2- N120P60K60 kg ha-1)respectively, with Zinc Sulphate in level Z1 (@ Zn 20 kg ha-1) 2.50, 1.23, 48.59, 53.24was found to be non-significant and Increasing level of farm yard manure Azotobactor and PSB F1 (FYM@ 10t ha-1, Azotobactor @ 200 g/10kg seed and PSB @ 250 g/ 10 kg seed) 2.50, 1.24, 48.91 was found non significant and water retaining capacity (%) 52.60 was found significant. Chemical Properties of Post Soil: During the course of study, it was observed that the highest pH (dSm-1) was recorded in7.63 (T0- L0Z0@ 0% N P K ha-1 + 0% ZnSO4 ha-1) and the lowest of 7.03 was recorded with the application of Treatment T8 (L2F1R0 - @ 100% N P K ha-1+ 100% ZnSO4 ha-1). If we compare the pH of pre sowing soil sample which was 7.80 with that of after crop harvest soil, there is decrease in pH after crop harvest. Increasing dose of N P K and ZnSO4 slightly decrease the Soil pH of the post harvest soil. The decrease in pH (dSm-1) might be due to higher growth of crops as respiration is more. Respiration evolves carbon dioxide and reacts with water to form carbonic acid in soil. The Electric conductivity (dSm-1), Organic carbon (%), Available Nitrogen, Phosphorus and Potassium (kg ha-1), available Zinc (mg kg-1) of soil after crop harvests. The Chemical Propertieswas significantly affected by different treatment combination of N, P, K, Zn, and FYM, Azotobactor and PSB. The effect of N P K fertilizer on Organic carbon (%), Phosphorus, Potassium (kg ha-1), Electric conductivity (dSm-1), Available Nitrogen, available Zinc significant the maximum Chemical Properties of after crop harvest soil was recorded Electric conductivity (dSm-1), Organic carbon (%), Available Nitrogen, Phosphorus, Potassium (kg ha-1), and Zinc(mg kg-1) 0.35, 0.67, 319.60, 30.61, 200.22, 0.52(L2- N120P60K60 kg ha-1)respectively, with Zinc in level Z1 (Zn 20 kg ha-1) 0.34, 0.64, 306.49, 28.19, 179.51, 0.43Organic carbon (%) and Potassium was found non-significant and Phosphorus (kg ha-1), Electric conductivity (dSm-1), Available Nitrogen, available Zinc found to be significant. Increasing level of farm yard manure Azotobactor and PSB F1 (FYM@ 10t ha-1, Azotobactor @ 200 g/10kg seed and PSB @ 250 g/ 10 kg seed) 0.34, 0.63, 307.54, 28.50, 181.38, 0.45 Potassium was found non-significant and %organic carbon Phosphorus (kg ha-1), Electric conductivity (dSm-1), Available Nitrogen, available Zinc found to be significant.

182


Table 2: Effect of different levels of N, P, K, Zn, and FYM, Azotobactor and PSB on Physico-chemical properties of post harvest soil of maize (Zea mays L.) Var. hybrid 9637. Treatment combination

Bd (gcm3 )

Pd (gcm3)

T0 (L0+F0+Z0) T1(L0+F0+Z1) T2(L0+F1+Z0) T3(L0+F1+Z1) T4(L1+F0+Z0) T5(L1+F0+Z1) T6(L1+F1+Z0) T7(L1+F1+Z1) T8(L2+F0+Z0) T9(L2+F0+Z1) T10(L2+F1+Z0) T11(L2+F1+Z1) F- Test S. Em () C. D. at 5%

1.13 1.15 1.18 1.20 1.20 1.22 1.22 1.25 1.25 1.28 1.28 1.30 NS 0.05 -

2.22 2.31 2.31 2.41 2.41 2.52 2.52 2.43 2.43 2.62 2.62 2.73 NS 0.20 -

Pore space (%) 44.72 47.78 47.91 50.01 47.78 47.91 48.75 46.94 48.75 47.91 48.88 50.98 NS 3.38 -

