Cloned Drosophila alcohol dehydrogenase genes are correctly ...

Proc. Natl. Acad. Sci. USA Vol. 81, pp. 1701-1705, March 1984 Biochemistry

Cloned Drosophila alcohol dehydrogenase genes are correctly expressed after transfection into Drosophila cells in culture (transient expression/Schneider line 2 cells/alcohol dehydrogenase transcripts/alcohol dehydrogenase enzyme activity)

CHEEPTIP BENYAJATI

AND

JAMES F. DRAY

Laboratory of Molecular Biology, LBI-Basic Research Program, NCI-Frederick Cancer Research Facility, Frederick, MD 21701

Communicated by Igor B. Dawid, December 9, 1983

ABSTRACT We have obtained correct transcription of the cloned alcohol dehydrogenase (Adh) gene of Drosophila melanogaster after DNA-mediated gene transfer into Drosophila cells in culture. Supercoiled plasmids, each containing various regions of the Adh gene cloned in pBR327, were introduced into Schneider line 2 (SL2) cells by the calcium phosphate-DNA transfection technique. Although these cells do not normally express their endogenous Adh genes, they do express the exogenous genes as shown by primer extension and nuclease S1 analyses of RNA isolated 48 hr after transfection. The resulting alcohol dehydrogenase (ADH) transcripts, both the larval and adult types, have the correct 5' ends and are properly spliced. The transfected cells have also acquired ADH enzyme activity. The levels of enzyme activity and of ADH protein crossreacting material in cells transfected with different Adh plasmids correlate directly with the level of ADH transcripts. When a mutant Adh gene cloned from an ADHnegative mutant fly with a defect in the splicing of ADH RNA is transfected into the Schneider line 2 cells, the resulting ADH RNA is not spliced properly and there is no synthesis of ADH; thus, the mutant gene transfection into cell culture mimics the mutant phenotypes observed in the mutant fly.

cells to study the expression of cloned genes. In one study, stable methotrexate-resistant transformants of cultured Drosophila cells were obtained with plasmids that contain a sequence coding for bacterial methotrexate-resistant dihydrofolate reductase under the control of the copia promoter (6). In the other, recombinant plasmids with the copia or the heat-shock protein promoters driving the expression of bacterial chloramphenicol acetyltransferase were introduced into cultured cells of two Drosophila species (7). The transient expression assay done 1-2 days later revealed CAT expression that can be regulated by heat shock. We report here that the cloned Adh gene of Drosophila can be transcribed correctly from its own regulatory sequences after the calcium phosphate-DNA transfection into cultured Drosophila cells; this results in functional ADH transcripts and the active ADH enzyme.

MATERIALS AND METHODS Cells. Cultured Drosophila cells, Schneider line 2 (SL2; see ref. 8; obtained from R. Gross), were grown in tissue culture flasks (Falcon) in M3 medium (9) containing 3% fetal calf serum at 25°C. The exponential growth range for the SL2 line under these conditions is 1 x 106 to 1 x 107 cells per ml, and the doubling time is 24 hr. Recombinant Plasmids. The Drosophila Adh regions were cloned into bacteriophage X and subcloned into pBR327 as described (10). Plasmid DNA was isolated by the cleared lysate method and was twice purified by CsCl/ethidium bromide equilibrium centrifugation. Transfection of Drosophila Cells. The calcium phosphateDNA transfection technique for introduction of DNA into mammalian cells (11) has been adapted to the Drosophila SL2 cells. pRSV-cat, which carries the Rous sarcoma virus long-terminal-repeat promoter linked to the coding sequence of bacterial chloramphenicol acetyltransferase (a gift from C. Gorman and B. Howard; ref. 12), was used to optimize transfection conditions for the SL2 cells. The SL2 cells were seeded at a density of 2 x 107 cells per T-75 flask in 10 ml of M3 medium containing 3% fetal calf serum 24 hr before transfection. Supercoiled plasmid DNA (10 ,ug of pRSV-cat or the Adh plasmids) precipitated with calcium phosphate (1 ml), as described by Gorman et al. (13), was added directly to the the flask. After a 4-hr incubation at 25°C, the DNA mix was removed and fresh medium was added. The cells were harvested 48 hr later; they generally doubled once during this expression period. RNA Analyses. Total cellular RNA was isolated as described by Chirgwin et al. (14), treated with 50 pAg of DNase I per ml (RNase-free; ref. 15) for 30 min at 37°C to eliminate any DNA that may have contaminated the RNA preparation (a critical step for experiments of this sort), and extracted with phenol/chloroform. Typically, we obtained 1 mg of total cellular RNA from one T-75 flask of transfected cells.

