Cloning and characterization of novel cyclotides ... - Wiley Online Library

Received: 6 February 2016

|

Revised: 10 August 2016

|

Accepted: 21 August 2016

DOI 10.1002/bip.22938

ORIGINAL ARTICLE

Cloning and characterization of novel cyclotides genes from South American plants Nicolau Brito da Cunha1 | Aulus Estev~ ao Anjos de Deus Barbosa2 | Renato Goulart de Almeida1 | William Farias Porto1 | Mariana Rocha Maximiano1 | 1 | Cassia Beatriz Rodrigues Munhoz3 | Luana Cristina Silva Alvares Chesterton Ulysses Orlando Eugênio1 | Ant^ onio Americo Barbosa Viana1 | Octavio Luiz Franco1,4 | Simoni Campos Dias1 1

Centro de Analises Proteômicas e Bioquímicas, Pos-graduaç~ao em Ciências Genômicas e Biotecnologia, Universidade Catolica de Brasília, SGAN 916 Modulo B Avenida W5, Brasília, DF, 70790-160, Brazil

2

Universidade Federal de Uberlândia, Av. Getulio Vargas, numero 230, Centro 38, Patos de Minas, MG, 700-128, Brazil

3

Departamento de Botânica, Instituto de Ciências Biologicas. Bloco D. Universidade de Brasília. Campus Darcy Ribeiro 70904-970, Asa Norte. Brasília, DF, Brazil

4

S-Inova Biotech, Pos Graduaç~ao em Biotecnologia, Universidade Catolica Dom Bosco, Campo Grande, MS, Brazil

Correspondence Octavio Luiz Franco S-Inova Biotech, Pos Graduaç~ao em Biotecnologia Universidade Catolica Dom Bosco, Campo Grande, MS, Brazil. Email: [email protected] Funding Information This work was supported by Coordenaç~ao de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Conselho Nacional de Pesquisa e Desenvolvimento (CNPq), Fundaç~ao de Amparo a Pesquisa do Distrito Federal (FAPDF) and Fundaç~ao de Apoio ao Desenvolvimento do Ensino, Ciência e Tecnologia do Estado de Mato Grosso do Sul (FUNDECT).

Abstract Cyclotides are multifunctional plant cyclic peptides containing 28-37 amino acid residues and a pattern of three disulfide bridges, forming a motif known as the cyclic cystine knot. Due to their high biotechnological potential, the sequencing and characterization of cyclotide genes are crucial not only for cloning and establishing heterologous expression strategies, but also to understand local plant evolution in the context of host-pathogen relationships. Here, two species from the Brazilian Cerrado, Palicourea rigida (Rubiaceae) and Pombalia lanata (A.St.-Hil.) Paula-Souza (Violaceae), were used for cloning and characterizing novel cyclotide genes. Using 30 and 50 RACE PCR and sequencing, two full cDNAs, named parigidin-br2 (P. rigida) and hyla-br1 (P. lanata), were isolated and shown to have similar genetic structures to other cyclotides. Both contained the conserved ER-signal domain, N-terminal prodomain, mature cyclotide domain and a C-terminal region. Genomic sequencing of parigidin-br2 revealed two different gene copies: one intronless allele and one presenting a rare 131-bp intron. In contrast, genomic sequencing of hyla-br1 revealed an intronless gene—a common characteristic of members of the Violaceae family. Parigidin-br2 50 and 30 UTRs showed the presence of 12 putative candidate sites for binding of regulatory proteins, suggesting that the flanking and intronic regions of the parigidinbr2 gene must play important roles in transcriptional rates and in the regulation of temporal and spatial gene expression. The high degree of genetic similarity and structural organization among the cyclotide genes isolated in the present study

Nicolau Brito da Cunha and Aulus Estev~ao Anjos de Deus Barbosa contributed equally to this work

784

|

C 2016 Wiley Periodicals, Inc. V

wileyonlinelibrary.com/journal/pepsci

Peptide Science 2016; 106: 784-795

CUNHA

|

ET AL.

785

from the Brazilian Cerrado and other well-characterized plant cyclotides may contribute to a better understanding of cyclotide evolution. KEYWORDS

cyclotides, palicourea rigida, pombalia lanata, rubiaceae, violaceae

1 | INTRODUCTION Cyclotides are a family of small, cyclic peptides, ranging from 28 to 37 amino acids in size, which play an important role in the innate defense system of plants. These circular peptides are commonly found in species from the Violaceae, Rubiaceae, Fabaceae, Poaceae, and Cucurbitaceae plant families.[1–7] Cyclotides have a unique cyclic structure formed by a peptide bond between the C- and N-termini and an interlocking pattern of three disulfide bonds formed between six conserved cysteine residues. The folded structure is termed a cyclic cystine knot (CCK) and is a characteristic feature of cyclotides.[8] The CCK provides cyclotides with considerable stability, structural rigidity, and physical protection from proteolytic enzymes, acidic conditions, and chemical degradation.[1,6,9–13] There are two main subfamilies of cyclotides, named M€obius and bracelet. M€obius cyclotides have a cis-proline residue in loop 5, generating a 1808 twist in the backbone whereas bracelets have no such twist.[8] A third class comprises the trypsin inhibitor cyclotides, the two best studied members of which were isolated originally from the seeds of Momordica cochinchinesis (Cucurbitaceae), and are named MCoTI-I and -II. Although the trypsin inhibitors also possess the CCK, they otherwise share little identity with other cyclotides.[14,15] Recent studies have described other subclasses of cyclotides, comprising peptides exhibiting hybrid characteristics of M€obius and bracelet subfamilies,[16] as well as cyclotides with properties derived from novel sequence features, such as lysine-rich, proline-rich and histidine-rich cyclotides,[10,17,18] or those with incomplete cyclization.[1,19] Cyclotides are gene-encoded natural products present in abundance in the plant kingdom. A single cyclotide may have a range of biological activities.[15,16] These include anti-HIV, antitumor, antimicrobial, insecticidal, trypsin inhibitor, nematicidal, molluscicidal, hemolytic, and cytotoxic activities.[15,20–26] Subtle variations in the sequence of amino acid residues by specific genetic mutations can modulate differential activities between closely related cyclotides, even though the overall structure of the CCK remains unaltered.[1,27] Notably, the insecticidal activity of cyclotides presents great potential for the development of valuable biotechnological products for agriculture.[16] Unlike other insecticidal disulfide-rich peptides, cyclotides seem to avoid the inhibition of pathogen-digestive enzymes.[28,29] A number of stud-