Water holding Capacity (%) 48.54 50.95 49.46 50.95 51.93 52.85 51.51 53.28 52.43 55.24 54.20 56.19 NS 1.47 -

pH (1:2 w/v)

EC (dSm-1)

O.C. (%)

N (kg ha1 )

P2O5 (kg ha1 )

K2 O (kg ha1 )

7.57 7.50 7.53 7.50 7.43 7.30 7.40 7.30 7.30 7.27 7.17 7.20 S 0.006 0.013

0.31 0.32 0.33 0.33 0.33 0.33 0.34 0.34 0.35 0.35 0.35 0.36 S 0.01 0.01

0.56 0.58 0.57 0.61 0.61 0.63 0.59 0.64 0.61 0.69 0.66 0.72 NS 0.02 -

287.12 289.21 290.26 295.45 298.54 302.83 303.88 307.02 312.26 317.50 321.69 326.93 S 0.37 0.76

23.56 24.70 25.29 25.59 26.19 27.39 28.37 29.19 29.19 30.68 30.98 31.58 S 0.03 0.07

152.69 157.18 157.18 158.67 169.90 173.64 177.39 179.63 190.86 194.60 202.09 213.31 NS 11.87 -

Zn (mg kg-1) 0.17 0.23 0.30 0.33 0.27 0.37 0.37 0.47 0.33 0.50 0.57 0.67 S 0.01 0.02

Conclusion: It was concluded from trail that the various levels of integrated nutrients use from different sources in the experiment, The combined application of NPK fertilizers @ N120P60K60 kgha-1 + FYM@ 10t ha-1, Azotobactor @ 200 gm/10kg seed and PSB @ 250 gm/ 10 kg seed + zinc @ 0 kg ha-1, 20 kg ha -1 found to be the best in increasing plant height (186.50 cm), no. of leaves per plant (15.66), leaf length (71.15 cm), cob length (19.12 cm), no. of grain per cob(359.89) dry weight (186.55g) test weight (221.67g) grain yield (55 q ha-1) and the physical and chemical properties of soil such as bulk density (1.30Mgm-3), particle density (2.73 Mgm-3), % pore space (50.98%), water retaining capacity (56.19%), EC (0.36 dSm-1), pH (7.20), % organic carbon (0.72%), available N (326.93 kg ha-1), P (31.58 kg ha-1), K (213.31 kg ha-1), Zn (0.67 mgkg-1) found to that any other treatment combination. The maximum net return Rs. 64403 ha-1. Since the result is based on one season experiment, further trial is needed to substantiate the results. Acknowledgement: The author are thankful to the Hon’ble Vice Chancellor, HOD and Advisor, Department of Soil Science, Sam Higginbottom Institute of Agriculture, Technology & Sciences (Deemed-to-be-University), Allahabad, U. P., for providing all necessary facilities, clarify studies. References Balyan, J. K., Singh P., Kumpawat, B. S. and Jat, M. L. (2008). Effect of organic manure, fertilizer level and biofertilizers on soil nutrients balance in maize (Zea mays L.) Research on Crops. 9(2): 308-310. Black, C.A. (1965). Methods of soil analysis.Vol.I.Am. Soc. Agron. Madison, Wisconsin, U.S.A. Buoyoucos, G.J. (1952) A recalibration of the hydrometer method for making mechanical analysis of soil, 43, 434. Fisher, R. A. (1950). Technique of Analysis of Variance .Handbook of Agricultural Statistics B-29- 110. Jackson, M. L. (1958). Soil chemical analysis, Prentice Hall, Inc, Englewood Cliffe, N.J. Kumar, P., Halepyati, A.S., Pujari, B.T. and Desai, B.K. (2001). Effect of Integrated Nutrient Management on Productivity, Nutrient Uptake and Economics of Maize (Zea mays L.) Under Rainfed Condition, Karnataka J. Agric. Sci., 20(3): 462-465 Nair, A. K., (2000) Effect of farmyard manure and fertilizer level on yield at maize (Zea mays L.) crop in Sikkim, Journal Agri. Sci. 70: 4 229-240. Olsen, S.R., Cole, C.V., Watnahe, F.S. and Dean, L.A. (1954). Estimation of available phosphorus in soils by extraction with sodium bicarbonate U.S. Deptt. Agr. Circ. 939. Paramasivan, M., Kumaresan, K. R., Malarvizhi, P., Mahimairaja, S. and Velayudham, K. (2011). Effect of different levels of NPK and Zn on yield and nutrient uptake of hybrid maize (COHM 5) (Zea mays L.) in Madhukkur (Mdk) series of soils of Tamil Nadu. Asian Journal of Soil Science. 5(2): 236-240. Rai, M. (2006). Effect of integrated nutrient management local and hybrid varieties of maize (Zea mays L.) yield. Hand Book of Agriculture 872-886. Singh, M. K., Singh, R. N., Singh, S. P., Yadav, M. K. and Singh, V. K. (2010). Integrated nutrient management for higher yield, quality and profitability of baby corn (Zea mays). Indian Journal of Agronomy. 55(2): 100-104. Suke, S.N., Deotale, R.D., Hiradeve P., Deogirker M. and Sorte, S.N. (2011). effect of nutrients and biofertilizer of chemical and biochemical parameter of Maize (Zea mays L.) J. soil and crop 21 (1): 107-112. Toth, S.J. and Prince, A.L. (1949). Estimation of Cation Exchange Capacity and exchangeable Ca, K and Na content of soil by Flame Photometer technique. Soil Sci. 67: 439-445. Walkey, A. and Black, I. A. (1947). Critical examination of rapid method for determining organic carbon in soils, effect of variance in digestion conditions and of inorganic soil constituents. Soil sci pp.632:251. Wilcox L.V. (1950) Electrical conductivity, Amer. Water works Assoc. J. 42: pp 775-776 .