The alcohol dehydrogenase (Adh) gene of Drosophila melanogaster provides an interesting system for detailed studies of the molecular mechanisms regulating gene expression during development. The Adh gene is active in larvae and adult flies, and the enzyme activity is restricted to certain tissues (1, 2). Studies of the alcohol dehydrogenase (ADH) transcripts isolated from animals at different developmental stages have provided insights into the developmental regulation of Adh expression (3). ADH mRNAs isolated from larvae and adult flies differ only in part of their 5'-untranslated regions; the protein-coding and the 3'-untranslated sequences of both mRNAs are identical. Two different "TATA" boxes, the presumptive promoters recognized by RNA polymerase II, have been found 24-25 base pairs (bp) upstream of the larval and adult RNA initiation sites in the Drosophila genome (see Fig. 1). Thus, it has been suggested that the Adh gene is transcribed from two different promoters active at different stages during development (3). Furthermore, in experiments using the P-element-mediated transformation technique (4, 5) the cis-acting sequences necessary for correct developmental expression of Adh have been shown to reside in an 11.8-kilobase (kb) genomic DNA containing the gene itself (2). To characterize the functional activity of the Adh promoters and possibly other cis-acting elements and to assay transacting elements important for proper Adh expression, we have introduced cloned Adh genes into the homologous Drosophila cells in culture. Recently, two groups have used calcium phosphate-DNA transfection of cultured Drosophila The publication costs of this article were defrayed in part by page charge

payment. This article must therefore be hereby marked "advertisement"

Abbreviations: ADH, alcohol dehydrogenase; Adh, alcohol dehydrogenase gene; bp, base pair(s); kb, kilobase(s).

in accordance with 18 U.S.C. §1734 solely to indicate this fact.