ies attest to the insecticidal properties of cyclotides, based on the cyclotide-dependent disruption of larval midgut membranes.[11,30,31] Recently, Pinto et al. identified and characterized parigidin-br1, an insecticidal cyclotide from the Brazilian Cerrado plant Palicourea rigida (Rubiaceae).[26] Parigidin-br1 is a bracelet cyclotide with potent in vivo and in vitro activities against Diatraea saccharalis and Spodoptera frugiperda SF-9 cells.[26] In plants, cyclotide gene expression profiles vary according to tissue localization, the age of the tissue, as well as climatic changes and seasonal fluctuations.[26,27,32–34] The biosynthesis and distribution of different cyclotides in a single plant can follow constitutive or tissue-specific patterns, providing evidence to support the idea that the modulation of cyclotide gene expression is caused primarily by differential physiological circumstances associated with biotic and/or abiotic stresses.[35] Commonly, a single plant possesses a suite of cyclotide genes encoded in the leaves, stem, petioles, flowers, pedicels, bulbs, seeds, and roots.[9] Several mechanisms of gene regulation have already been reported in cyclotide biosynthesis: the most notable being alternative mRNA splicing, selective translation by ribosome instability and differential precursor-processing.[32,36–38] Furthermore, cyclotide genes present a characteristic and highly conserved genetic organization, which encodes linear precursor proteins usually containing up to 200 amino acid residues.[20,39] The main genetic elements of cyclotides are: I) a single initial endoplasmic reticulum signal (ER-signal) domain coding sequence of 54 to 90 bp; II) a single N-terminal prodomain (NTPD) coding sequence comprising 66 to 165 bp; III) an N-terminal repeat (NTR) domain coding sequence of 48 to 60 bp; IV) a mature cyclotide domain (MCD) coding sequence of 84 to 111 bp; and V) a hydrophobic C-terminal repeat (CTR) coding sequence of 9 to 33 bp). These last three can be repeated up to three times, with each repetition encoding a mature cyclotide.[40] This modular organization allows for sophisticated expression control, mediated by protein binding motifs distributed along the 50 and 30 UTRs, and different post-translational processing,[33] resulting in increased cyclotide production for protective purposes—triggered immediately after the recognition of infective agents by the plant—or long-term basal accumulation of the peptides in plant tissues.[35] Recently, cyclotides and acyclotides with shortened precursors were discovered in Chassalia chartacea, Panicum

786

|

laxicum, and Viola tricolor.[1,19,41] These unusual peptides are synthesized as shortened precursors, lacking the typical C-terminal tail. Another interesting example is a group of 12 cyclotides, isolated from the seeds of Clitoria ternatea (Fabaceae), containing novel sequence motifs with Asn to Asp variants at the in planta cyclization site. This discovery makes the Fabaceae the largest plant family that contains cyclotides.[12,42] In this work we report the discovery of two novel cyclotide genes from Pombalia rigida (Rubiaceae) and P. lanata (Violaceae), which are wild plants from the Brazilian Cerrado. Both genes had their cDNAs completely sequenced, and the proximal 50 and 30 UTRs of the P. rigida gene were investigated for the presence of regulatory motifs and other protein binding sites. These constitute the first cyclotide genes isolated from South American plants. Comparative modeling and phylogenetic analysis were also carried out in order to evaluate the relationship between the structures of the peptides and their probable functions and specificities. 2 | MATERIAL AND METHODS 2.1 | Plant materials Leaves of P. rigida Kunth (Rubiaceae) UB (Voucher Munhoz, CBR. and Campos, S. 7400; Herbarium UB) and P. lanata (A. St.-Hil.) Paula-Souza (Violaceae) (Voucher Eugênio, CUO. 3; Herbarium UB) were collected at the “Ermida Dom Bosco” park (15847’54.92”S and 47848’31.10”W) (Brasilia/DF) and “Reserva Ecol ogica do Instituto Brasileiro de Geografia e Estatística” (RECOR-IBGE) (15856’38,52” - 15856’38,87”S and 47852’25,81” - 47852’33.91”W) (Brasilia/DF), respectively. The samples were placed on ice during transport and kept at 2808C for extended storage. 2.2 | RNA extraction and cDNA synthesis Total RNA was isolated using an InviTrap® Spin Plant RNA Mini Kit (Invitek/STRATEC Molecular) and cDNAs were synthesized using a SuperScript® II Reverse Transcriptase Kit (InvitrogenTM), according to the manufacturer’s instructions. RNA was quantified using a Qubit® RNA Assay Kit and Qubit® Fluorometer (InvitrogenTM) and its integrity evaluated by electrophoresis. 2.3 | Primer design The P. rigida cyclotide gene was amplified using a degenerate primer based on the parigidin-br1 MCD motif in a sense orientation, (Accession: B3EWF1) (PrF1.1 50 -GGAGGATC TGTBCCWTGCGG-30 ).[27] P. lanata cyclotide cloning primers were designed from conserved cyclotide gene sequences from Melicytus ramiflorus (MrF150 - GATGTGITCAC

CUNHA

ET AL.

TCVTGAAACC-30 ), V. baoshanensis (VbF1 50 - TTCCAA GATTGTSTTTGTIGC-30 , VbF2 50 -TGCCAAGAAGATG TTTSTTGC-30 , VbF3 50 - TGGAGAGCAACAAGAAGATG C-30 , VbF450 -AGATGTTTGTTGCCCTTGTGC-30 ) and V. odorata (VoF1 50 -GTTGGGCTCTTCCTCATTGC-30 , VoF2 50 - GTCTCACACACACAACAAAGC-30 , VoF350 -AGATG TTTATTGTGCTTGTGC-30 ). 2.4 | Cloning of amplicons and sequencing PCR reactions were performed using 2 mL of each cDNA, 0.5 lM forward and reverse primers and GoTaq® DNA Polymerase (Promega) in a 50 mL reaction following the manufacturer’s instructions. An oligo (dT) primer was used as the reverse primer for all reactions. The cycling reactions were conducted for 5 min at 958C, followed by 30 cycles of a 45-s denaturation step at 95˚C, a 45-s primer annealing step at 53˚C, a 45-s extension step at 72˚C, ending with a 5-min extension step at 72˚C. The amplifications were detected by 1% agarose gel electrophoresis. The amplicons were purified using a PureLinkTM Quick Gel Extraction and PCR Purification Combo Kit (InvitrogenTM) and cloned into a pGEM®-T Easy vector (Promega), according to each manufacturer’s instructions. The ligation reactions were electroporated on E.coli XL1-Blue cells. Cloned fragments were sequenced using SP6 and T7 primers in the 3130 Genetic Analyzer (Applied Biosystems/Life TechnologiesTM). Sequences were analyzed with DNA Baser Sequence Assembler v4.x (Heracle BioSoft - www.DnaBaser.com), BioEdit[43] and ClustalW2.[44] 2.5 | 50 race pcr The complete mRNA sequences of P. rigida and P. lanata cyclotides were obtained using an ExactSTARTTM Eukaryotic mRNA 50 & 30 RACE Kit (Epicentre), according to the manufacturer’s instructions. Primers were designed specifically for the 50 RACE: Prigida50 Rev (50 -GGCAAACCG TTCACTACCAC-30 ) and Planata50 Rev (50 -CAAAGTTGG CTTTCTCACTGG-30 ). Amplicons were cloned and sequenced as previously described. 2.6 | Genomic DNA extraction and complete gene sequencing Plant DNA was purified using a CTAB procedure.[45] For complete genome sequencing of cyclotide genes, the primers were designed using obtained complete mRNA sequences. The P. rigida cyclotide gene was amplified with PrigidaDNAF (50 -CCAAAACTACTCATTCCAGCAAG-30 ) and PrigidaDNAR (50 -TCCTGATACTGTCTGGAAAACAA-30 ) primers. The P. lanata cyclotide gene was amplified using PlanataDNAF (50 -ATGGATGCCAAGAAGATGTTG30 ) and