AN APPRAISAL OF SEASONAL VARIATIONS IN THERMAL INDICES, HEAT AND WATER USE EFFICIENCY IN MANGO Tarun Adak, Kailash Kumar and Vinod Kumar Singh ICAR- Central Institute for Subtropical Horticulture, Lucknow-226101, Uttar Pradesh, India, E-mail: tarunadak@ gmail.com, Corresponding Author: Tarun Adak

K

nowledge on the variations in weather parameters during the crop growing season is essentially important owing to understand the climate change impacts on the crop husbandry (Rajan, 2008). The energy received during the onset of critical phenological stage is depended on the sites/locations and the energy-matter interactions finally outcome of the source-sink relationship (Davenport, 2003). Any change in the energy amount will untimely affects the quantity as well as quality of the produce. Rajan (2012) observed the phenological response of mango crop to the changing climatic conditions particularly temperature and rainfall. It is well known fact that the seasonal changes in weather parameters particularly temperature dynamics have enormous influence on the phenology of the crop. Analysis of long time weather data series indicated changing in flowering time and growing season across different trees. Szabó et al. (2016) recorded a strong correlation of temperature 60 days prior to flowering (February to April) to the timing of lily of valley flowering. A similar advancement in onset of mango flowering was also evidenced under subtropical Lucknow, U.P. Indian condition (Rajan et al., 2011). Likewise seasonal changes in rainfall, another important weather parameter also influence the water use system as well as productivity in mango. Changes in pattern of rainfall, its quantity, intensity, frequency and distribution ultimately have a bearing on the fruit productivity. Absence of optimum rainfall during fruit set and fruit growth stages enhances the chances of poor fruit set, higher fruit drop, lower fruit size and ultimately reduced fruit yield. It has been recorded that unseasonal rainfall during flower bud initiation and early flowering stages extents the flowering period. Dinesh and Reddy (2012) observed that unseasonal rains and high humidity may initiate flowering at unsynchronized way at flowering phenological stages in an unseasonal way. The vulnerability on mango crop to weather variations is also studied under subtropical condition. Adak et al. (2013) observed that extended cold period (Tmin95% relative humidity and Walstad et al. (1970) also reported that B. bassiana required above 92.5% RH for luxuriant mycelial growth. Local isolate of B. bassiana was able to grow well between 10 to 35 °C temperature and at 52% to 100% RH. Since, during two major cropping seasons, the Kharif and the Rabi, temperature and RH in north-central India remains in the range of suitable growth of the test fungus. It is very good indication towards use of this strain for use as biocontrol agent against H. armigera. References Aneja, K. R. (1996). Experiments in microbiology, plant pathology and tissue culture, pp. 31-34. Vishwa Prakashan, A division of Wiley Eastern Limited, New Delhi, India. Armes, N. J., Wightman, J.A., Jadhav, D.R. and Ranga Rao, G.V. (1997). Status of insecticide resistance in Spodoptera litura in Andhra Pradesh, India. Pesticide Science, 50: 240-248. Fargues, J., Goettel, M.S., Smits, N, Ovedra, A. and Roughier. (1997). Effect of temperature on vegetative growth of B. bassiana isolation from different origins. Mycologia, 89: 383-392. Fitt, G.P. (1989). The ecology of Heliothis species in relation to agro