1701

1702

Biochemistry: Benyajati and Dray

RNA samples were hybridized to 32P-labeled probes in 80% deionized formamide/1 mM EDTA/0.4 M NaCl/40 mM 1,4piperazinediethanesulfonic acid, pH 6.4, at 500C overnight and then analyzed by primer extension or nuclease S1 treatment. For primer-extension experiments, the probe was an 81-base 5' Pvu II/BstEII 3' single-stranded DNA fragment located in the ADH protein-coding region (see Fig. 1). The recombinant plasmid containing the 4.8-kb EcoRI fragment of the AdhD alleie of Adh (see Fig. 2, plasmid c) in pBR327 was cleaved at the unique BstEII site and labeled at its 3' ends by the replacement synthesis technique (16) using T4 DNA polymerase (Bethesda Research Laboratories) and [32P]dCTP (800 Ci/mmol; 1 Ci = 37 GBq; Amersham). After cleavage with Pvu II, the labeled single-stranded 81-base fragment was separated on a denaturing gel and recovered by electroelution and subsequent precipitation with ethanol. After hybridization, the DNA-RNA hybrids were recovered by ethanol precipitation. cDNA was synthesized in the reaction containing 100 mM Tris HCl, pH 8.3/100 mM KCI/8 mM MgCl2/0.5 mM dithiothreitol/500 gM each of the four dNTPs/5 units of AMV reverse transcriptase (Life Sciences, St. Petersburg, FL) for 1 hr at 42°C. cDNA products were recovered by ethanol precipitation, and the pellets were resuspended in 50 mM NaOH, incubated at 68°C for 5 min, diluted with the formamide loading buffer, and fractionated on 8 M urea/5% polyacrylamide gels. For nuclease S1 mapping of the RNA 3' end, the probe was an Nci I/Xba I 1043bp genomic fragment; the Nci I site is in the region that codes for ADH protein (see Fig. 1). The fragment was labeled at the 3' termini using T4 DNA polymerase. After hybridization, the samples were diluted with 10 vol of 75 mM sodium acetate, pH 4.8/250 mM NaCl/1 mM ZnCl2/500 units of nuclease S1 per ml (Bethesda Research Laboratories) and incubated at 25°C for 30 min. Nuclease-resistant DNA was recovered by precipitation with ethanol, fractionated on 8 M urea/5% polyacrylamide gels, and visualized by autoradiography. Fragments of 4X174 DNA, cleaved with Hae III and end-labeled, were used as size markers on the same gels. Protein Analyses, Cells (=5 x 107) were harvested, washed twice with phosphate-buffered saline, and resuspended in small volumes of phosphate-buffered saline. The cell suspension was sonicated, and nuclei and debris were removed by centrifugation for 5 min in a Microfuge at 40C. We typically obtained 1-2 mg of soluble cytoplasmic protein from one T-75 flask of transfected cells. The cell extract was probed for the ADH protein by using affinity-purified goat anti-ADH antibody (kindly provided by A. R. Place) after NaDodSO4/ PAGE and electrophoretic transfer of proteins to nitrocellulose (17). The ADH immunogen was detected by use of rabbit anti-goat IgG and 1251-labeled protein A (a gift of B. Sauer). Enzyme Assay. ADH enzyme activity was measured fluorimetrically by monitoring the rate of NADH production at 250C (18). The reaction mixture (2.5 ml) contained 0.1 M Tris'HCl, pH 7.5/2 mM NAD/0.15 M 2-butanol/500 ,ug of cytoplasmic protein (15-20 ,ul of cell extract). Under these conditions, NADH production was completely dependent on the presence of the substrate and remained linear with time for at least 60 min. The protein concentration was measured by the modified Coomassie blue method (19). RESULTS ADH Transcripts in Transfected DrosophUia Cells Are Correctly Initiated and Spliced. The Adh gene of D. melanogaster encodes two major transcripts, the larval and the adult, that differ only in part of their 5'-untranslated regions (ref. 3; Fig. 1). The mature larval ADH mRNA is 53 bases shorter than the adult mRNA at the 5' end. This is shown in the

Proc. Natl. Acad Sd USA 81 0.5

0

169 65

P IE'. '' 87

Pa

'

654

405 ,'

135 65

\ti;

70

-'. :

405

;

1.0 kb

444 4* R

.

70

(1984)

RNA

444 -

X

(larvae) (adult)

probe for 81 primer extension 1043 probe for Si mapping| FIG. 1. The Drosophila Adh gene, its transcripts, and locations of molecular probes. T-A-T-T-T-A-A and T-A-T-A-A-A-T-A represent the adult and larval putative promoter regions, respectively (3); cap indicates the RNA initiation sites; ini and ter indicate the initiation and termination codons; A-A-T-A-A-A refers to the putative poly(A)-addition signal. The larval-type primary transcript (P1) contains 2 introns, and the adult-type primary transcript (Pa) contains an additional intron in the 5' untranslated region. The hybridization probes (isolated from an Adh genomic clone) for primer extension (81 bases; 3' BstEII/Pvu II 5' fragment) and nuclease S1 (1043 bases; 3' Nci I/Xba I 5' fragment) analyses are shown as black bars.