CUNHA

|

ET AL.

PlanataDNAR (50 -TTAAATAACGAGGGAGTTCCTGT30 ) primers. PCR reactions contained 10 mM Tris-HCl (pH 8.4), 50 mM KCl, 2 mM MgCl2, 160 lM of each dNTP, 2U Taq polymerase (Invitrogen), 20 ng of genomic DNA and 200 nM of each specific primer. PCR mixes were placed in a DNA thermal cycler (MJ Peltier, USA). DNAs were predenatured at 958C for 5 min and amplified with 35 of the following cycles: 958C for 1 min, 558C for 1 min, and 738C for 1 min, with a final cycle at 728C for 7 min. Obtained amplicons were cloned and sequenced, as previously described. 2.7 | In silico motif identification Screening of exons, intron, 50 and 30 UTRs of parigidin-br2 for motif identification was performed using the Scope 2.1.0 de novo computational motif discovery tool (Dartmouth College, NH, http://genie.dartmouth.edu/scope/). Three algorithms were used for motif identification: BEAM, PRISM and SPACER, for non-degenerate, degenerate and bipartite motifs, respectively. Both intergenic and fixed genomic sequences of Arabidopsis thaliana were used as templates to find representative motifs.[46,47] Target consensus sequences presenting SIG values greater than 5.0 were considered overrepresented and benchmarks for the presence of motifs. The presence of putative sites for binding of transcription factors and other gene expression regulatory proteins was evaluated by UTRscan and defined in the UTRSite Database (http://itbtools.ba.itb.cnr.it/utrscan). 2.8 | Molecular modeling The structures of cyclotides parigidin-br2 and hyla-br1 were modeled through advanced comparative modeling using MODELLER 9.14.[48] First, the structure of circulin B (PDB Code: 2ERI)[49] was identified by BLASTP[50] as the sequence with the highest coverage of parigidin-br2 and hyla-br1. A subroutine for special patching was introduced in order to create a peptide bond between the N- and Cterminal and therefore, setting as “false” the property default patching from automodel class. Then, 100 molecular models were constructed and the model with the smallest DOPE Score was selected. The structure validation was done in PROCHECK[51] and PROSA[52] servers.

787

sequences “[1]G[. . .]NG[33]” and “[1]G[. . .]NG[34]” for hylabr1 and parigidin-br1, repectively. Then, these modified structures were processed with pdb2gmx, using the flag -ter, in order to select the terminal capping: “none” and “COOH” were set for N- and C-terminals, respectively. Subsequently, the coordinates of Gly[33] or Gly[34] were removed from .gro, .itp, and .top files. Finally, the dihedrals, angles, pairs and bonds that were formed by Asn[32] and Gly[33] or Asn[33] and Gly[34] were reconstructed between Asn[32] and Gly[1] or Asn[33] and Gly[1], generating the cyclic topology for GROMACS. The structures were immersed in water, in cubic boxes with a minimum distance of 1 nm between the proteins and the edges of the boxes. Sodium ions were also inserted in order to neutralize the system charge. Geometry of water molecules was constrained using the SETTLE algorithm.[55] All atom bond lengths were linked using the LINCS algorithm.[56] Electrostatic corrections made using the Particle Mesh Ewald algorithm,[57] with a cut-off radius of 1.4 nm in order to minimize the computational time. The same cut-off radius was used for van der Waals interactions. The list of neighbors of each atom was updated every 20 simulation steps of 2 fs. The system underwent an energy minimization using 50,000 steps of the steepest descent algorithm. After that, the system temperature was normalized to 300 K for 100 ps, using the velocity rescaling thermostat (NVT ensemble). Then the system pressure was normalized to 1 bar for 100 ps, using the Parrinello-Rahman barostat (NPT ensemble). The systems with minimized energy, balanced temperature and pressure were simulated for 100 ns using the leap-frog algorithm. 2.10 | Analyses of molecular dynamics trajectories Molecular dynamics simulations were analyzed by means of the backbone root mean square deviation (RMSD), residue root mean square fluctuation (RMSF), radius of gyration and solvent accessible surface area using the g_rms, g_rmsf, and g_sas built-in functions of the GROMACS package,[54] respectively. The distances between Glu and Ser for hyla-br1 and Glu and Thr for parigidin-br2 were measured by means of the g_mindist utility from GROMACS. 2.11 | Phylogenetic relations

2.9 | Molecular dynamics simulations Molecular dynamics simulations of the ensembles (parigidinbr2 and hyla-br1) were carried out in an aqueous environment, using the Single Point Charge water model.[53] The analyses were performed using the GROMOS96 43A1 force field and computational package GROMACS 4.[54] The cyclic topologies for GROMACS were created as follows: the coordinates of the first residue (Gly) were copied and placed after the last one (Asn), generating structures with the

A phylogenetic tree was designed based on the alignment of 26 full-length precursor sequences of cyclotides, including 8 M€obius, 4 chimeric, 10 bracelet (among them parigidin-br2 and hyla-br1) and 4 linear peptides, from the Violaceae, Rubiaceae, Fabaceae, and Poaceae families. The Maximum Parsimony (MP) method was used to carry out phylogenetic analysis. Hierarchical clustering ignored partitions reproduced in fewer than 50% of trees. The Close-NeighborInterchange algorithm was used to obtain the MP tree with

788

|

CUNHA

ET AL.