ecosystems. Annual Review of Entomology, Palo Alto, 34: 17-52. Goettel, M.S and Roberts, D.W. (1992). Mass production, Formulation and Field Application of Entomopathogenic Fungi. pp. 230-238. In: Lomer, C.J. and C. Prior (Eds.) Biological Control of Locusts and Grasshoppers Wallingford, Oxon, UK, CAB International. Guo, Y. Y. (1997). Progress in the researches on migration regularity of Helicoverpa armigera and relationships between the pest and its host plants. Acta Entomologica Sinica, Beijing, 40: 1-6. Hallsworth, J. E. and Magan, N. (1996). Culture age, temperature and pH affect the polyol and trehalose contents of fungal propagules. Applied Environ. Microbiol, 62: 2435-2442. Iqbal, N and Mohyuddin, A.I. (1990). Eco. Biology of Heliothis spp in Pakistan. Pakistan Journal of Agricultural Research. 2: 257-266. Jenkins, N.E., Heviefo, G., Langewald, J., Cherry, A.J. and Lomer, C.J. (1998). Development of mass production technology for aerial conidia for use as mycopesticides. Biocontrol New and Information, 19: 21-31. Lammers, J. and Macleod, W. (2007). A report of a pest risk analysis: Helicoverpa armigera (Hübner, 1808). Plant Protection Service (NL) and Central Science Laboratory (UK) joint Pest Risk Analysis for Helicoverpa armigera.

202


Manjunath, T.M., Bhatnagar, V.S., Pawar, C.S. and Sitanathan, S. (1989). Economic importance of Heliothis in India and assessment of their natural enemies and host plants. P. 197-228. In: Proceedings of Workshop on Biological Control of Heliothis Increasing the Effectiveness of Natural Enemies (Eds. E.G. King and R.D. Jackson), Far East Regional Office, USDA, New Delhi India, 550 pp. Mc Coy, C.W. (1996). Entomogenous Fungi as Microbial Pesticides. Pp. 139-159. In: Baker,R.R and P.E. Dunn,(Eds.).New Directions in Biological Control. A.R. Liss,Newyork. Moral Garcia, F. J (2006). Analysis of the spatiotemporal distribution of Helicoverpa armigera (Hübner) in a tomato field using a stochastic approach. Biosystems Engineering, Bedford, 93: 253-259. Nancy Shophiya, J., Sahraj, K., Kalairasi, J.M.V. and Jebitta M. Shrilin. (2014). Biocontrol potential of entomopathogenic fungus Beauveria bassiana against Pericallia richi Fab (Lepidoptera: Arctidae) larvae. Biolife “An international quarterly journal of biology and lifesciences”, 2: 813-824. Sabbour, M.M., Ragei, M. and Abd-El-Rehman. (2011). Effect of some ecological factors on the growth of Beauveria bassiana and Paecilomyces fumoroseus against Corn bores. Austrian Journal of Basic and Applied sciences, 5: 228-235. Sahayaraj, K., Selvarj, P. and Balasu bramanian, R. (2007). Cell mediated immune response of Helicoverpa armigera Hubner and Spodoptera litura Fabricius to Fern Phytoecdysteron. Journal of Entomology, 4: 289298. Stark, J. D. and Banks, J. E. (2003). Population-level effects of pesticides and other toxicants on arthropods. Annual Review of Entomology, 48: 505-519. Walstad, J.D., R.F. Anderson and Stambaugh, W.J. (1970).Effect of environmental conditions on two species of muscardine fungi (Beauveria bassiana and Metarhizium anisopliae). J. Invertbrate Pathology, 2: 221-22. Young, S.E., S. KwangHee, S., DongHa, K., KiDuk, J., Cheol, Y., Young Man and Yong, P.H. (2002). Cultivation optimization of insect –pathogenic fungi Paecilomyces Iilacinus HY-4 to soil –pest Adoretus tenuimaculatus. Kor. J. Entomol., 32: 133-139. Zalucki, M. P. et al. (1986). The biology and ecology of Helicoverpa armigera (Hübner) and H. punctigera Wallengren (Lepidoptera: Noctuidae) in Australia. Australian Journal of Zoology, Melbourne, 34: 779-814.

