JOURNAL OF BACTERIOLOGY, Aug. 2002, p. 4114–4123 0021-9193/02/$04.00⫹0 DOI: 10.1128/JB.184.15.4114–4123.2002 Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Vol. 184, No. 15
Cloning and Characterization of the Phosphatidylserine Synthase Gene of Agrobacterium sp. Strain ATCC 31749 and Effect of Its Inactivation on Production of High-Molecular-Mass (133)--D-Glucan (Curdlan) Tara Karnezis,1 Helen C. Fisher,1 Gregory M. Neumann,1 Bruce A. Stone,1 and Vilma A. Stanisich2* Departments of Biochemistry1 and Microbiology,2 La Trobe University, Melbourne, Victoria 3086, Australia Received 15 January 2002/Accepted 24 April 2002
Genes involved in the production of the extracellular (133)--glucan, curdlan, by Agrobacterium sp. strain ATCC 31749 were described previously (Stasinopoulos et al., Glycobiology 9:31-41, 1999). To identify additional curdlan-related genes whose protein products occur in the cell envelope, the transposon TnphoA was used as a specific genetic probe. One mutant was unable to produce high-molecular-mass curdlan when a previously uncharacterized gene, pssAG, encoding a 30-kDa, membrane-associated phosphatidylserine synthase was disrupted. The membranes of the mutant lacked phosphatidylethanolamine (PE), whereas the phosphatidylcholine (PC) content was unchanged and that of both phosphatidylglycerol and cardiolipin was increased. In the mutant, the continued appearance of PC revealed that its production by this Agrobacterium strain is not solely dependent on PE in a pathway controlled by the PssAG protein at its first step. Moreover, PC can be produced in a medium lacking choline. When the pssAG::TnphoA mutation was complemented by the intact pssAG gene, both the curdlan deficiency and the phospholipid profile were restored to wild-type, demonstrating a functional relationship between these two characteristics. The effect of the changed phospholipid profile could occur through an alteration in the overall charge distribution on the membrane or a specific requirement for PE for the folding into or maintenance of an active conformation of any or all of the structural proteins involved in curdlan production or transport. would generate a fusion protein capable of delivering the PhoA moiety into the oxidizing environment of the periplasm, where it is active (13). The TnphoA mutagenesis experiments were conducted on LTU114, a curdlan-producing (Crd⫹) but alkaline phosphatase-deficient (Pho⫺) mutant of the wild-type Agrobacterium strain LTU50 (Crd⫹ Pho⫹). This led to the isolation of LTU121, an insertion mutant with restored Pho activity that is defective in curdlan production. The characteristics of LTU121 are the subject of this report. We show that the mutation in LTU121 occurs in a gene, pssAG, whose product is a membrane protein responsible for the formation of phosphatidylserine (PS), the precursor of the quantitatively important membrane phospholipid phosphatidylethanolamine (PE). This finding, together with the demonstration that high-molecular-mass curdlan is produced only if pssAG is functional, establishes the critical role played by the phospholipid composition of Agrobacterium membranes in the production of this extracellular polysaccharide.
Curdlan is an extracellular (133)--D-glucan produced by members of the Rhizobiaceae in the form of aggregates of triple-stranded helices (23). In the case of Agrobacterium sp. strain ATCC 31749, the genes required for curdlan production have been mapped to two distinct loci, I and II (57). Locus I consists of an operon containing three genes, each of which is necessary for curdlan production. One of these genes, crdS (57), encodes a protein homologous with family 2 -glycan synthases, which include cellulose, chitin, and hyaluronan synthases (8; http://afmb.cnrs-mrs.fr/⬃cazy/CAZY/index.html). The CrdS protein has been shown experimentally to be a polytopic inner membrane protein (T. Karnezis, B. A. Stone, and V. A. Stanisich, unpublished data). The crdA and crdC genes flanking crdS, encode proteins that show no significant homology with reported protein sequences, and their roles in curdlan production are yet to be determined. Locus II is believed to contain a regulatory gene (A. Anguillesi, S. J. Stasinopoulos, B. A. Stone, and V. A. Stanisich, unpublished data). Since curdlan is an extracellular polysaccharide, it was anticipated that any ancillary proteins required for its assembly or transport are likely to occur at the cell surface. Thus, additional curdlan-related genes whose protein products were located in the periplasm or were membrane bound with periplasmic domains were sought. The strategy adopted to identify such genes involved random mutagenesis with TnphoA, a transposon that carries the alkaline phosphatase reporter gene (37). Appropriate insertion of TnphoA into a gene of interest
MATERIALS AND METHODS Strains and plasmids. The bacteria and plasmids used in this study are described in Table 1. Plasmids pVS1560, pVS1561 (both pssAG⫹), and pVS1562 (⌬pssAG) carry PCR-derived NdeI-BamHI clones produced from pVS1557 with the forward primer 5⬘-GGGAATTCCATATGGCCCGCAGTGATAGC and the reverse primers 5⬘-CGGGATCCATCGACAATATCGC, 5⬘-CGGGATCCT AAACCTGCGGT, and 5⬘-CGGGATCCATGAGAAGATAAC, respectively. (The underlined sequences here and below indicate restriction enzyme cleavage sites.) Compared with the full-length pssAG sequence (825 bp), the portions present in each of the three clones commence at the ATG start codon and end at nucleotide 770 or 480 beyond the stop codon or at nucleotide 563 within the coding sequence, respectively. Plasmid pVS1568, containing a pssAG-lacZ fusion, was constructed by first cloning the PCR-derived NdeI-BamHI fragment produced from pVS1557 (with primers 5⬘-GGGAATTCCATATGGCCCGCAGTGATAGC and 5⬘-CGGGAT
* Corresponding author. Mailing address: Department of Microbiology, La Trobe University, Melbourne, Victoria 3086, Australia. Phone: 61 3 9479 2317. Fax: 61 3 9479 1222. E-mail:
[email protected] .au. 4114
VOL. 184, 2002
PHOSPHATIDYLSERINE SYNTHASE AND CURDLAN PRODUCTION
4115
TABLE 1. Bacterial strains and plasmids used in this study Strain or plasmid
Agrobacterium sp. LTU50 LTU61 LTU114 LTU121 LTU264 Escherichia coli XL1-Blue S17-1 S17-1(pir) SM10(pir) BL21(DE3)(pLYS) CC118 Plasmids pLAFRI pSWFII pBluescriptIISK⫹ pBBR1MCS-3 pUC19 pET23(a) pRT733 pVS1506 pVS1511 pVS1550 pVS1549 pVS1551 pVS1552–pVS1554 pVS1556 pVS1557 pVS1560 pVS1561 pVS1562 pVS1565 pVS1566 pVS1567 pVS1568 pVS1569 pMC1871 pJP5603
Relevant characteristics
Reference or source