Multiple sequence alignments of novel and previously described cyclotide precursors. The alignment is split into Rubiaceae (top) and Violaceae (bottom) sequences, comparing the sequences and lengths of the conserved domains. Rubiaceae cyclotide precursors: parigidin-br2 from P. rigida; chac2, chac4 and chac8 from C. chartacea; oak1 and oak2 from O. affinis; hbc1 from H. biflora; and hcf1 from H. centranthoides. Violaceae cyclotide precursors: hyla-br1 from H. lanatus; cycvio13 from V. odorata; vio-bao from V. baoshanensis; hyb-flo from H. floribundus; glo-blak from G.lakeanum; and mra23 from M. ramiflorus. Loop formation is shown between conserved cysteine residues (numbered by Roman numerals). Disulfide bonds are shown by black connectors

FIGURE 1

search level 3 in initial trees. Alignment gaps were not considered in tree construction. Phylogenetic analyses were carried out in MEGA7 with bootstrap statistical test to confirm reliability of the tree.[58] 3 | RESULTS 3.1 | Gene identification For P. rigida, a combination of 30 and 50 RACE PCRs resulted in the amplification of the complete coding sequence of a cyclotide (Supporting Information Figure 1A). Translation of the cDNA resulted in an 82-amino acid peptide (Figure 1). For P. lanata, eight forward primers designed from conserved sequences of cyclotide genes from M. ramiflorus, V. baoshanensis and V. odorata were used in 30 RACE PCR. The PCR carried out using the VoF1 primer resulted in a 600-bp amplicon, which was cloned and sequenced. The complete cyclotide cDNA sequence was obtained using 30 and 50 RACE PCR. Sequencing revealed a 330-nucleotide open reading frame (Supporting Information Figure 1B), encoding a 109-amino acid peptide (Figure 1), presenting the same conserved domains as observed in other cyclotides. The gene was named hyla-br1. In order to compare the two novel precursors with others already described, a multiple sequence alignment was performed using the ClustalW2 software (Figure 1). The two novel precursors showed the same conserved domains observed in other cyclotides, including the ER-signal, NTPD, NTR, MCD, and CTR (Figure 1). The conserved amino acid residues involved in post-translational processing and formation of the CCK were observed in the MCD and CTR domain (Supporting Information Figure 1). MCD and CTR proximal sites for binding and recognition of processing endopeptidases were also detected (formed by MCD N-

terminal glycine and C-terminal asparagine residues, as well as CTR leucine) (Figure 1). A pairwise sequence alignment between parigidin-br2 and parigidin-br1 (Accession B3EWF1.1) revealed that a gene for a different peptide was sequenced, with 96% identity. Therefore, the peptide was named parigidin-br2. The sequence of parigidin-br2 shows two amino acid substitutions relative to parigidin-br1: (1) the substitution of a leucine for an isoleucine at position 59 (Leu59Ile); and (2) the substitution of an asparagine for an aspartate at position 75 (Asn75Asp) (data not shown). 3.2 | Genomic analysis Using the parigidin-br2 and hyla-br1 full cDNA sequences, forward and reverse primers (PrigidaDNAF and PrigidaDNAR; and PlanataDNAF and PlanataDNAR) were designed based on 50 and 30 UTRs, respectively. PCR reactions were performed using purified gDNA of P. rigida and P. lanata as the templates. The resulting amplicons were purified. For P. lanata, one amplicon of nearly 350 bp was detected, cloned into a pGEM®-T Easy vector and sequenced. The sequence was identical to the hyla-br1 mRNA, revealing an intronless gene. For P. rigida, two amplicons of 400 and 500 bp were detected; they were then cloned into separate pGEM®-T Easy vectors, before being sequenced. The sequence of the 400-bp amplicon was identical to the parigidin-br2 cDNA. However, the sequence of the 550-bp amplicon showed an intron of 131 bp within the ER-signal domain (Figure 2A). Therefore, two copies of the same gene were found, one of which was intronless. 3.3 | Motif screening Motif screening analyses indicated a total of 12 candidate motifs distributed along with the parigidin-br2 intronic gene:

CUNHA

|

ET AL.

789

F I G U R E 2 Genomic sequence of parigidin-br2 and its sequence motifs. A: Parigidin-br2 genomic sequence, showing start and stop translation codons (bold) and the presence of a single intron (shaded in dark gray). Putative sites for regulatory protein binding are underlined in blue, green, and orange and, forward and reverse primer annealing positions are underlined in black. Blue lines indicate putative sites for binding of the MYB-related transcription factor. Green lines indicate putative internal ribosome entry sites (IRESs), and the orange line indicates putative binding sites for an iron responsive element (IRE) attachment. B: Candidate motif sequences with their respective SIG values. (a) sequence motif for binding of MYB-related transcription factor (Accession: BAC98495), (b) sequence motif of the IRES, and (c) 3UTR motif of the IRE

one in the 50 UTR, five in the intron and six in the 30 UTR (Figure 2A). Candidate motif sequences were determined using the position weight matrix (PWM) calculated by algorithms BEAM, PRISM and SPACER. The four top-scoring 6ers and 7ers for transcription factor binding sites were ranked according to respective SIG values, as shown in Figure 2B. Seven putative sites for binding of the MYB-related transcription factor (Accession: BAC98495), a defenserelated gene elicitor found in plants like tobacco and Arabidopsis, were detected.[59] Four putative internal ribosome entry sites (IRESs)[60] were found exclusively in the intron, and one putative site for an iron responsive element (IRE)[61] was found in the 30 UTR (Figure 2B). 3.4 | Structural analysis The structures of parigidin-br2 and hyla-br1 were predicted to contain 310 helices, comprising residues [11]LTS[13] and [11] ISS[13], respectively, and a b-sheet (composed of two b-strands) comprising residues [18]SCK[20] and [23]VCY[25], in the fold typical of bracelet subfamily members, which was likely stabilized by three disulfide bridges (Figure 3). Since the three-dimensional structures were constructed using the same template, they were very similar. However, differences were observed in loops 3 and 6, and the structures were evaluated using molecular dynamics simulations. It is important to highlight that parigidin-br2 has 32 amino acid residues, whereas hyla-br1 has 31; thus, they could not be properly compared. According to the RMSD evolution

along the molecular dynamics simulation, both structures were stable, with a variation of less than 4 Å. However, hyla-br1 had more bulky residues than parigidin-br2 (Figure 3), and showed a larger solvent-accessible surface area (Figure 4). In addition, evaluating the movements of each amino acid residue separately, the two cyclotides were found to have different properties. In parigidin-br2, the Phe7 moved a considerable distance, with a an RMSF of 4 Å; for hyla-br1, a similar movement was observed for Phe14 (Figure 4). However, the residue whose movement was most different between the two was Glu3 (Figure 4). This residue is known to stabilize the cyclotide structure, forming a hydrogen bond to a hydroxyl18-containing residue (overall serine or threonine one) in loop 3. In hyla-br1, the Glu3 had an RMSF of about of 3 Å, whereas in parigidin-br2, its RMSF was about 1.5 Å (Figure 4). This variation could due to the fact that, in hyla-br1, the hydrogen bond hydroxylcontaining residue linkage does not form. We measured the minimum distance between this residue and the Thr12 or Ser12 of parigidin-br2 and hyla-br1, respectively, and it was observed that the distance is maximized in hyla-br1, when compared to parigidin-br2. This indicates that the hydrogen bond Glu3···Ser12 could not be formed in hyla-br1. 3.5 | Phylogenetic analysis A multiple sequence alignment of parigidin-br2 and hyla-br1 full-length precursors with 24 other cyclotide precursors from Violaceae, Rubiaceae, Fabaceae and Poaceae families