primer extension analysis in Fig. 3 (lanes 4 and 6): the 319base cDNA is obtained when the RNA from young larvae is used as the template, whereas a 372-base cDNA band is obtained when adult RNA is used. Both RNAs coexist in thirdlarval-instar animals, with the larval type predominating (lane 5). The SL2 cells, on the other hand, do not contain any detectable ADH RNA (lane 7). Nonetheless, 48 hr after being transfected with the Adh plasmids (Fig. 2), these cells expressed ADH RNAs. When plasmids c and d were transfected, both the larval- and the adult-type ADH RNAs were expressed. These RNAs have been correctly initiated, and the 65-bp intron and the 654-bp adult intron have been correctly spliced out, as judged by the presence of the 319- and 372-base cDNA bands (Fig. 3, lanes 10 and 11). Transfection with the plasmid lacking the adult promoter region (plasmid b) yields only the larval-type RNA (lane 9). Finally, when the gene template contains a deletion of 17 bp in the 65-bp intron at the 3' A-G splice site (plasmid a), both the larvaland the adult-type RNAs appear to be correctly initiated but still retain the partially deleted intron sequence (lane 8). These conclusions have been confirmed using other probes in the nuclease S1 mapping experiment (data not shown). The above data clearly indicate that cloned Adh genes that have been transfected into cultured Drosophila cells can serve as templates for transcription. Both the larval and the adult RNA initiation sites are used here, suggesting that the sequences necessary for correct initiation of transcription are present on the cloned genes and are recognized in homologous cultured cells. Splicing of intervening sequences (including the 70-bp intron; data not shown) is also accurate and efficient except when the splice site is defective. We have estimated the ADH RNA levels in transfected cells based on the intensities of cDNA bands (determined by densitometric tracing of the autoradiogram) and the amounts of RNA in each primer extension reaction. ADH RNA levels in the SL2 cells transfected with plasmid c or d are 1/50th to 1/100th that in mature adult flies. Since about 1% of the total translatable RNA in adult flies is the ADH message (20),

Biochemistry: Benyajati and Dray

Proc. NatL Acad ScL USA 81 (1984)

1703

0

C A, LU

(a)

LU q 0

9 Iz ( I

WM

la la

(b)

LU

-i

LU~~~~~~mr C

° LU

(3

(c)

(d)

-I (a)t

1 kb

ADH transcripts constitute 0.01-0.02% of total cellular RNA, with two-thirds of those being the adult type and onethird being the larval type. In cells transfected with plasmid b, which lacks the adult promoter region, the level of ADH 1

13531078-

_

872-

f

603-

f

2

3

4

5

6 7

8

9

10

11

12

13

-1353 -1078 872 -603

372

420 3

7

319

310281271-

%

234-

%

372

AO

0

to I

-31 0

S271 dP =_281

-V

-234

--

-194

-

-118

194-

_FP~

_1Iww 118-

81-1. primer

_

primer 4-81

FIG. 3. Mapping the 5' ends of ADH RNAs from transfected cells. Total cellular RNAs were hybridized with 1 ng of the 81-base single-stranded 32P-labeled 3' BstEII/Pvu II 5' primer (Fig. 1), which was then extended with reverse transcriptase. The cDNA products were electrophoresed on a 5% polyacrylamide/8 M urea gel. Lanes: 1 and 13, standard size markers; 2, control, no RNA; 3, control, tRNA; 4, young larval RNA; 5 and 12, third-instar-larval RNA; 6, 4-day-old adult RNA; 7, SL2 RNA; 8, RNA from cells transfected with plasmid a; 9, RNA from cells transfected with plasmid b; 10, RNA from cells transfected with plasmid c; 11, RNA from cells transfected with plasmid d. Ten micrograms of RNA was used in lanes 3-6 and 12; 200 Mg of RNA was used in lanes 7-11.

FIG. 2. Recombinant plasmids containing various Adh regions. Drosophila DNA containing the Adh 0~~~~~ gene from the AdhD wild-type allele (b-d; ref. 10) and the splicing-defective, Adhf"4 mutant allele (a; ref. 10) were subcloned in pBR327. (a) Plasmid a, a 4.8-kb EcoRI insert in the EcoRI site. This Adhfn4 allele contains a 17-bp deletion in the 65-bp intron that splits the 3' dinucleotide A- G splice site (10). (b) Plasmid b, a 2.9cc kb HindIII/EcoRI insert between the HindIII and EcoRI sites. (c) Plasmid c, a 4.8-kb EcoRI fragment in the EcoRI site. (d) Plasmid d, an 8.4-kb Sal I fragment in the Sal I site.