ECONOMICAL AND ECOFRIENDLY DRYING METHODS AND MODELING FOR RETENTION OF QUALITY ATTRIBUTES OF AMLA Payel Ghosh, Sandeep Singh Rana, Rama Chandra Pradhan and Sabyasachi Mishra Department of Food Process Engineering, National Institute of Technology–Rourkela, Email: [email protected], [email protected], [email protected], Corresponding Author: Payel Ghosh

I

ndian goose berry is an important minor arid zone fruit and a crop of commercial significance. The Amla berry (Emblicaofficinalis) is a traditional food and medicine that inspires us in the mind of the serious herbalist due to its many known nutritional and medicinal benefits and uses. Amla fruit enjoys a special place in Ayurveda, as a nurturing food, that is credited with a number of health benefits. In the Ayurvedic tradition, the fruit forms an integral part of medicinal preparations that are used to support wellness and healthy aging (Majeed et al., 2009). Amla is known for its medicinal and nutritional properties Fig 1. It is the richest source of vitamin C among fruits like Barbados cherry or West Indian cherry. Chemical composition of the amla fruitcontains more than 80% of water. It also has protein, carbohydrate, fiber and mineral and also contains gallic acid which is a potent polyphenol. The amla fruit is reported to contain nearly 20 times as much vitamin C as orange juice. The edible amla fruit tissue has 3 times the protein concentration and 160 times the ascorbic acid concentration of an apple. The fruit also contains higher concentration of most minerals and amino acids than apples. Amlafruit ash contains chromium, Zinc and copper. It is considered as adaptogenic that improves immunity. The dried fruit, the nut or seed, leaves, root, bark and flowers are frequently employed. The ripe fruits are generally used fresh, but dried fruit are also used. The green fruit is described as being exceedingly acidic. The dried fruit is sour and astringent. The flowers are cooling and aperient. The bark is astringent (Nadkarni and Nadkarni, 1999). There are two forms of amla, the wild one with smaller fruits and the "Banarsi" with larger fruits (Thakur et al., 1989).

Fig 1 Medicinal Activities

Mishra et al, 2009 studied different drying techniques (freeze drying, sun drying, spray drying, hot air drying and vacuum drying) on physicochemical properties of amlapowder. In case ofwild variety, the total phenolic contents were found to be 32.32 g/100 g of gallic acid equivalent (dwb), whereas Chakiya variety had 24.50 g/100 g of gallic acid (dwb). Powder yield varied with type of drying method as sun drying (10.11%), tunnel drying (8.78%), vacuum drying (12.48%), spray drying (4.90%) and freeze drying (2.23%).The lowest concentration of ascorbic acid was found in sun dried powder. Freeze dried samples showed maximum mineral contents in terms of calcium (79.6 mg/100 g), phosphorus (12.38 mg/100 g) and iron (88.03 mg/100 g).Verma and Gupta (2004) dried amla on a solar dryer to investigate the effects of different treatments on the product quality. The pretreatments under study were flaking; pricking; pricking + blanching; pricking + blanching + flaking etc. All the treatments were significantly improve the product quality. Microwave heating increases interior product temperature that is dependent on the dielectric properties of the material and this is enhanced by an internal pressure gradient. Microwave heating has three main advantages (Van Arsdel et al., 1973). Application of microwave drying technique for