790

|

CUNHA

ET AL.

Molecular modeling of parigidin-br2 and hyla-br1. The alignment with the template is shown on top, the model structures on middle and their surfaces in bottom. The lines above the sequence alignment indicate the disulfide connectivity; the alignment is written in the cyclic topology, which starts at the first Cys residue. The structure of parigidin-br2 showed 84% of the residues in favored regions and 16% in allowed regions, and a Z-score on PROSA of-5.28. For hyla-br1 it showed 88.5% in favored regions and 7.7% in allowed regions, and a Z-score of 24.98. The loops are colored as follows: loop 1, green; loop 2, cyan; loop 3, magenta; loop 4, pink; loop 5, silver; and, loop 6, indigo. The molecular surface is colored as follows, hydrophobic residues, white; neutral polar, wheat; amine radical, purple; negative charged; red; and positive charged; blue. The amino acids labeled are in loop 6, where there are major differences between the cyclotides

FIGURE 3

was performed and a phylogenetic tree was constructed (Figure 5). Overall, the three could be split in two major branches, the chimeric cyclotides from Fabaceae and the others from Violaceae, Rubiaceae and Poaceae. In this second branch, it could be observed a paraphyletic division, with exclusive branches of linear cyclotides from Poaceae and bracelets from Violaceae. The Rubiaceae sequences were divided in three distinct branches, mixing bracelets and M€obius sequences (Figure 5). Parigidin-br2 presented close relationship to bracelet chac2 from C. chartacea and hylabr1 to mra23 bracelet from M. ramiflorus.

4 | DISCUSSION This work revealed the first complete cDNA and genomic sequences of cyclotides isolated from South American plants. Although the cyclotide parigidin-br1 was previously isolated from P. rigida[26] and many others have been reported from the Hybanthus and Pombalia genera,[21,62–65] little is known about the genetic organization, structure and expression of cyclotides Eight forward primers were utilized to amplify the cDNA containing the full hyla-br1 sequence. Only one forward

CUNHA

ET AL.

|

791

Molecular dynamics simulation analysis of parigidin-br2 (black lines) and hyla-br1 (red lines). The backbone RMSDs along the simulation are shown in top left panel; the residue RMS fluctuations are shown in top right panel; the solvent accessible surface areas are shown in bottom left panel; and the distances between Glu3 and Thr12 (parigidin-br2) or Glu3 and Ser12 (hyla-br1) are shown in bottom right panel

FIGURE 4

primer, VoF1 (50 -GTTGGGCTCTTCCTCATTGC-30 ), provided the full amplification of the 600-bp amplicon in 30 RACE PCR. After cDNA cloning, a total of six experimental clones were sequenced using two primers in triplicate, totalizing 32 sequences. Thirty of these sequences exhibited high quality for analysis. All sequences proved to be the same and codified the precursor of hyla-br1. This surprising result can be explained by the design of primers prior to amplification. P. lanata cyclotide cloning primers were designed from conserved cyclotide gene sequences from M. ramiflorus, V. odorata and V. baoshanensis. The genetic divergence between these species probably is the main reason for the low primer annealing in the 30 RACE PCR. In fact, P. lanata is one of the few species of Violacea found in Brazil, while M. ramiflorus originates from New Zealand, and V. odorata and V. baoshanensis originate from Europe and Asia.[21,26,27,41] Therefore, the evolutionary separation between these species may have resulted in divergence between the sequences of cyclotides genes that were targets of the forward primers. Parigidin-br2 and hyla-br1 did not present additional repetitions of NTR, MCD and CTR domains—a common char-

acteristic of bracelet and M€obius cyclotides. This suggests that there are few or no structural differences in mature peptides encoded by two or more different gene copies in P. rigida and P. lanata. This may be to minimize functional promiscuity and enhance protective activity against pathogens.[40,66] Moreover, sequence comparison of parigidin-br1 and 2 resulted in the detection of two amino acid substitutions: Leu59Ile and Asn75Asp. Although isoleucine and leucine are non-polar aliphatic amino acids without considerable steric differences in their R groups, a polar uncharged residue of asparagine in place of a negatively charged aspartate may alter loop diameter and change biological activity. There is evidence to suggest that a single residue replacement can result in epitope variations that modulate the differential activity of cyclotides.[4,27] The high degree of conserved ER-signal residues in parigidin-br2 and hyla-br1, compared to other bracelet and M€obius cyclotides, confirms the necessity of Golgi complex targeting after ER exposure. This is a crucial step in disulfide bond formation due to appropriate redox conditions in the secretory pathway. Inside the Golgi lumen there is high catalytic activity of components of the ferredoxin/thioredoxin

792

|

CUNHA

ET AL.

Phylogenetic tree assembled by Neighbor Joining showing the evolutionary relations between subfamilies of bracelet, M€ obius, linear and chymeric cyclotides from Rubiaceae, Violaceae, Fabaceae, and Poaceae botanical families. The evolutionary history was inferred using the Maximum Parsimony method. Tree #1 out of 4 most parsimonious trees (length 5 167) is shown. The consistency index is (0.814371), the retention index is (0.864629), and the composite index is 0.704129 (0.704129) for all sites and parsimony-informative sites (in parentheses). The MP tree was obtained using the Subtree-Pruning-Regrafting (SPR) algorithm with search level 3 in which the initial trees were obtained by the random addition of sequences (10 replicates). The analysis involved 26 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 27 positions in the final dataset. Evolutionary analyses were conducted in MEGA7. The respective cyclotide identifications and bootstrap values are aligned to tree branches. The first black capital letter indicates the cyclotide botanical family: “F” for Fabaceae, “P” for Poaceae, “R” for Rubiaceae, and “V” for Violaceae. Colored letters indicate the cyclotide subfamily: green capital “B” for “bracelet”, red capital “M” for M€obius, purple capital “L” for linear and brown capital “C” for chimeric FIGURE 5