RNA is one-third of that with either plasmid c or d. This is consistent with the efficiency of the larval promoter region on plasmid b being the same as on plasmid c or d. Cells transfected with plasmid a appear to contain only half of the ADH RNA of cells transfected with plasmid c, its wild-type counterpart. This lower level of steady-state ADH RNA has been observed in the homozygous viable, Adhfn4 mutant flies, from which plasmid a was cloned (10). Adhfn4 adult flies possess only 5-10% of the wild-type RNA levels. We postulated previously that the mutant precursor RNA is less stable and turns over more rapidly than the wild-type ADH RNA (10). ADH Transcripts Possess Multiple 3' Ends in Transfected Cells. The 3' RNA ends were mapped by nuclease S1 digestion of total RNA hybridized to a 1043-bp labeled Nci I/Xba I DNA fragment (Fig. 1). Mature ADH mRNA from young larvae and adult flies have identical 3' sequences (3); thus, the same 396-base nuclease Si-resistant DNA bands are observed (Fig. 4, lanes 7-9). As we have shown above, SL2 cells in culture do not have any detectable ADH RNA (lane 2). However, after transfection of these cells with the Adh plasmids, ADH RNAs with multiple 3' ends were obtained, as evident from the presence of the 237-, 396-, 650-, and 800base nuclease Si-resistant DNA fragments (Fig. 4, lanes 36). It is unlikely that these bands are artifacts of the S1 digestions; they were entirely absent when the same amount of the SL2 control RNA was used with the same probe concentration. Furthermore, the RNA preparations had been treated with excess DNase I to destroy any residual transfected DNA templates that might hybridize to the probe under the conditions favoring DNARNA hybrid formation (21). These results indicate that only a fraction of ADH RNA in transfected cells appears to have both 5' and 3' ends identical to those of ADH RNA from larvae and adult flies. The others are properly initiated and spliced but have different 3' ends. Two observations are of note. (i) ADH transcripts in cells transfected with plasmid d appear qualitatively distinct from those in cells transfected with the other three gene templates, the 237-base DNA fragment being the major Si-resistant band. This was reproducible whether the S1 analysis was done at 250C or 370C. Plasmid d has a longer Drosophila genomic sequence at the 5' end and an extra 200 bp at the 3' sequence (Fig. 2). It is possible that the overall size of the exogenous templates, in addition to specific DNA se-

1704

Biochemistry: Benyajati and Dray 1

2

3

4

5

6

7

13531078-U 872-_

probe

Proc. NatL Acad ScL USA 81 8

9

2

3

4

5

6

7

(1984) 8

9

10

1043 4-

603-9

800

4--650

92,500-

*t,-.MwlpFr

396

_-*am4 66,200-

310-_

281271_ 234-

45,000.M.

W-

W

^4--237

194-

31,000ADH

-_

(27.000)

1 18-

.;.

72-_.~

FIG. 4. Mapping the 3' ends of ADH RNAs from transfected cells. Total cellular RNAs were hybridized with 10 ng of the 1043-bp 32P-end-labeled Nci I/Xba I DNA fragment (Fig. 1) under the conditions that promote DNA-RNA but not DNA-DNA hybrid formation. After nuclease S1 digestion, the protected DNA fragments were fractionated on a 5% polyacrylamide/8 M urea gel. The arrows indicate the S1-protected fragments. Lanes: 1, standard size markers; 2, SL2 RNA; 3-6, RNA from cells transfected with plasmid b, a, c, and d, respectively; 7, third-instar-larval RNA; 8, young larval RNA; 9, adult RNA. Two hundred micrograms of RNA was used in lanes 24; 10 pg of RNA was used in lanes 7-9.