Cmr mutant of ATCC 31749; Crd⫹ Pho⫹; used as the wild-type strain in this work crdS::TnphoA insertion mutant of LTU50; Crd⫺ Pho⫺ mutant of LTU50; Crd⫹ pssAG::TnphoA mutant of LTU114; Crd⫺ Pho⫹ LTU50 pssAG::pVS1569 disruptant; Crd⫺
57 57 This study This study This study
recA1 endA1 F⬘ [proAB⫹ laclq lacZ⌬M15Tn10] Tcr Res⫺ Mod⫹ RP4-2Tc::Mu-Km::Tn7; auxotroph Smr Tpr pir lysogen of S17-1 pir lysogen of SM10; recA RP4-2Tc::Mu; auxotroph Kmr T7pol lysogen recA1 ⌬phoA20 ⌬lacX74 auxotroph
Novagen 54 J. M. Pemberton 54 Novagen 37
Mobilizable broad-host-range cosmid vector; Tcr Contains promoterless phoA cassette; Apr Plasmid vector; Apr Mobilizable broad-host-range plasmid vector; Tcr Plasmid vector; Apr Plasmid vector with T7 10 promoter; Apr Mobilizable suicide vector; oriVR6K oriTRP4 TnphoA; Apr Kmr pLAFR1 with locus I crd genes pLAFR1 with locus II crd genes pUC19 with 7.9-kb EcoRI junction fragment from LTU121; Apr pET23(a) with pUC19 PvuII-BamHI multiple cloning site and lacZ region pUC19 with 1.2-kb HpaI (TnphoA)-EcoRI (LTU121) junction fragment from pVS1550 LTU50 pssAG⫹ genomic clones in pLAFR1 pLAFR1 with 1.6-kb pssAG⫹ EcoRI fragment from pVS1553 pBluescriptIISK⫹ with 1.6-kb pssAG⫹ EcoRI fragment from pVS1556 pET23(a) with 1.3-kb PCR-derived pssAG gene pET23(a) with 845-bp PCR-derived pssAG gene pET23(a) with 563-bp PCR-derived ⌬pssAG gene pBBR1MCS-3 with 845-bp pssAG clone from pVS1561 pBBR1MCS-3 with 563-bp pssAG clone from pVS1562 pVS51549 with pssAG-phoA80 sandwich fusion pVS51549 with pssAG-lacZ replacement fusion pJP5603 with 324-bp PCR-derived internal fragment of pssAG Contains promoterless lacZ cassette, Apr Mobilizable suicide vector; Kmr
21 20 Stratagene 31 69 Novagen 60 57 57 This study This study This study This study This study This study This study This study This study This study This study This study This study This study Pharmacia 49
CCATCTGCTCGCC) into the complementary sites in pVS1549. The lacZ cassette from pMC1871 was then inserted, in-frame, at the unique BamHI site, creating a pssAG-lacZ fusion at pssAG nucleotide 240. The pssAG-phoA-pssAG sandwich fusion in pVS1567 was constructed as follows. A unique BamHI site was introduced at pssAG nucleotide 243 by spliced overlap extension PCR (25) with, sequentially, two sets of primers, 5⬘-GGGA ATTCCATATGGCCCGCAGTGATAGC and 5⬘-CGGCAAGCGGGATCC ATCTGCT plus 5⬘-AGCAGATGGATCCCGCTTGCCG and 5⬘-CGGAATT CATCGACAATATCGC. The desired 1.4-kb product was digested and cloned into pVS1549 in the NdeI and EcoRI sites, and the phoA cassette from pSWFII was then inserted, in-frame, at the unique BamHI site, creating the required fusion. In all cases, the junctions with pssAG DNA were sequenced to ensure that the correct reading frame was maintained. The primers 5⬘-AGCAGATGGATC CGGCTTG and 5⬘-CGGATCCATGAGAAGATAAC were used to amplify a 324-bp internal fragment of pssAG which was cloned to produce pVS1569. Growth media. Escherichia coli strains were grown at 37°C, and Agrobacterium strains were grown at 28°C. The compositions of nutrient broth (NB), nutrient agar (NA), Agrobacterium defined broth (ADB), and aniline blue agar (ABA) have been described previously (57). Luria broth (LB) and Luria agar (LA) (51) were also used. Supplements were added to these media when required to obtain the following final concentrations (in micrograms per milliliter of medium): ampicillin sodium salt, 100; choramphenicol, 50; kanamycin, 50; and tetracycline, 10. Similarly, LA was supplemented with 40 g of 5-bromo-4- chloro-3-indolyl-D-galactopyranoside (X-Gal) and 40 g of 5-bromo-4-chloro-3-indolylphosphate (XP) per ml. Isolation of LTU114 by NTG mutagenesis. LTU114 is a Pho⫺ mutant of LTU50 that was isolated to enable screening for in-frame gene fusions to TnphoA (37). Late-log-phase LTU50 cells were suspended in citrate buffer (pH
5.0) with 100 g of N-methyl-N⬘-nitro-N-nitrosoguanidine (NTG) per ml for 20 min. The bacteria were washed, and an aliquot was grown overnight in 50 ml of NB prior to dilution and plating on LA-XP. LTU114 was a white colony (Pho⫺) mutant that was tested further on ABA and in ADB to ensure that its curdlan production (Crd⫹) capability had not been affected by NTG treatment (see Table 2). Isolation of DNA fragments able to complement the mutation in LTU121. The wild-type allele of the disrupted gene in LTU121 was isolated in the following way. Part of the disrupted gene was cloned from LTU121 on an EcoRI junction fragment containing the kanamycin resistance (Kmr) portion of TnphoA and adjacent genomic DNA, yielding pVS1550. The genomic DNA together with 180 bp of TnphoA was then recovered on a 1.2-kb HpaI (TnphoA)-EcoRI (Agrobacterium) subclone (pVS1551) that served as a probe to screen a genomic library of LTU50 constructed in the cosmid vector pLAFR1. Three positive colonies from ⬇4,500 screened yielded pLAFR1 derivatives (pVS1552 to pVS1554) that contained a common 1.6-kb EcoRI fragment. This fragment was subcloned into pLAFR1, and the recombinant produced, pVS1556, as well as pVS1552 to pVS1554, were transferred individually into LTU121 by mobilization from E. coli S17-1 (54). Curdlan production was restored in all cases, demonstrating that the 1.6-kb EcoRI fragment carried the intact gene of interest. Conjugal mobilization of plasmids. The mobilization of plasmids from E. coli to Agrobacterium strains was achieved by conjugation of the bacteria on a membrane filter, followed by recovery of the transconjugant progeny on ABA selective medium. The procedure has been described (57) and served several purposes: (i) to isolate the in-frame TnphoA insertion mutant, LTU121, following mobilization of pRT733 from E. coli SM10(pir) to LTU114; (ii) to assess functional complementation following the mobilization of pssAG⫹ pLAFR1 or pBBR1MCS-3 recombinant plasmids from E. coli S17-1 to LTU121; and (iii) to
4116
KARNEZIS ET AL.
J. BACTERIOL.
TABLE 2. Biomass, curdlan production, alkaline phosphatase activity, and phospholipid composition of Agrobacterium sp. strain LTU50 and its mutantsa Agrobacterium strain
LTU50 LTU114 LTU121 LTU61
Phenotype ⫹
Crd Pho⫹ Crd⫹ Pho⫺ Crd⫺ Pho⫹ Crd⫺ Pho⫹
Curdlan production
Biomass (g)
Curdlan (g/liter)
Yield (g/g of biomass)
2.0
6.7 ⫾ 0.17
3.4
1.8
6.2 ⫾ 0.14
1.9 2.0
PhoA activity (U)
% of total phospholipidsb PE
PC
5.2 ⫾ 0.027
45 ⫾ 1.3
20 ⫾ 0.2
27 ⫾ 1
9 ⫾ 1.9
3.4
0.004 ⫾ 0.001
44 ⫾ 0.9
25 ⫾ 1.2
30 ⫾ 2.1
6 ⫾ 0.3
0.3 ⫾ 0.07
0.16
117.0 ⫾ 2
ND
24 ⫾ 1.7
55 ⫾ 3
⬍0.2
0.1
NA
NA
NA
PG
NA
CL
21 ⫾ 1.2 NA
a Biomass, curdlan production, and phospholipid content were estimated with 7-day ADB cultures. Alkaline phosphatase activities were determined with mid-logphase cultures in NB. The data are averages from three independent experiments. b ND, not detected; NA, not assayed.