system, which allows the oxidizing conditions for the establishment of three disulfide bonds that maintain CCK rigidity.[40] An even higher conservation pattern was observed in glycine and asparagine residues flanking the N- and Cterminal regions of the MCD and an N-proximal leucine in the CTR domain. These amino acids are integral components of the recognition sites for asparaginylendopeptidases that catalyze point cleavages for domain detachment and release of the MCD.[29,67] Although cyclotides present great variations in sequence and structure, it seems that processing for all precursors probably relies on one or a few basic mechanisms.[40] The modeled three-dimensional structures of parigidinbr2 and hyla-br1 presented the classic bracelet subfamily fold, showing one anti-parallel double-stranded b-sheet (one strand composed of residues 14-18 and other strand by resi-

dues 21-25), one 310 helix and three stabilizing disulfide bonds (CysI-CysIV, CysII-CysV, and CysIII-CysVI). The typical six loops were also observed, maintaining a conserved Glu[3] in loop 1, Gly[16] in loop 3 and Asn[27] in loop 6[40]. A comparison of the sequences of parigidin-br2 and hylabr-1 with those of other cyclotides from the Violaceae and Rubiaceae families revealed that both contain a Phe[7] in a region where an aromatic ring is highly conserved (frequently substituted by tryptophan, as observed in chac2, chac8, and cycvio13) and seemingly crucial for the activity of bracelet cyclotides.[68] A well-known mechanism of plant defense against pests is triggered by ingestion; for example, the intake of cyclotides by Helicoverpa armigera and H. punctigera larvae has been shown to disrupt microvilli and rupture the cells of the gut epithelium.[31] The formation of oligomeric cyclotides

CUNHA

|

ET AL.

for pore induction within membranes seems to be closely regulated by peptide binding with exposed phosphatidylethanolamine on the membrane surface.[34,69] For parigidin-br1, such interactions might be a consequence of residues Phe[7] and Ile[8] in loop 2 and Ile[11], Ser[13] and Leu[14] in loop 3 (most of them hydrophobic), with additional electrostatic interactions mediated by the negatively charged Glu[3] in the CCK[26]. It is probable that parigidin-br2 behaves similarly to parigidin-br1, since it presents similar residues in their respective positions, with the exception of Ile[11], which is replaced by Leu[11]. Hyla-br1, despite also presenting the same residues (except for the substitution of Leu[14] for Phe[14]), seems not to behave in a similar way, according to molecular dynamics simulations. Despite the fact that Leu and Phe are hydrophobic residues, molecular dynamics simulations suggested that such a substitution could affect the structure because the Phe[14] in hyla-br1 is more dynamic than the Leu[14] in parigidin-br2. Although the biological activity of parigidin-br2 seems to be insecticidal, due to similarity to parigidin-br1, the biological activity of hyla-br1 remains unknown. Cloning of 50 RACE PCR amplicons revealed a less common characteristic of parigidin-br 2: the presence of a 131-bp intron. The presence of two different copies of the same gene in P. rigida suggests differential expression strategies according to temporal and environmental conditions.[26,27,33] Frequently, the presence of an intron considerably enhances the expression rates in plants by boosting mRNA stability.[70] Although it occurs more often in monocots, especially maize, dicots also seem to respond positively to the presence of introns in immature mRNAs.[71] Analysis of the 50 and 30 UTRs of the parigidin-br2 genomic sequence revealed the presence of seven putative binding sites for the MYB-related transcription factor: five were located in the 30 UTR, and two in the 50 UTR and intron. These motifs are plant cis-regulatory elements involved in transcriptional activation by wounding and treatment with microbial elicitors in response to defense-related stresses, caused by fungi (especially Trichoderma viride) and bacteria.[59] Four putative IRESs were located exclusively in the intron, suggesting the importance of this additional sequence in the differential biosynthesis of parigidin-br2. The IRES allows for the initiation of translation at sides other than the usual translational start site. As a result, protein synthesis can lead to different combinations of derivative peptides.[60] Finally, one putative IRE was found in the 30 UTR. This stem-loop motif is closely regulated by iron-responsive proteins in response to the iron uptake by the cell. At low iron concentrations, iron-responsive proteins bind the IRE and inhibit translation.[61,72,73] The combined roles of the 12 regulatory sites seem to be related to a multi-defense strategy that boosts parigidin-br2 expression when the plant is under

793

biotic stress conditions and modulates alternative mRNA translation for multiple biological activities, downregulating gene expression under restrictive iron environmental conditions. A similar modulation of cyclotide expression due to seasonal and geographical variations has already been confirmed by temporal and tissue-specific accumulation of different cyclotides in Rubiaceae and Violaceae, including parigidin-br1.[26,27,33,35,74] Refined genetic control of cyclotide expression in plants might reflect efficient strategies to promptly repel the pests typical of a particular season, while basal concentrations of other cyclotides can maintain a systemic defense inhibition of ubiquitous pathogens and insects throughout the plant cycle. It seems that different defensive challenges require cyclotide diversification and molecules with variable chemical properties and accumulation rates respecting the tissue-pathogen interaction.[75] Concerning cyclotides phylogenetic relationships, our analysis suggests that the cyclotides compose a paraphyletic group, as observed by Porto et al.,[76] where the sequences evolved in independent processes. Our analysis indicated that parigidin-br2 is closely related to the bracelet cyclotide chac2 from C. chartacea (Rubiaceae), a potent antimicrobial peptide with cytotoxic and hemolytic activities.[19] Hyla-br1, on the other hand, is closely related to mra23 from M. ramiflorus, an antimicrobial cyclotide. Between both pairs, parigidin-br2/chac2 and hyla-br1/mra23, the higher sequence similarity was observed in the ER-signal sequence and in characteristic segments of the MCD: the domain loops, the first b-strand of the b-sheet and in the intermediate cleavage site between the MCD and CTR. Lower sequence identity was observed in residue sequences of the helix 310. This corroborates findings that, although Rubiaceae and Violaceae cyclotides present strikingly similar gene architecture, the predicted precursors commonly have low sequence identity and a distant evolutionary relationship, which is reflected in different presumed biological activities.[19,36] In summary, the determination of complete cDNAs of parigidin-br2 and hyla-br1, as well as the genetic organization of the precursor domains, may contribute to further efforts on molecular cloning and characterization of their biological activity. The discovery of putative sites that possibly influence the expression of both genes may shed some light on the mechanisms that control cyclotide biosynthesis in Rubiaceae and Violaceae; in addition, this knowledge may boost heterologous production and contribute to improved systematic plant protection in the future.