affects the 3'-end processing of transcripts of these templates in transient expression assays (see also Discussion). (it) The levels of total ADH transcripts in various transfected cells were estimated from the densitometric scanning of Si-resistant DNA band intensities and the known amounts of RNA in each sample; they are consistent with those determined in the primer extension analysis described above. Detection of ADH and Its Enzyme Activity in Transfected Cells. We next analyzed the SL2 cells transfected with the various Adh plasmids for the presence of the ADH protein. Fig. 5 shows the protein immunoblot that has been probed with affinity-purified goat anti-ADH antibody. By this immunological detection method, we could detect about 1 ng of purified ADHF (monomer Mr, 27,000; Fig. 5, lane 5). Neither the SL2 control extract (lane 6) nor the extract of cells transfected with plasmid a, the splicing-defective plasmid (lane 7), contains detectable ADH protein. By contrast, cells transfected with plasmids b, c, and d are ADH positive (lanes 8-10). We estimate that ADH constitutes -0.02% of total cytoplasmic protein in the plasmid c- and plasmid dcontaining cells and =0.006% in the plasmid b-containing cells 48 hr after transfection. When these cell extracts were assayed directly for the ADH enzyme activity, we found the activity to correlate with the presence and the level of ADH protein (Table 1). Thus, it appears that the ADH protein synthesized in transfected cells is fully active. The level of ADH accumulation in the 48-hr expression time follows closely the level of total ADH transcripts in the quences,

4

FIG. 5. Immunoblot detection of ADH protein from transfected cells. Cytoplasmic extracts (30 ,ug of total protein) of cells transfected with different Adh plasmids were denatured and fractionated on a 10o NaDodSO4/polyacrylamide gel. Purified ADHF (from the fly carrying the wild-type AdhF allele, provided by A. R. Place) in the amounts indicated were run on the same gel as positive controls. After electrophoretic transfer of the proteins to nitrocellulose, the ADH crossreacting material was identified by use of affinity-purified goat anti-ADH antibody. Protein molecular weight standards are as follows: phosphorylase B, 92,500; bovine serum albumin, 66,200; ovalbumin, 45,000; and carbonic anhydrase, 31,000. Lanes: 1-5, purified ADHF 90, 30, 10, 5, and 1 ng, respectively; 6, SL2 extract, control; 7-10, extract, transfected with plasmid a, b, c, and

d, respectively.

transfected cells. It is possible that all the ADH transcripts in cells transfected with the Adh plasmids (except plasmid a) are functional, including those with 3' ends different from that of the larval and adult site.

DISCUSSION Using the calcium phosphate-DNA transfection technique, have introduced into cultured Drosophila cells supercoiled plasmids containing active Adh genes of D. melanogaster. After 48 hr, correct transcription specific to the exogenous Adh promoters resulted in ADH transcripts that were translated into the active ADH enzyme. The levels of ADH protein and enzyme activity parallel the levels of total ADH transcripts. About 0.01-0.02% of soluble cytoplasmic protein is ADH in cells transfected with plasmids containing both the larval and adult promoters (Fig. 2, plasmids c and d, at 10 ,ug of each plasmid per 2 x 107 cells). Correct RNA 5' ends of both the larval- and the adult-type transcripts and correct and efficient splicing of introns were observed in the transfected cells. Surprisingly, these RNAs can have several different 3' ends, only one of which is idenwe

tical to the normal 3' end in ADH RNA from larvae and adult flies. Because ADH is present in the cells after transfection, Table 1. ADH enzyme activity in transfected SL2 cells Sample ADH activity, units SL2, control 4.3 SL2, transfected with plasrnid a 4.8 SL2, transfected with plasmid b 7.4 SL2, transfected with plasmid c 17.0 14.6 SL2, transfected with plasmid d Purified ADHF 11.9 The amount of SL2 protein per assay was 500 .ug; the amount of purified ADHF enzyme was 0.045 ,ug. One unit of activity is defined as 1 nmol of NADH produced in 15 min in a 2.5-ml reaction mixture at 250C with 2-butanol as substrate.