obtain targeted disruptants of the pssAG gene following mobilization of pVS1569 from E. coli S17-1(pir) to LTU50. In all cases, the selective medium contained chloramphenicol and either tetracycline or kanamycin, depending on the marker associated with the donor plasmid. Preparation of membrane and soluble fractions from E. coli. Bacteria were grown to an optical density at 600 nm of 0.6 to 0.8 in 200 ml of LB and induced for 3 h with 0.5 mM IPTG (isopropyl--D-thiogalactopyranoside). The cells were washed and suspended in 10 ml of potassium phosphate buffer (100 mM, pH 7.4), treated on ice for 30 min with lysozyme (200 g/ml), and disrupted by five cycles of freezing (in liquid N2) and thawing (at room temperature). Cell debris was removed by centrifugation at 12,000 ⫻ g for 10 min, and the clarified lysate was recentrifuged for 1 h at 150,000 ⫻ g to obtain the soluble fraction. The pellet, suspended in 400 l of potassium phosphate buffer, served as the membrane fraction. Expression of the Agrobacterium phosphatidylserine synthase gene in E. coli. The pssAG and ⌬pssAG genes were exclusively expressed (58) from the T7 10 promoter of the pET23(a) vector in E. coli BL21(DE3)(pLYS) with a chromosomal Plac-controlled T7 RNA polymerase gene. The procedure was similar to that described before (2) except that the starved bacteria were induced for 30 min with 1 mM IPTG prior to treatment with rifampin (200 g/ml for 30 min at 37°C) and exposure to [35S]methionine-cysteine mix (10 Ci/ml for 5 min). The harvested cells, either whole or fractionated, were analyzed by sodium dodecyl sulfate-polyacrylamide (12%) gel electrophoresis (2). Curdlan and biomass estimation. Curdlan production was assessed by the amount of alkali-soluble polysaccharide produced in 7-day, 25-ml ADB cultures (57). After this treatment, cells were collected by centrifugation, washed with water, freeze-dried, and weighed to quantify biomass. Enzyme assays. Alkaline phosphatase and -galactosidase were measured as described previously (7, 40), with mid-log phase (optical density at 600 nm, 0.6) cultures. In the case of plasmid-encoded activities, the E. coli CC118 bacteria were grown in LB-ampicillin prior to induction with 0.5 mM IPTG for 1 h. The chromosomally encoded alkaline phosphatase activity of Agrobacterium strains was measured with NB cultures, whereas that of E. coli XL1-Blue was measured following induction in 121 medium (64). Phosphatidylserine synthase in soluble and membrane fractions of E. coli BL21(DE3)(pLYS) was assayed as described before (19). The reaction mixtures, with and without 10 mM MnCl2, were incubated at 30°C for 30 min, and the reactions were terminated by the addition of 1 ml of methanol containing 1 M HCl. Chloroform-soluble 3H-labeled products were partitioned from the aqueous phase, dried at 30°C, and measured (33). Phospholipid detection and analysis. Agrobacterium strains were grown for 5 days in 25 ml of ADB. After harvesting, lipids were extracted in chloroform (27) and separated on high-performance silica gel 60 F254 thin-layer chromatography (TLC) plates (Merck, Darmstadt, Germany), with chloroform-methanol-acetic acid (65:25:8, vol/vol/vol). Phospholipids were detected with a phosphate esterspecific spray (17) and identified by Rf comparisons with standards for PS, PE, PC, phosphatidylglycerol (PG), and cardiolipin (CL) (Sigma). In addition, PC was identified with the choline-specific Dragendorff stain reagent (27). Phospholipids on the TLC plates were also detected by staining with iodine vapor. Each spot was then scraped off the plate, and the amount of phospholipid was measured based on its phosphate content (49). Independent identification of PE, PC, and PG was made by electrospray ionization-mass spectrometry (ESI-MS). ESI-MS. ESI-MS was performed on a Perkin-Elmer Sciex API-300 triple quadrupole mass spectrometer with flow injection of samples into a 5-l/min
flow of acetonitrile–0.1% formic acid. Approximately 1 g of unpurified lipid extract was dissolved in 5 l of chloroform and diluted to 100 l with methanol (negative ion mode) or methanol–0.1% formic acid (positive ion mode), yielding sample concentrations of about 10 g/ml. Mass calibration of quadrupoles Q1 and Q3 was accomplished with singly charged poly(propylene glycol) ions from a standard calibration mixture (Applied Biosystems PPG-3000 STD). Mass spectra were averaged from 20 to 40 Q1 scans, with reproducibility confirmed by two to four repeat analyses. MS/MS collisional fragmentation spectra (Q3 product ion scans) were obtained with nitrogen collision gas (4 mtorr pressure) in the Q2 collision cell (20.7-cm cell length) and ion collision energies of 30 to 35 eV. DNA techniques. Molecular cloning techniques were performed according to standard protocols (51). The Agrobacterium sp. strain LTU50 genomic library was prepared with partially digested EcoRI fragments cloned in pLAFR1 (57). The sequences of both strands of the Agrobacterium pssAG gene were determined with pVS1557 and suitable deletion mutants as the template DNAs. Nucleotide sequence accession numbers. The compiled sequence of pssAG has been entered in GenBank under accession number AAL01116. The GenBank accession numbers of other pss sequences used for comparative studies are: Agrobacterium tumefaciens C58, NP354086; Bacillus subtilis, NP388109; Escherichia coli, NP289144; Helicobacter pylori, AAC45587; Mesorhizobium loti, NP108059; Saccharomyces cerevisiae, NP010943; Sinorhizobium meliloti, AAG00422; and wheat (Triticum aestivum), AADE10497.
RESULTS Origin of the Phoⴙ Crdⴚ TnphoA insertion mutant LTU121. Random TnphoA insertion mutagenesis of LTU114 (Pho⫺ Crd⫹) following conjugal mobilization of pRT733 from E. coli resulted in the isolation of LTU121, a mutant in which the restoration of Pho activity was accompanied by the concomitant loss of curdlan production. The latter two features were recognized by the formation of blue colonies on LA selective medium containing the chromogenic PhoA substrate XP (37) and white colonies on selective ABA medium containing the (133)--glucan-specific dye aniline blue (42), respectively. Quantitative assays (Table 2) revealed that the Pho activity of LTU121 was 20-fold higher than that of the wild-type LTU50 and that the mutant was defective in curdlan production, yielding less than 1/20th of normal levels of high-molecular-mass curdlan. It was also noted that although the colonies on ABA remained white on prolonged incubation, flecks of blue staining appeared in areas of high bacterial density. These areas did not develop the dry pellicle typically associated with curdlan production (43), nor did they yield any blue-staining colonies that might have represented revertants to the Crd⫹ phenotype. The Agrobacterium gene disrupted in LTU121 encodes phosphatidylserine synthase and is essential for curdlan produc-
VOL. 184, 2002
PHOSPHATIDYLSERINE SYNTHASE AND CURDLAN PRODUCTION
4117
FIG. 1. Structural analysis of the phosphatidylserine synthase (PssAG) from Agrobacterium sp. strain LTU50. (A) The hydropathy profile of PssAG was generated (32) with a 17-amino-acid (17AA) sliding average. The hydrophobic regions (positive values) form eight putative transmembrane domains (TM I to VIII) recognized by ALOM (30). The residues comprising the TM domains are indicated by brackets and involve the following residues: TM I, 19 to 39; II, 43 to 63; III, 81 to 101; IV, 104 to 124; V, 145 to 165; VI, 170 to 190; VII, 205 to 225; and VIII, 228 to 248. Also shown is the location of a conserved motif (residues 59 to 84) and the sites at which PssAG was fused in the hybrid proteins expressed by LTU121 (PssAG-PhoA) and the plasmids pVS1567 (PssAG-PhoA-PssAG) and pVS1568 (PssAG-LacZ) (see Results for details). (B) Schematic representation of the predicted topology of PssAG showing the location of a conserved motif, Dx2DGx9(S/ T)x2Gx3Dx3D, implicated in the catalytic mechanism (39).