5 | ACCESSION NUMBERS The GenBank accession numbers for the sequences reported in this work are KX306373, KX306374 for the full cDNA

794

|

and genomic DNA sequences of parigidin-br2; and KX306375 for the full cDNA sequence of hyla-br1. R EF ERE NC ES [1] G. K. Nguyen, Y. Lian, E. W. Pang, P. Q. Nguyen, T. D. Tran, J. P. Tam, J Biol Chem 2013, 288, 3370. [2] B. Chen, M. L. Colgrave, N. L. Daly, K. J. Rosengren, K. R. Gustafson, D. J. Craik, J Biol Chem 2005, 280, 22395.

CUNHA

ET AL.

[20] I. Saska, M. L. Colgrave, A. Jones, M. A. Anderson, D. J. Craik, J Chromatogr B Analyt Technol Biomed Life Sci 2008, 872, 107. [21] R. Burman, E. Svedlund, J. Felth, S. Hassan, A. Herrmann, R. J. Clark, D. J. Craik, L. Bohlin, P. Claeson, U. G€oransson, J. Gullbo, Biopolymers 2010, 94, 626. [22] S. T. Henriques, Y. H. Huang, K. J. Rosengren, H. G. Franquelim, F. A. Carvalho, A. Johnson, S. Sonza, G. Tachedjian, M. A. Castanho, N. L. Daly, D. J. Craik, J Biol Chem 2011, 286, 24231.

[3] C. V. Jennings, K. J. Rosengren, N. L. Daly, M. Plan, J. Stevens, M. J. Scanlon, C. Waine, D. G. Norman, M. A. Anderson, D. Craik, J Biochem 2005, 44, 851.

[23] M. Zarrabi, R. Dalirfardouei, Z. Sepehrizade, R. K. Kermanshahi, J Appl Microbiol 2013, 115, 367.

[4] D. C. Ireland, M. L. Colgrave, D. Craik, J. Biochem J 2006, 400, 1.

[24] S. Park, A. A. Str€omstedt, U. G€oransson, PLoS ONE 2014, 9, e91430.

[5] G. K. Nguyen, S. Zhang, N. T. Nguyen, P. Q. Nguyen, M. S. Chiu, A. Hardjojo, J. P. Tam, J Biol Chem 2011, 286, 24275.

[25] M. F. S. Pinto, R. G. Almeida, W. F. Porto, I. C. M. Fensterseifer, L. A. Lima, S. C. Dias, O. L. Franco, J Evid Based Complementary Altern Med 2011, 17, 40.

[6] C. W. Gruber, A. G. Elliott, D. C. Ireland, P. G. Delprete, S. Dessein, U. G€oransson, M. Trabi, C. K. Wang, A. B. Kinghorn, E. Robbrecht, D. Craik, J. Plant Cell 2008, 20, 2471.

[26] M. F. S. Pinto, I. C. M. Fensterseifer, L. Migliolo, D. A. Sousa, G. de Capdville, J. W. Arboleda-Valencia, M. L. Colgrave, D. J. Craik, B. S. Magalh~aes, S. C. Dias, O. L. Franco, J Biol Chem 2012, 287, 134.

[7] J. Koehbach, A. F. Attah, A. Berger, R. Hellinger, T. M. Kutchan, E. J. Carpenter, M. Rolf, M. A. Sonibare, J. O. Moody, G. K. Wong, S. Dessein, H. Greger, C. W. Gruber, Biopolymers 2013, 100, 438.

[28] A. Chagolla-Lopez, A. Blanco-Labra, A. Patthy, R. Sanchez, S. Pongor, J Biol Chem 1994, 269, 23675.

[8] D. J. Craik, N. L. Daly, T. Bond, C. Waine, J Mol Biol 1999, 294, 1327. [9] D. Craik, J. Toxicon 2010, 56, 1092. [10] D. J. Craik, N. L. Daly, J. Mulvenna, M. R. Plan, M. Trabi, Curr Protein Pept Sci 2004, 5, 297. [11] C. K. Wang, M. L. Colgrave, K. R. Gustafson, D. C. Ireland, U. G€oransson, D. J. Craik, J Nat Prod 2008, 71, 47. [12] A. G. Poth, M. L. Colgrave, R. Philip, B. Kerenga, N. L. Daly, M. A. Anderson, D. Craik, J. ACS Chem Biol 2011, 6, 345. [13] A. G. Poth, J. S. Mylne, J. Grassl, R. E. Lyons, A. H. Millar, M. L. Colgrave, D. J. Craik, J Biol Chem 2012, 287, 27033. [14] A. Heitz, J. F. Hernandez, J. Gagnon, T. T. Hong, T. T. Pham, T. M. Nguyen, D. Le-Nguyen, L. Chiche, Biochemistry 2001, 40, 7973. [15] N. L. Daly, L. Thorstholm, K. P. Greenwood, G. J. King, K. J. Rosengren, B. Heras, J. L. Martin, D. J. Craik, J Biol Chem 2013, 288, 36141. [16] N. L. Daly, K. J. Rosengren, D. Craik, J Adv Drug Deliv Rev 2009, 61, 918.

[27] M. Trabi, D. Craik, J. Plant Cell 2004, 16, 2204.

[29] C. W. Gruber, M. Cemazar, M. A. Anderson, D. Craik, J. Toxicon 2007, 49, 561. [30] A. Nourse, M. Trabi, N. L. Daly, D. J. Craik, J Biol Chem 2004, 279, 562. [31] B. L. Barbeta, A. T. Marshall, A. D. Gillon, D. J. Craik, M. A. Anderson, Proc Natl Acad Sci USA 2008, 105, 1221. [32] C. Jennings, J. West, C. Waine, D. Craik, M. Anderson, Proc Natl Acad Sci USA 2001, 98, 10614. [33] S. M. Simonsen, L. Sando, D. C. Ireland, M. L. Colgrave, R. Bharathi, U. G€oransson, D. Craik, J. Plant Cell 2005, 17, 3176. [34] Y. H. Huang, M. L. Colgrave, N. L. Daly, A. Keleshian, B. Martinac, D. J. Craik, J Biol Chem 2009, 284, 20699. [35] M. R. Plan, K. J. Rosengren, L. Sando, N. L. Daly, D. Craik, J. Biopolymers 2010, 94, 647. [36] J. L. Dutton, R. F. Renda, C. Waine, R. J. Clark, N. L. Daly, C. V. Jennings, M. A. Anderson, D. J. Craik, J Biol Chem 2004, 279, 46858. [37] A. Herrmann, R. Burman, J. S. Mylne, G. Karlsson, J. Gullbo, D. J. Craik, R. J. Clark, U. G€oransson, Phytochemistry 2008, 69, 939.