Proc. Natl. Acad Sci USA 81 (1984)

Biochemistry: Benyajati and Dray RNA 3'

ENDS 31

1

5'

A)

TAAGAAGTGAIAAICCCAAAAAAAAAACATA >

122

188

B) 5' CGATAATAAAACTTTCCATGAAAAATATGGAAAAATTATGAAAATTGAGAAATCCAAAAACTCAT 3'

(396)

448

388

C)

3' (237)

5' AGATATAGCGGTGAGTGAGCGGGAAGCTCGGTTTCTGTCCAGATCGAACTKAACTiAGT 3' 570

D)

(650)

601

5' AATCAATACTTTAGAACAAAATCAAAACTCAT

3'

(800)

FIG. 6. Predicted sequences at the 3' ends of ADH transcripts from transfected cells. Vertical line denotes putative nucleotides at the 3' ends of ADH RNAs; each corresponds to the sizes of nuclease S1-resistant DNA fragments of Fig. 4 (in parentheses). The 3' ends of the larval and adult mRNAs (black dot in B) and the putative signal for poly(A) addition (AATA, dashed underlines) were determined previously by S1 analysis and comparison of the cDNA and genomic sequences (3, 20). The size of the 237- and 397-base nuclease-resistant fragments was accurately measured, but that of the 650- and 800-base fragment was only approximate. The sequences in A, C, and D, representing the predicted 3' ends of the additional ADH RNAs in transfected cells, were identified from the published sequence in the 3' region of the Adh gene noncoding strand (22). Their regions of homology to sequence in B are underlined with solid lines. The termination codon TAA is boxed. The nucleotide T is designated 1 (nucleotide 1681 in ref. 22). The numbers above refer to their positions from the boxed TAA. Arrows indicate one of the few direct repeats in the 3' region of the larval and adult ADH RNAs. some or most of these transcripts must be translatable. We noted the 237-base, nuclease S1-resistant DNA band (Fig. 4), which indicates the presence of an RNA species shorter than normal at the 3' end. This is the major RNA species in the cells transfected with plasmid d (lane 6), which contain as much or more ADH as cells transfected with plasmid c. Based on the sizes of the S1-resistant DNA bands (Fig. 4), we have tried to locate the positions of the 3' RNA ends on the genomic DNA sequence. The normal 3' end is shown in Fig. 6B. Homology was noted first between sequences in Fig. 6 A and B. These sequences were then used to locate the ends of the larger transcripts (Fig. 6 C and D). We emphasize that the latter are only approximate, because accurate size measurements could not be made in this experiment. From our present data, it is not clear why there are ADH transcripts with multiple 3' ends in transfected cells. Although the poly(A)-addition site of the larval and adult mRNA has been determined, we do not know whether that is identical to the transcription-termination site or the site of specific cleavage on the longer precursor RNA prior to poly(A) addition. Perhaps additional control sequences required for stringent 3' processing are not present on these recombinant plasmid clones. Further experiments with new clones that include more of the 3'-genomic sequence should test this possibility. The other possibility is that the secondary structures of precursor RNAs transcribed from cloned templates in SL2 cells in culture are different from those in larvae or adult flies because of differences in the transcription-termination sites. This might result in additional cleavage of precursor RNA at sequences similar to the normal site. Determination of the actual transcription-termination site should help distinguish between these possibilities. Previously, we used these same plasmids as templates in transcription-competent extracts made from HeLa cells and detected specific but unspliced run-off transcripts that originated from the adult promoter only (3, 10). Perhaps the heterologous HeLa cell extracts do not recognize fully the regulatory sequences on the Drosophila templates. Thus, we found it interesting that both the larval and the adult promoters of the Adh gene are functional in transient expression assays in this homologous Drosophila system. In addition,

we have shown here that transcription and splicing phenotypes of an Adh mutant fly can be closely mimicked in this