tion. The wild-type allele of the disrupted gene in LTU121 was isolated on a 1.6-kb EcoRI fragment with the strategy described in Materials and Methods. Plasmids carrying this fragment (pVS1552 to pVS1554 and pVS1556) were able to restore curdlan production in LTU121, whereas plasmids carrying locus I (pVS1506) or locus II (pVS1511) could not. This demonstrated that the 1.6-kb EcoRI fragment contained a previously unidentified gene required for curdlan production. The DNA sequence of the new gene was determined and compared with the truncated gene sequence cloned from LTU121 on a 1.2-kb HpaI-EcoRI fragment (pVS1551) (see Materials and Methods). This revealed that the location of the TnphoA insertion in LTU121 was at nucleotide 179 of an 825-bp open reading frame (ORF) that commenced with an ATG start codon and terminated at a TAA stop codon (data not shown). A putative ribosome-binding site (AGAACGGA) preceded the ORF, but no consensus ⫺10 and ⫺35 E. coli-like promoter sequences were detected in the upstream (135-bp) region. The 273-amino-acid sequence deduced from the ORF revealed a highly hydrophobic protein (66% hydrophobic res-
FIG. 2. Amino acid sequence comparison of Agrobacterium PssAG with bacterial and eukaryotic phosphatidylserine synthase proteins. The Clustal W program (61) was used to align the deduced phosphatidylserine synthase sequences from Sinorhizobium meliloti (Sme), Mesorhizobium loti (Mlo), Helicobacter pylori (Hpy), Bacillus subtilis (Bsu), Saccharomyces cerevisiae (Sce), wheat (Triticum aestivum, Tae), and Agrobacterium sp. strain LTU50 (Agr) (this study). Amino acid residues that are identical in all the sequences are denoted by asterisks, and conserved amino acids are denoted by dots. The predicted TM domains I to VIII in PssAG are underlined, and the conserved motif region is in bold.
idues versus 19% hydrophilic and 15% neutral residues) whose hydropathy profile (Fig. 1A) (32) was predicted by ALOM (30) to contain eight transmembrane (TM) domains (TM I to VIII). All but one of these (TM II) was confirmed by the TopPred2 algorithm (66). Analysis with BlastP revealed similarities between the de-
4118
KARNEZIS ET AL.
FIG. 3. Autoradiogram of overexpressed recombinant PssAG and truncated PssAG (⌬PssAG) in E. coli. (A) The proteins expressed by pssAG (in pVS1560) and ⌬pssAG (in pVS1562) were labeled with [35S]methionine-cysteine as described in Materials and Methods, separated by SDS-PAGE with a 12% (wt/vol) gel under reducing conditions, and detected by autoradiography. Lane 1, PssAG; lane 2, ⌬PssAG. (B) Detection of radiolabeled PssAG in the membrane and soluble fractions of E. coli carrying pVS1560. The E. coli control carried the empty vector pET23(a). Lane 1, PssAG (soluble); lane 2, PssAG (membrane); lane 3, vector alone (soluble); lane 4, vector alone (membrane). Positions of molecular size markers are shown in kilodaltons.
duced Agrobacterium LTU50 product and various prokaryotic and eukaryotic phosphatidylserine synthase (Pss) proteins. The highest homologies were with putative Pss sequences identified in the recently reported genome sequences of A. tumefaciens C58 (99% identity) (http://www.ncbi.nlm.nih.gov:80/cgi-bin /Entrez/framik?db⫽genome&gi ⫽189), Sinorhizobium meliloti 1021 (75% identity, 86% similarity) (9), and Mesorhizobium loti (64% identity, 81% similarity) (26). This contrasts with values of between 16 and 37% identity and 35 and 58% similarity with Pss proteins from Bacillus subtilis (45), Helicobacter pylori (22), Saccharomyces cerevisiae (44), and wheat, Triticum aestivum (12), the enzymatic functions of which have been confirmed. In comparison, there was no homology between the Agrobacterium sp. strain LTU50 product and the corresponding synthase (PssA) from E. coli, a protein that is associated with the ribosomal cell fraction (10, 34), or with putative PssA homologues from other bacteria. These findings suggest that the disrupted ORF in Agrobacterium sp. strain LTU50 is a pss gene (here designated pssAG) that encodes a membrane-associated, i.e., a subclass II (39), phosphatidylserine synthase. This view was further supported by Clustal W alignment of PssAG and related Pss sequences (Fig. 2), which revealed a motif, Dx2DGx2ARx5S/Tx2Gx3DSx2D, where xn represents the indicated number of any nonconserved residues. This motif is similar to that present in subclass II Pss proteins and in other phosphatidyltransferases and aminoalcohol phosphotransferases and thought to be involved in their reaction mechanisms (39). The motif (PssAG residues 59 to 84) forms a potential amphipathic helix and extends from the N-terminal part of TM II through the weakly hydrophilic region between residues 60 to 80 and into the C-terminal part of TM III (Fig. 1A and B).
J. BACTERIOL.
Expression and enzymatic activity of the Agrobacterium pssAG gene product in E. coli. To obtain experimental evidence for the cellular location and enzymatic activity of the PssAG protein, the pssAG gene was expressed in E. coli from the 1.3-kb clone in pVS1560, a construct in which the native ribosomebinding site of pssAG was replaced by the strong ribosomebinding site from the pET23(a) vector. A single labeled product of ⬇30 kDa (Fig. 3A, lane 1) was observed, consistent with that predicted for PssAG (30,687 Da). A truncated protein expressed from a 3⬘ deletant of pssAG (pVS1562) also yielded a product of the expected size (⬇20 kDa) (Fig. 3A, lane 2). Moreover, when pVS1560-containing E. coli was lysed and the cellular components were fractionated prior to analysis by SDS-PAGE, PssAG was detected only in the membrane fraction (Fig. 3B, lane 2), supporting the prediction (Fig. 1B) that it is a membrane-associated protein. The enzymatic activity of PssAG was assessed in the cytoplasmic and membrane fractions from pVS1557-containing E. coli (pssAG⫹) and those with the empty pET23(a) vector with the procedure developed for the B. subtilis Pss homologue (19, 45). Figure 4 shows that the incorporation of [3H]serine into a chloroform-soluble product was detected exclusively in the membrane fraction from the pssAG⫹ cells and was dependent on the presence of Mn2⫹ ions. These characteristics are those expected of a Bacillus-type (subclass II) Pss enzyme (39). Characteristics of the conserved motif in PssAG. The conserved motif that occurs in Pss proteins and related transferases is thought to be associated with the inner face of the cytoplasmic membrane (39). However, LTU121, with TnphoA inserted at nucleotide 179 to create a PhoA fusion at residue 1 of the PssAG motif, has a Pho⫹ phenotype (Table 2). This suggested that the PhoA moiety, and hence the motif region at the fusion site, is periplasmic. An alternative explanation for the Pho⫹ phenotype of LTU121 is that perturbation of the protein at the fusion site may have prevented the formation of TM II, marooning the PhoA moiety in the periplasm instead of
FIG. 4. Enzymatic activity of overexpressed recombinant PssAG in E. coli. Membrane fractions (hatched bars) and soluble fractions (open bars) from E. coli carrying pVS1560 (pssAG⫹) or the unloaded pET23(a) vector (pssAG⫺) were assayed for the incorporation of 3H label into chloroform-soluble products as described in Materials and Methods. The membrane fraction was also assayed without added MnCl2 (shaded bar).