[17] A. S. Ravipati, S. T. Henriques, A. G. Poth, Q. Kaas, C. K. Wang, M. L. Colgrave, D. Craik, J. ACS Chem Biol 2015, 10, 2491.

[38] J. Zhang, B. Liao, D. J. Craik, J. T. Li, M. Hu, W. S. Shu, Gene 2009, 431, 23.

[18] C. Masa, K. Soohyun, M. Tunjung, S. R. Anjaneya, J. C. David, Curr Top Med Chem 2012, 12, 1534.

[39] A. D. Gillon, I. Saska, C. V. Jennings, R. F. Guarino, D. J. Craik, M. A. Anderson, Plant J 2008, 53, 505.

[19] G. K. T. Nguyen, W. H. Lim, P. Q. T. Nguyen, J. P. Tam, J Biol Chem 2012, 287, 17598.

[40] Q. Qin, E. J. McCallum, Q. Kaas, J. Suda, I. Saska, D. J. Craik, J. S. Mylne, BMC Genomics 2010, 11, 111.

CUNHA

|

ET AL.

[41] R. Hellinger, J. Koehbach, D. E. Soltis, E. J. Carpenter, G. K. S. Wong, C. W. Gruber, J Proteome Res 2015, 14, 4851. [42] A. G. Poth, M. L. Colgrave, R. E. Lyons, N. L. Daly, D. Craik, J. Proc Natl Acad Sci USA 2011, 108, 10127. [43] T. A. Hall, Nucleic Acids Symp Ser (Oxf) 1999, 41, 95. [44] M. A. Larkin, G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. Gibson, D. G. Higgins, Bioinformatics 2007, 23, 2947.

795

[60] M. Mokrejs, V. Vopalensky, O. Kolenaty, T. Masek, Z. Feketova, P. Sekyrova, B. Skaloudov a, V. Kríz, M. Pospísek, Nucleic Acids Res 2006, 34, D125. [61] P. Piccinelli, T. Samuelsson, RNA 2007, 13, 952. [62] S. L. Gerlach, U. G€oransson, Q. Kaas, D. J. Craik, D. Mondal, C. W. Gruber, Biopolymers 2013, 100, 433. [63] J. Zhang, J. Li, Z. Huang, B. Yang, X. Zhang, D. Li, D. J. Craik, A. J. M. Baker, W. Shu, B. Liao, J Plant Physiol 2015, 178, 17.

[45] A. Michiels, W. Van den Ende, M. Tucker, L. Van Riet, A. Van Laere, Anal Biochem 2003, 315, 85.

[64] R. Burman, M. Y. Yeshak, S. Larsson, D. J. Craik, K. J. Rosengren, U. G€oransson, Front Plant Sci 2015, 6,

[46] A. Chakravarty, J. M. Carlson, R. S. Khetani, R. H. Gross, BMC Bioinform 2007, 8, 15.

[65] A. F. Attah, R. Hellinger, M. A. Sonibare, J. O. Moody, S. Arrowsmith, S. Wray, C. W. Gruber, J Ethnopharmacol 2016, 179, 83.

[47] J. M. Carlson, A. Chakravarty, C. E. DeZiel, R. H. Gross, Nucleic Acids Res 2007, 35, 259. [48] B. Webb, A. Sali, Curr Protoc Bioinformatics 2002, 47, 1. [49] N. L. Daly, A. Koltay, K. R. Gustafson, M. R. Boyd, J. R. Casas-Finet, D. J. Craik, J Mol Biol 1999, 285, 333. [50] S. F. Altschul, T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, D. Lipman, Nucleic Acids Res 1997, 25, 3389. [51] R. A. Laskowski, M. W. MacArthur, D. S. Moss, J. M. Thornton, J Appl Crystallogr 1993, 26, 283. [52] M. Wiederstein, M. Sippl, J. Nucleic Acids Res 2007, 35, 407. [53] H. J. C. Berendsen, J. P. M. Postma, W. F. van Gunsteren, J. Hermans, In: Intermolecular Forces: Proceedings of the 14th Jerusalem Symposium on Quantum Chemistry and Biochemistry,. (Ed. B. Pullman); Jerusalem, Israel. Dordrecht, Holland: Reidel; 1981, 331–342. [54] B. Hess, C. Kutzner, D. van der Spoel, E. Lindahl, J Chem Theory Comput 2008, 4, 435.

[66] Q. Kaas, D. Craik, J. Biopolymers 2010, 94, 584. [67] E. d’Aloisio, A. R. Paolacci, A. P. Dhanapal, O. A. Tanzarella, E. Porceddu, M. Ciaffi, BMC Plant Biol 2010, 10, 1. [68] D. Craik, J Trends Plant Sci 2009, 14, 328. [69] Z. O. Shenkarev, K. D. Nadezhdin, V. A. Sobol, A. G. Sobol, L. Skjeldal, A. S. Arseniev, febs J 2006, 273, 2658. [70] R. T€opfer, C. Maas, C. H€oricke-Grandpierre, J. Schell, H. H. Steinbiss, Methods Enzymol 1993, 217, 67. [71] C. Maas, J. Laufs, S. Grant, C. Korfhage, W. Werr, Plant Mol Biol 1991, 16, 199. [72] W. Li, P. Lan, BMC Res Notes 2015, 8, 1. [73] O. Agafonov, C. H. Selstø, K. Thorsen, X. M. Xu, T. Drengstig, P. Ruoff, PLoS ONE 2016, 11, e0147120. [74] P. Seydel, C. W. Gruber, D. J. Craik, H. D€ornenburg, Appl Microbiol Biotechnol 2007, 77, 275.

[55] S. Miyamoto, P. A. Kollman, J Chem Theory Comput 1992, 13, 952.

[75] E. K. Gilding, M. A. Jackson, A. G. Poth, S. T. Henriques, P. J. Prentis, T. Mahatmanto, D. Craik, J New Phytol 2015, 210, 717.

[56] B. Hess, H. Bekker, H. J. C. Berendsen, J. G. E. M. Fraaije, J Comput Chem 1997, 18, 1463.

[76] W. F. Porto, V. J. Miranda, M. F. S. Pinto, S. M. Dohms, O. L. Franco, Biopolymers 2016, 106, 109.

[57] T. Darden, D. York, L. Pedersen, J Chem Phys 1993, 98, 10089. [58] J. Felsenstein, Evolution 1985, 39, 783. [59] K. Sugimoto, S. Takeda, H. Hirochika, Plant Cell 2000, 12, 2511.

SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article.