Drosophila

transient

expression assay. Together with the

1705

ability to mutagenize in vitro cloned DNA templates, the transient expression in cultured Drosophila cells should provide a rapid and meaningful assay for sequences that are important for Adh transcription initiation, termination, and RNA processing. This information is necessary for studying the interactions between the cis-controlling elements and trans factors necessary for developing in vitro assays. The question remaining unanswered is why endogenous Adh genes are not expressed in the SL2 cell line when exogenous Adh sequences are. Southern analysis of the SL2 genomic DNA has shown no obvious rearrangements of endogenous gene (data not shown). The SL2 cell line was derived from embryos (8), the developmental stage at which ADH enzyme activity is very low (1). The endogenous gene may be in a chromatin configuration that does not permit recognition of promoter sequences by transcription factors, or the exogenous genes may be assembled into an active form of chromatin that permits interactions of transcription regulatory factors and the Adh promoter sequences. In any event, SL2 cells contain all the trans-acting factors required for Adh transcription initiation at both the adult and larval promoters. We thank Cory Gorman and Bruce Howard of the National Cancer Institute for pSV2-cat, pRSV-cat; Dr. J. Sinclair of the University of Sussex for communicating his transfection protocol for Drosophila cells; Mark Pearson, Daphne Blumberg, and Nat Sternberg of the NCI-Frederick Cancer Research Facility for reviewing the manuscript; and Allen R. Place of the University of Pennsylvania for providing the purified ADHF and the affinity-purified anti-ADH antibody and for our continuing collaboration. Research was sponsored by the National Cancer Institute, under Contract N01-CO23909 with Litton Bionetics, Inc. The contents of this publication do not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of tradenames, commercial products, or organizations imply endorsement by the U.S. Government.

1. Ursprung, H., Sofer, W. H. & Burroughs, N. (1970) Wilhelm Roux's Arch. 164, 201-208. 2. Goldberg, D. A., Posakony, J. W. & Maniatis, T. (1983) Cell 34, 59-73. 3. Benyajati, C., Spoerel, N., Haymerle, H. & Ashburner, M. (1983) Cell 33, 125-133. 4. Spradling, A. C. & Rubin, G. M. (1982) Science 218, 341-347. 5. Rubin, G. M. & Spradling, A. C. (1982) Science 218, 348-353. 6. Baurouis, M. & Jarry, B. (1983) EMBO J. 2, 1099-1104. 7. Di Nocera, P. P. & Dawid, I. B. (1983) Proc. Natl. Acad. Sci. USA 80, 7095-7098. 8. Schneider, I. (1972) J. Embryol. Exp. Morphol. 27, 353-365. 9. Shields, G. & Sang, J. H. (1977) Drosophila Inf. Serv. 52, 161. 10. Benyajati, C., Place, A. R., Wang, N., Pentz, E. & Sofer, W. (1982) Nucleic Acids Res. 10, 7261-7272. 11. Graham, F. & van der Eb, A. (1973) Virology 52, 456-457. 12. Gorman, C. M., Merlino, G. T., Willingham, M. C., Pastan, I. & Howard, B. H. (1982) Proc. Natl. Acad. Sci. USA 79, 67776781. 13. Gorman, C. M., Moffat, L. F. & Howard, B. H. (1982) Mol. Cell. Biol. 2, 1044-1051. 14. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J. & Rutter, W. J. (1979) Biochemistry 18, 5294-5299. 15. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). 16. O'Farrell, P. (1981) Focus 3, 1-3. 17. Towbin, H., Staehelin, T. & Gordon, J. (1979) Proc. Natl. Acad. Sci. USA 76, 4350-4354. 18. Dalziel, K. (1962) Biochem. J. 84, 244-254. 19. Bradford, M. (1976) Anal. Biochem. 72, 248-254. 20. Benyajati, C., Wang, N., Reddy, A., Weinberg, E. & Sofer, W. (1980) Nucleic Acids Res. 8, 5649-5667. 21. Casey, J. & Davidson, N. (1977) Nucleic Acids Res. 4, 15391552. 22. Kreitman, M. (1983) Nature (London) 304, 412-417.