VOL. 184, 2002
PHOSPHATIDYLSERINE SYNTHASE AND CURDLAN PRODUCTION
4119
FIG. 5. Comparison of lipid extracts from the Agrobacterium pssAG mutant LTU121, its pssAG⫹ parent, LTU114, and the wild-type strain LTU50. Chloroform-soluble material was extracted from bacteria harvested from 5-day ADB cultures and separated by TLC as described under Materials and Methods. Individual phospholipids were detected with a phosphate ester-specific stain (17), and their mobilities (Rf) were compared with those of phospholipid standards (CL, PG, PE, PS, and PC). O, origin; F, solvent front.
positioning it in the cytoplasm, as expected from the topological model (Fig. 1B). To distinguish between these possibilities, two in vitro gene fusions were constructed and analyzed in E. coli CC118, one resulting in a PhoA sandwich fusion at residue 21 of the PssAG motif (pVS1567) and the other in a confirmatory LacZ replacement fusion at residue 20 (pVS1568). Both fusion sites are in the weakly hydrophilic motif region close to TM III (Fig. 1B) and thus should not interfere with the formation with TM II. In keeping with this expectation, the phenotype conferred by pVS1567 was PhoA⫺ (10.2 versus 152 U from the positive control, XL1-Blue, and 0.7 U from CC118) and that by pVS1568 was LacZ⫹ (356 versus 520 U in the positive control, XL1-Blue carrying pUC19, and 2.0 U from CC118). These findings suggest that the motif region of PssAG, at least in the vicinity of residues 20 and 21, is exposed to the cytoplasm. Phospholipid composition of the Agrobacterium pssAG mutant LTU121. The sequence analysis of LTU121 showed that it carried an insertion mutation in pssAG. The effects of this mutation on the phospholipid profile of LTU121 were assessed by comparison with the profiles of LTU50 (the wild-type strain) and LTU114 (the parent strain) by one-dimensional TLC separation of the extracted lipids, followed by staining and quantitative assays based on phosphate content. This assay showed that four major phospholipids (Fig. 5, Table 2) were present in similar amounts in LTU50 and LTU114. These were identified as PE, PC, PG, and CL based on their Rf values. In contrast, LTU121 exhibited several changes, including the absence of PE, consistent with the loss of PssAG and hence of PS, the immediate precursor of PE. LTU121 also had elevated
FIG. 6. ESI-MS mass spectra of phospholipids from the wild-type LTU50, the pssAG mutant LTU121, and other Agrobacterium strains. Positive-ion ESI-MS mass spectra for phospholipid extracts were obtained as described in Materials and Methods from the following Agrobacterium strains: (A) wild-type LTU50; (B) pssAG mutant LTU121; (C) LTU121 carrying pVS1565 (pssAG⫹); and (D) LTU121 carrying pVS1566 (⌬pssAG). Peaks were identified on the basis of molecular mass and MS/MS collisional fragmentation spectra (Fig. 7) as PC(x:y) or PE(x:y), containing a total of x acyl carbons and y double bonds, as indicated. (⫹Na), sodium adduct ion.
levels of PG and especially CL, possibly reflecting a compensatory mechanism to restore membrane stability (39). Finally, contrary to the expectation that PC production in bacteria depends on the methylation of PE (46), LTU121 continued to produce a PC-like lipid that corresponded to the wild-type PC in Rf value and stained with the choline-specific Dragendorff reagent (27). The identification of phospholipids extracted from the wildtype Agrobacterium sp. strain LTU50 was confirmed by positive-ion ESI-MS (Fig. 6A), which revealed a major singly charged ion peak at m/z 786.6 ⫾ 0.2 Da, corresponding to a monoprotonated 785.6-Da PC [expected mass for PC(36:2) is 785.67 Da]. This was confirmed by MS/MS collisional fragmentation of m/z 786.7 (Fig. 7A), which gave the expected single major peak at m/z 184 due to the choline phosphate head group (24, 35). The major phospholipid peak at m/z 744.6 (Fig. 6A) was identified as the PE(36:2), as confirmed by MS/MS fragmentation involving loss of the 141-Da PE head group, ethanolamine phosphate (Fig. 7C). ESI-MS was similarly used to identify minor wild-type phospholipid peaks due to PC(34: 1), PC(34:2), PE(37:2), PE(34:1), and PE(34:2), as indicated in
4120
KARNEZIS ET AL.
FIG. 7. MS/MS collisional fragmentation spectra of phospholipids from the wild-type LTU50, the pssAG mutant LTU121, and other Agrobacterium strains. Positive-ion MS/MS collisional fragmentation spectra (from selected precursor ions as in Fig. 6) were obtained as described in Materials and Methods for m/z 786.6 ions from (A) wildtype LTU50 and (B) pssAG mutant LTU121 and for m/z 744.6 ions from (C) wild-type LTU50 and (D) LTU121 carrying pVS1565 (pssAG⫹). The characteristic m/z 184 fragment peak due to the PC head group, choline phosphate, was used to identify both m/z 786.6 precursor ions as PC(36:2), as indicated in A and B. The characteristic loss of 141 Da (PE head group) was used to identify both m/z 744.6 precursor ions as PE(36:2), as indicated in C and D.
Fig. 6A, and to show that both PE(37:2) and PC(34:2) contribute to the minor peak at m/z 758.6 (data not shown). By contrast, phospholipids extracted from the pssAG mutant (LTU121) gave a positive-ion electrospray mass spectrum (Fig. 6B) which differed conspicuously from that for the wild type (Fig. 6A) in that peaks due to PE were completely absent; however, a closely similar pattern of PC(36:2), PC(34:1), and PC(34:2) phosphatidylcholines was observed for both the mutant and wild-type strains, as confirmed by MS/MS (e.g., Fig. 7B; other data not shown). Negative-ion mass spectra of the wild-type and pssAG mutant phospholipids (data not shown) exhibited only peaks due to phosphatidylglycerol, consisting mainly of PG(36:2) with two C18:1 chains and a lesser amount of PG(34:1) with a C16:0 chain in the sn-1 position and a C18:1 chain in the sn-2 position, as determined by MS/MS (data not shown) (35). Significant levels of phospholipids other than PC, PE, and PG were not observed in any of the phospholipid extracts analyzed, whether in positive- or negative-ion mode. On the basis of the above data, it was concluded that membranes of the pssAG mutant contain high levels of the same
J. BACTERIOL.
phosphatidylcholines as found in the wild type but do not contain significant levels of any of the phosphatidylethanolamines elaborated by the wild type. Correlation between pssAG function, curdlan production, and phospholipid profile. The involvement of the pssAG gene in curdlan production was identified by the loss of this phenotype in the insertion mutant LTU121 (Table 2) and its restoration in the presence of pVS1556 (a 1.6-kb clone containing pssAG). These findings, however, do not exclude the possibility that the phenotypic changes were due, respectively, to polarity on and complementation by a gene located immediately downstream of pssAG. We therefore used PCR methods to isolate only the pssAG sequence (in pVS1565) and showed that it too could complement the defect in LTU121 (data not shown). Similarly, a 324-bp internal fragment of pssAG was cloned in a suicide plasmid and used to obtain targeted disruptants via recombinational insertion of the construct (pVS1569) into the pssAG genomic sequence. Such disruptants (Cmr Kmr) were isolated at a frequency of ⬇5 ⫻ 10⫺8/donor and behaved like LTU121, that is, they were Crd⫺ and their insertion mutations were complemented by pVS1565 (three, including LTU264, were tested). Finally, the phospholipid profile of the complemented strain, LTU121 carrying pVS1565, was determined and compared with that of a corresponding strain carrying a truncated pssAG gene (⌬pssAG in pVS1566). Positive-ion electrospray mass spectra for phospholipids from the complemented strain (Fig. 6C) were closely similar to those for the wild-type LTU50 (Fig. 6A), consistent with the restoration of PssAG activity. The level of PE relative to PC was about twofold lower, however, compared with LTU50, but it is not known whether this difference resulted from a lower absolute level of PE or a higher absolute level of PC, or both. There were no differences in the identities of phospholipids as determined by MS/MS (Fig. 7C and D; other data not shown). As expected, positive-ion electrospray mass spectra for phospholipids from LTU121 (pVS1566) (Fig. 6D) were closely similar to those for LTU121 (Fig. 6B), in which the major phospholipid present was PC(36: 2). Taken together, these findings establish a functional relationship between pssAG activity and its consequent effect on the phospholipid profile and the ability of Agrobacterium sp. strain LTU50 to produce high-molecular-mass curdlan. Growth characteristics of the pssAG mutant LTU121. Although the mutation affecting LTU121 occurred in a gene involved in phospholipid biosynthesis, growth of the mutant on NA was not significantly affected but was reduced in the more stringent ADB medium (doubling time, ⬇12 h versus ⬇6 h for LTU50). It has been shown (10, 53) that the growth arrest phenotype of pssA mutants of E. coli is partially suppressed by added Mg2⫹, presumably because this ion stabilizes the membrane. This raised the possibility that the curdlan deficiency of LTU121 could be due, at least in part, to a membrane destabilization resulting from the pssAG mutation. This possibility was not, however, sustained experimentally. Although MgCl2 supplementation of ADB (10 or 20 mM) restored the growth rate of LTU121 to near that of the wild type, it failed to have a corresponding effect on the ability of the strain to produce curdlan.