204


potato (Bouraout et al. 1994), apple and mushroom (Funebo and Ohlsson 1998), carrots (Litvinet al. 1998, Prabhanjan et al. 1995, Lin et al. 1998), raisins (Kostaropoulos and Saravacos 1995, Tulasidas et al. 1993), herbs (Giese 1992), blueberries (Ramaswamy and Nsonzi 1998) and banana (Maskan 2000) has been successfully experimented. These researchers also noted the improvement in the end product quality along with the reduction of total drying time compared to hot-air drying. Wang et al. (2007) evaluated the characteristics of thin layer microwave drying of apple pomace with and without hot air pre-drying in a laboratory scale microwave dryer. The drying experiments were carried out at 150, 300, 450 and 600W, and the hot air pre-drying experiment was performed at 105°C. In case of microwave drying kinetics the relationship between the ratio of microwave output power to sample amount and the effective moisture diffusivity. After evaluation of the data, the dependence of the effective moisture diffusivity on the ratio of microwave output power to sample amount were represented with an Arrhenius-type exponential model.The aim of the present study is to observe the effect of various drying in changes of physicochemical properties of amla. 1. Materials and Methods Sample: Fresh, mature fruits were obtained from the local market of Rourkela, Odisha, India (located at 84.54E longitude and 22.12N latitude). Samples were cleaned and washed manually and packed in perforated polythene bags and stored at 40 C for further use (Benherlal 2010). Before experiments, samples are taken out from freezer and thawed for 3 hrs. Experimental Procedure: Amla sample (in triplicate) was dried in normal sun drying method on metal tray placed on the concrete floor. In a single layer 0.05 kg of sample for three replication was used for drying. The drying area was 0.3364 m2 and the loading density was 4.45 kg/m2. The remaining sample was subjected to dry in the tray dryer and microwave dryer respectively. According to review of literature and preliminary study, independent and dependent parameters were selected and experimental procedure was set up. Independent variables for microwave drying was power level (70, 210, 350 W) and for tray drying was temperature (40, 50, 60)0C respectively. Dependent Variables were moisture content, physical parameters (mass and dimension), and ascorbic acid content. Moisture Content Determination: According to International Organization Standardization – ISO 6673 (1983) each sample (3-5 g) was oven dried (Hot air oven) at 1050C for 24 h. The moisture content was calculated by dividing the mass changes of the beans by the initial mass and then times by 100 to obtain the percentage. The test was done in triplicate and the results averaged. Mass: The mass was determined by a digital balance (Essae DS-852G, India) with an accuracy of 0.01 g. Samples were weighed and then the sum of the masses was divided by 100 to obtain the average sample mass. The test was repeated three times and the resultant three averages were themselves averaged to obtain a single value for the mass (Bart-Plange and Baryeh, 2003). Dimension: The principal dimensions, i.e. thickness (t) were measured by using a micrometer of 0.01 cm least count of the sliced sample.

Ascorbic Acid: Analysis for ascorbic acid (Vitamin C) was done using the 2, 6dichloroindophenol titrimetric method (AOAC, 2000). 2. Result and Discussions Sun Drying

Fig 2 Changes in moisture content with time

Economical and Eco-friendly Drying Methods and Modeling for Retention…………..

205

From Fig 2 it can be concluded that it takes almost 63 hours to reach the safe storage moisture content for the uniform slices of amla. The change in moisture content was observed uniformly throughout the drying period. In case of sundrying at night time the samples were kept in a heap formation which also allows to decrease the moisture content from the cumulative heat inside. But the quality of the product decrease at the time increases. With the comparison of other two drying method this method of drying was a long term process. Microwave Drying: During the drying of amla slices (50 g) at three microwave power levels, there was a reduction of moisture content from 79±1%(wb) to 15% (wb). The quantities of moisture removed from the sample in every 1 min time period ofdrying at three different microwave power levels. As the microwave output power was increased, the drying time of amlawas significantly reduced (P