VOL. 184, 2002
PHOSPHATIDYLSERINE SYNTHASE AND CURDLAN PRODUCTION
FIG. 8. Pathways for phospholipid synthesis in bacteria. The reactions in the pathways are catalyzed by phosphatidylserine synthase (Pss), phosphatidylserine decarboxylase (Psc), phosphatidylmethyl transferase (Pmt), and phosphatidylcholine synthase (Pcs).CDP-DAG, ●●.
DISCUSSION In this paper, we show that LTU121, a TnphoA insertion mutant of Agrobacterium sp. strain LTU50, is unable to produce high-molecular-mass curdlan owing to disruption of its previously uncharacterized phosphatidylserine synthase (pssAG) gene. The resulting phenotypic changes, namely, a phospholipid profile that entirely lacks PE (Table 2, Fig. 5 and 6) and the production of curdlan at 1/20th the wild-type level (Table 2), were specifically attributable to the gene disruption because reintroduction of the pssAG sequence into LTU121 restored the wild-type status for both features. By expressing PssAG in E. coli, we showed that this protein is a subclass II, membrane-associated, and Mn2⫹-dependent phosphatidylserine synthase (Fig. 3B and 4). The only other report of such an enzyme in a gram-negative bacterium is in H. pylori (22). However, database searches show that PssAG homologues occur not only in Rhizobiaceae (Fig. 2) but also in diverse gram-negative bacteria, demonstrating that this enzyme type is distributed beyond the gram-positive bacteria with which it is more generally associated (39). The subclass II Pss proteins and related phosphatidyl or aminoalcohol transferases contain a conserved motif, Dx2DGx2ARx4S/Tx2Gx3Dx3D, that has been implicated in their catalytic mechanism based on enzyme inactivation following site-directed substitutions at the S/T residue (50, 65) and on the location of the motif in a predicted cytoplasmic domain enabling access of intracellular substrates (39, 50). We obtained topological evidence from the phenotypes conferred by PssAG-PhoA and PssAG-LacZ hybrids fused at sites near TM III that the motif region is cytoplasmic, consistent with the topology shown in Fig. 1B. The phospholipid profile of LTU121 demonstrated the phenotypic consequences of the pssAG::TnphoA mutation. The most dramatic alteration was that LTU121, unlike the wildtype strain (LTU50), contained no detectable PE in the chloroform-extractable lipids when assessed by TLC (Fig. 5) or ESI-MS (Fig. 6A and B). This suggests that PE synthesis in this Agrobacterium strain occurs via PS, presumably by the first
4121
reaction in the pathway (Fig. 8) that occurs in both grampositive and gram-negative bacteria (18). Remarkably, despite the lack of PE in LTU121, the level of PC was unaltered (Table 2, Fig. 6A and B). This was unexpected, as PC is produced by methylation of PE in those bacteria in which PC is a major phospholipid (48). Bacteria that typically produce PC include members of the Rhizobiaceae, e.g., A. tumefaciens (36) and S. meliloti (15, 16) and some other gram-negative bacteria (e.g., Rhodobacter sphaeroides (1) and Zymomonas mobilis (59, 68). A single N-methyltransferase is able to perform all three methylation steps (1, 14, 59), although in Bradyrhizobium japonicum, an additional N-methyltransferase has been proposed (41). None of these methylation pathways can operate in LTU121, as the precursor PE is unavailable (Fig. 8). A clue to the ability of LTU121 to produce PC by a pathway that bypasses PE is provided by the recent findings of de Rudder and coworkers (15, 16). They showed that pmt mutants of S. meliloti, deficient in N-methyltransferase, produced PC by an alternative pathway that is dependent on exogenous choline (Fig. 8). The enzyme involved, phosphatidylcholine synthase (Pcs), forms PC directly from CDP-diacylglycerol and choline (56). LTU121, like the S. meliloti pmt mutants, is able to grow in minimal medium, but only LTU121 can produce PC in the absence of added choline. Thus, in LTU121, the choline substrate must arise de novo, for example, by a pathway from serine, as has been proposed in Fusarium graminearum (47). It would then be available as a substrate for the Pcs pathway or, perhaps, a novel pathway. The former may be the more likely, as a homologue of the S. meliloti Pcs is encoded by A. tumefaciens C58. Although LTU121 lacked PE in its membranes, it grew in ADB minimal medium, albeit at a reduced rate compared to the wild type. Loss of the PE, the predominant wild-type phospholipid, appears to be compensated for by the elevated levels of the anionic PG and CL (Table 2), as also seen in E. coli pssA mutants (10, 53). Indeed, plasticity of the phospholipid profile appears to be a strategy to compensate for the mutational loss of major phospholipids and is also seen in E. coli mutants that lack PG or CL; these accumulate the anionic precursor phosphatidic acid (29, 38). Mg2⫹ supplementation also permits the E. coli pssA mutants to grow in rich medium without an alteration in phospholipid content (10, 53). In the case of LTU121, Mg2⫹ supplementation enhanced growth but did not restore curdlan production. Finally, in relation to the main focus of this work, the most important finding was that inactivation of pssAG changed the phospholipid profile of LTU121 and at the same time dramatically reduced the yield of curdlan. Significantly, both characteristics were restored when the strain was complemented with the intact pssAG gene, establishing a clear correlation between the phospholipid profile and the ability to produce curdlan. The activating effect of phospholipids on membrane-associated enzymes, including glycosyltransferases, is well established. For example, CL is quite specifically required for the activity of hyaluronan synthase from Streptococcus pyogenes, and CL, PE, or phosphatidic acid activates its counterpart in Streptococcus equisimilis (62). Plant (133)--glucan synthases from soybean (Glycine max) (28) and red beet (Beta vulgaris) (55) are also activated by phospholipids, as are chitin synthases from several microfungi (3).
4122
KARNEZIS ET AL.
A number of potential mechanisms might explain these observations. Membrane lipids have an important role in the folding of membrane proteins and for maintenance of their active conformations (4, 67). In the wild-type Agrobacterium sp. strain LTU50, phospholipid could be required for the folding or maintenance of folding of one or more of the structural proteins involved in curdlan production. For example, curdlan synthase (57), a polytopic inner membrane protein (T. Karnezis, unpublished data) may be misfolded in LTU121. Alternatively, the folding of the curdlan synthase or other curdlan proteins in the membrane may be critical for the passage of the nascent glucan chain across the inner membrane bilayer. These effects may be related to a change in the overall charge on the membrane to a more negative value due to the absence of the zwitterionic PE and the somewhat increased level of PG and CL (Table 2). In such an environment, the curdlan synthase may be inactive. On the other hand, the absence of PE may be the specific cause of the curdlan deficiency, since all the other major phospholipids are present in LTU121. This would be comparable to the dependence of hyaluronan synthases from Streptococcus spp. on CL (62, 63) or to the involvement of PE in the function of lactose permease (LacY) of E. coli. In reconstituted membranes, LacY has an almost absolute requirement for the zwitterionic PE (or PS) (52), as it is not folded correctly in PEdeficient membranes (6). Here, PE is proposed to act as a lipochaperone and to exert its effect on folding at a late step of the conformational maturation of LacY (5, 6). By analogy, in the absence of PE, curdlan synthase, although present in the membranes of LTU121 (T. Karnezis, B. A. Stone, and V. A. Stanisich, unpublished data), would be inactive, and thus curdlan production would be suppressed. Another possible function for PE could be to assist in the assembly and/or maintenance of a curdlan transport complex in, for example, the outer membrane leaflet. A paradigm for this would be the preferential requirement for PE in the assembly of porin monomers and their trimerization to the active porin in the outer membrane of E. coli (11). Further analysis of the curdlan synthase-PE relationship will be required to distinguish between these possibilities. ACKNOWLEDGMENTS This work was supported in part by an Australian Research Council grant (AO9925079). We thank J. M. Pemberton for strains and Trevor Lithgow for helpful advice and comments. REFERENCES 1. Arondel, V., C. Benning, and C. R. Somerville. 1993. Isolation and functional expression in Escherichia coli of a gene encoding phosphatidylethanolamine methyltransferase (EC 2.1.1.17) from Rhodobacter sphaeroides. J. Biol. Chem. 268:16002–16008. 2. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1994. Current protocols in molecular biology. Wiley, New York, N.Y. 3. Binks, P. R., G. D. Robson, M. W. Goosey, and A. P. J. Trinci. 1993. Inhibition of phosphatidylcholine and chitin biosynthesis in Pyricularia oryzae, Botrytis fabae and Fusarium graminearum by edifenphos. J. Gen. Microbiol. 139:1371–1377. 4. Bogdanov, M., and W. Dowhan. 1999. Lipid-assisted protein folding. J. Biol. Chem. 274:36827–36830. 5. Bogdanov, M., and W. Dowhan. 1998. Phospholipid-assisted protein folding: Phosphatidylethanolamine is required at a late step of the conformational maturation of the polytopic membrane protein lactose permease. EMBO J. 17:5255–5264.
J. BACTERIOL. 6. Bogdanov, M., J. Sun, H. R. Kaback, and W. Dowhan. 1996. A phospholipid acts as a chaperone in assembly of a membrane transport protein. J. Biol. Chem. 271:11615–11618. 7. Brickman, E., and J. Beckwith. 1975. Analysis of the regulation of Escherichia coli alkaline phosphatase synthesis with deletions and 80 transducing phages. J. Mol. Biol. 96:307–316. 8. Campbell, J. A., G. J. Davies, V. Bulone, and B. Henrissat. 1997. A classification of nucleotide-diphospho-sugar glycosyltransferases based on amino acid sequence similarities. Biochem. J. 326:929–939. 9. Capela, D., F. Barloy-Hubler, J. Gouzy, G. Bothe, F. Ampe, J. Batut, P. Boistard, A. Becker, M. Boutry, E. Cadieu, S. Dreano, S. Gloux, T. Godrie, A. Goffeau, D. Kahn, E. Kiss, V. Lelaure, D. Masuy, T. Pohl, D. Portetelle, A. Puhler, B. Purnelle, U. Ramsperger, C. Renard, P. Thebault, M. Vandenbol, S. Weidner, and F. Galibert. 2001. Analysis of the chromosome sequence of the legume symbiont Sinorhizobium meliloti strain 1021. Proc. Natl. Acad. Sci. USA 98:9877–9882. 10. DeChavigny, A., P. N. Heacock, and W. Dowhan. 1991. Sequence and inactivation of the pss gene of Escherichia coli: Phosphatidylelthanolamine may not be essential for cell viability. J. Biol. Chem. 266:5323–5332. 11. de Cock, H., M. Pasveer, J. Tommassen, and E. Bouveret. 2001. Identification of phospholipids as new components that assist in the in vitro trimerization of a bacterial pore protein. Euro. J. Biochem. 268:865–875. 12. Delhaize, E., D. M. Hebb, K. D. Richards, J. M. Lin, P. R. Ryan, and R. C. Gardner. 1999. Cloning and expression of a wheat (Triticum aestivum L.) phosphatidylserine synthase. J. Biol. Chem. 274:7082–7088. 13. Derman, A. I., and J. Beckwith. 1991. Escherichia coli alkaline phosphatase fails to acquire disulfide bonds when retained in the cytoplasm. J. Bacteriol. 173:7719–7722. 14. de Rudder, K. E. E., L. I. M. Lopez, and O. Geiger. 2000. Inactivation of the gene for phospholipid N-methyltransferase in Sinorhizobium meliloti: phosphatidylcholine is required for normal growth. Mol. Microbiol. 37:763–772. 15. de Rudder, K. E. E., C. Sohlenkamp, and O. Geiger. 1999. Plant-exuded choline is used for rhizobial membrane lipid biosynthesis by phosphatidylcholine synthase. J. Biol. Chem. 274:20011–20016. 16. de Rudder, K. E. E., O. J. E. Thomas, and O. Geiger. 1997. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase. J. Bacteriol. 179:6921–6928. 17. Dittmer, J. C., and R. L. Lester. 1964. A simple, specific spray for the detection of phospholipids on thin-layer chromatograms. J. Lipid Res. 5:126–127. 18. Dowhan, W. 1997. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66:199–232. 19. Dutt, A., and W. Dowhan. 1981. Characterization of a membrane-associated cytidine diphosphate-diacylglycerol-dependent phosphatidylserine synthase in bacilli. J. Bacteriol. 147:535–542. 20. Ehrmann, M., D. Boyd, and J. Beckwith. 1990. Genetic analysis of membrane protein topology by a sandwich gene fusion approach. Proc. Natl. Acad. Sci. USA 87:7574–7578. 21. Friedman, A. M., S. R. Long, S. E. Brown, W. J. Buikema, and F. M. Ausubel. 1982. Construction of a broad host range cosmid cloning vector and its use in the genetic analysis of Rhizobium mutants. Gene 18:289–296. 22. Ge, Z., and D. E. Taylor. 1997. The Helicobacter pylori gene encoding phosphatidylserine synthase: sequence, expression and insertional mutagenesis. J. Bacteriol. 179:4970–4976. 23. Harada, T., and A. Harada. 1996. Curdlan and succinoglycan, p. 21–57. In S. Dumitriu (ed.), Polysaccharides in medical applications. Marcel Dekker, New York, N.Y. 24. Hiyashi, A., T. Matsubura, M. Morita, T. Kinoshita, and T. Nakamura. 1989. Structural analysis of choline phospholipids by fast atom bombardment mass spectometry and tandem mass spectrometry. J. Biochem. (Tokyo) 106: 264–269. 25. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site-directed mutagenesis by overlap extension with the polymerase chain reaction. Gene 77:51–59. 26. Kaneko, T., Y. Nakamura, S. Sato, E. Asamizu, T. Kato, S. Sasamoto, A. Watanabe, K. Idesawa, A. Ishikawa, K. Kawashima, T. Kimura, Y. Kishida, C. Kiyokawa, M. Kohara, M. Matsumoto, A. Matsuno, Y. Mochizuki, S. Nakayama, N. Nakazaki, S. Shimpo, M. Sugimoto, C. Takeuchi, M. Yamada, and S. Tabata. 2000. Complete genome structure of the nitrogen-fixing symbiotic bacterium Mesorhizobium loti (supplement). DNA 7:381–406. 27. Kates, M. 1986. Techniques in lipidology: isolation, analysis and identification of lipids, 2nd ed., vol. 3, part 2. Elsevier, Amsterdam, The Netherlands. 28. Kauss, H., and W. Jeblick. 1986. Synergystic activation of 1,3--D-glucan synthase by Ca2⫹ and polyamines. Plant Sci. 43:103–107. 29. Kikuchi, S., I. Shibuya, and K. Matsumoto. 2000. Viability of an Escherichia coli pgsA null mutant lacking detectable phosphatidylglycerol and cardiolipin. J. Bacteriol. 182:371–376. 30. Klein, P., M. Kanehisha, and C. Dehisi. 1985. The detection and classification of membrane spanning proteins. Biochim. Biophys. Acta 815:468–476. 31. Kovach, M. E., R. W. Phillips, P. H. Elzer, R. M. Roop II, and K. M. Peterson. 1994. pBBR1MCS: a broad host-range cloning vector. BioTechniques 16:300–302.
VOL. 184, 2002
PHOSPHATIDYLSERINE SYNTHASE AND CURDLAN PRODUCTION
32. Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105–132. 33. Larson, T. J., and W. Dowhan. 1976. Ribosomal-associated phosphatidylserine synthetase from Escherichia coli: purification by substrate-specific elution from phosphocellulose with cytidine 5⬘-diphospho-1,2-diacyl-sn-glycerol. Biochemistry 15:5212–5218. 34. Louie, K., Y. C. Chen, and W. Dowhan. 1986. Substrate-induced membrane association of phosphatidylserine synthase from Escherichia coli. J. Bacteriol. 165:805–812. 35. Lytle, C. A., Y. D. Gan, and D. C. White. 2000. Electrospray ionisation mass spectrometry compatible with reverse phase separation of phospholipids: piperidine as a post column modifier for negative ion detection. J. Microbiol. Methods 41:227–234. 36. Manasse, R. J., and W. A. Corpe. 1967. Chemical composition of the cell envelopes from Agrobacterium tumefaciens. Can. J. Microbiol. 13:1591–1603. 37. Manoil, C. 1990. Analysis of protein localization by use of gene fusions with complementary properties. J. Bacteriol. 172:1035–1042. 38. Matsumoto, K. 2001. Dispensible nature of phosphatidylglcerol in Escherichia coli: dual roles of anionic phospholipids. Mol. Microbiol. 39:1427–1433. 39. Matsumoto, K. 1997. Phosphatidylserine synthase from bacteria. Biochim. Biophys. Acta 1348:214–227. 40. Miller, J. H. 1972. Assay of -galactosidase, p. 352–355. In J. H. Miller (ed.), Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 41. Minder, A. C., K. E. E. de Rudder, F. Narberhaus, H.-M. Fischer, H. Hennecke, and O. Geiger. 2001. Phosphatidylcholine levels in Bradyrhizobium japonicum membranes are critical for an efficient symbiosis with soybean host plant. Mol. Microbiol. 39:1186–1198. 42. Nakanishi, I., K. Kimura, S. Kusui, and E. Yamazaki. 1974. Complex formation of gel-forming bacterial (133)--D-glucans (curdlan-type polysaccharides) with dyes in aqueous solution. Carbohydr. Res. 32:47–52. 43. Nakanishi, I., K. Kimura, T. Suzuki, M. Ishikawa, I. Banno, T. Sakane, and T. Harada. 1976. Demonstration of a curdlan-type polysaccharide and some other (133)--glucan in microorganisms with aniline blue. J. Gen. Appl. Microbiol. 22:1–11. 44. Nikawa, J., Y. Tsukagoshi, T. Kodaki, and S. Yamashita. 1987. Nucleotide sequence and characterisation of the yeast PSS gene encoding phosphatidylserine synthase. Eur. J. Biochem. 167:7–12. 45. Okada, M., H. Matsuzaki, I. Shibuya, and K. Matsumoto. 1994. Cloning, sequencing, and expression in Escherichia coli of the Bacillus subtilis gene for phosphatidylserine synthase. J. Bacteriol. 176:7456–7461. 46. Ridgway, N. D., and D. E. Vance. 1988. Kinetic mechanism of phosphatidylethanolamine N-methyltransferase. J. Biol. Chem. 263:16864–16871. 47. Robson, G. D., M. G. Weibe, B. Cunliffe, and A. P. J. Trinci. 1995. Cholineand acetylcholine-induced changes in the morphology of Fusarium graminearum: evidence for the involvement of choline transport system and acetyl cholinesterase. Microbiology 141:1309–1314. 48. Rock, C. O., S. Jackowoski, and J. E. J. Cronan. 1996. Lipid metabolism in prokaryotes, p. 35–74. In D. E. Vance and J. E. Vance (ed.), Biochemistry of lipids, lipoproteins and membranes. Elsevier, Amsterdam, The Netherlands. 49. Rouser, G., S. Fleisher, and A. Yamamoto. 1970. Two-dimensional thin layer chromatographic separation of polar lipids by phosphorus analysis of spots. Lipids 5:494–496. 50. Saha, S. K., Y. Furukawa, H. Matsuzaki, and I. Shibuya. 1996. Directed mutagenesis, Ser-56 to Pro, of Bacillus subtilis phosphatidylserine synthase drastically lowers enzymatic activity and relieves amplification toxicity in Escherichia coli. Biosci. Biotechnol. Biochem. 60:630–633. 51. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
52. 53.
54. 55. 56. 57.
58. 59. 60. 61.
62.
63.
64. 65.
66. 67. 68. 69.
4123
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Seto-Young, D., C.-C. Chen, and T. H. Wilson. 1985. Effect of different phospholipids on the reconstitution of two functions of the lactose carrier of Escherichia coli. J. Membr. Biol. 84:259–287. Shibuya, I., C. Miyazaki, and A. Ohta. 1985. Alteration of phospholipid composition by combined defects in phosphatidylserine and cardiolipin synthases and physiological consequences in Escherichia coli. J. Bacteriol. 161: 1086–1092. Simon, R., U. Priefer, and A. Pu ¨hler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology 1:784–790. Sloan, M. E., P. Rodis, and B. P. Wasserman. 1987. CHAPS solubilization and functional reconstitution of -glucan synthase from red beet (Beta vulgaris L.) storage tissue. Plant Physiol. 85:516–522. Sohlenkamp, C., K. E. E. de Rudder, V. Rohrs, I. M. Lopez-Lara, and O. Geiger. 2000. Cloning and characterization of the gene for phosphatidylcholine synthase. J. Biol. Chem. 275:18919–18925. Stasinopoulos, S. J., P. R. Fisher, B. A. Stone, and V. A. Stanisich. 1999. Detection of two loci involved in (133)--glucan (curdlan) biosynthesis by Agrobacterium sp. ATCC31749 and comparative sequence analysis of the putative curdlan synthase gene. Glycobiology 9:31–41. Tabor, S., and C. R. Richardson. 1985. A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc. Nat. Acad. Sci. USA 82:1074–1078. Tahara, Y., T. Yamashita, A. Sogabe, and Y. Ogawa. 1994. Isolation and characterization of Zymomonas mobilis mutant defective in phosphatidylethanolamine N-methyltransferase. J. Gen. Appl. Microbiol. 40:389–396. Taylor, R. K., C. Manoil, and J. J. Mekalanos. 1989. Broad-host-range vectors for delivery of TnphoA: use in genetic analysis of secreted virulence determinants of Vibrio cholerae. J. Bacteriol. 171:1870–1878. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673–4680. Tlapak-Simmons, V. L., B. A. Baggenstoss, T. Clyne, and P. H. Weigel. 1999. Purification and lipid dependence of the recombinant hyaluronan synthases from Streptococcus pyogenes and Streptococcus equisimilis. J. Biol. Chem. 274:4239–4245. Tlapak-Simmons, V. L., E. S. Kempner, B. A. Baggenstoss, and P. H. Weigel. 1998. The active streptococcal hyaluronan synthases (HASs) contain a single HAS monomer and multiple cardiolipin molecules. J. Biol. Chem. 273: 26100–26109. Torriani, A. 1966. Alkaline phosphatase from Escherichia coli, p. 224–234. In G. L. Cantoni and R. Davies (ed.), Procedures in nucleic acid research. Harper and Row, New York, N.Y. Usui, M., H. Sembongi, H. Matsuzaki, K. Matsumoto, and I. Shibuya. 1994. Primary structures of the wild-type and mutant alleles encoding the phosphatidylglycerophosphate synthase of Escherichia coli. J. Bacteriol. 176: 3389–3392. Von Heijne, G. 1992. Sequence determinants of membrane protein topology. New Comp. Biochem. 22:75–84. White, S. H., A. S. Ladokhin, S. Jayasinghe, and K. Hristova. 2001. How membranes shape protein structure. J. Biol. Chem. 276:32395–32398. Yamashita, S., and J. I. Nikawa. 1997. Phosphatidylserine synthase from yeast. Biochim. Biophys. Acta 1348:228–235. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequence of the M13mp18 and pUC19 vectors. Gene 33:103–119.
