Mammalian Genome 12, 117–123 (2001). DOI: 10.1007/s003350010240 Incorporating Mouse Genome
© Springer-Verlag New York Inc. 2001
Cloning, expression, genomic localization, and enzymatic activities of the mouse homolog of prostate-specific membrane antigen/ NAALADase/folate hydrolase Dean J. Bacich,1 John T. Pinto,2 William P. Tong,3 Warren D.W. Heston1 1 Department of Cancer Biology, George M O’Brien Urology Research Center for Prostate Cancer, The Cleveland Clinic Foundation, 9500 Euclid Ave, Cleveland, Ohio 44195, USA 2 Nutrition Research Laboratory, Memorial Sloan-Kettering Cancer Center, New York, N.Y. 10021, USA 3 Pharmacology Analytical Laboratory, Memorial Sloan-Kettering Cancer Center, New York, N.Y. 10021, USA
Received: 18 April 2000 / Accepted: 19 September 2000
Abstract. Human Prostate Specific Membrane Antigen (PSMA), also known as folate hydrolase I (FOLH1), is a 750-amino acid type II membrane glycoprotein, which is primarily expressed in normal human prostate epithelium and is upregulated in prostate cancer, including metastatic disease. We have cloned and sequenced the mouse homolog of PSMA, which we have termed Folh1, and have found that it is not expressed in the mouse prostate, but primarily in the brain and kidney. We have demonstrated that Folh1, like its human counterpart, is a glutamate-preferring carboxypeptidase, which has at least two enzymatic activities: (1) N-acetylated ␣-linked L-amino dipeptidase (NAALADase), an enzyme involved in regulation of excitatory signaling in the brain, and (2) a ␥-glutamyl carboxypeptidase (folate hydrolase). The 2,256-nt open reading frame of Folh1 encodes for a 752-amino acid protein, with 86% identity and 91% similarity to the human PSMA amino acid sequence. Cells transfected with Folh1 gained both NAALADase and folate hydrolase activities. Examination of tissues for NAALADase activity correlated with the mRNA expression pattern for Folh1. Fluorescent in situ hybridization (FISH) revealed Folh1 maps to only one locus in the mouse genome, Chromosome 7D1-2.
Introduction The protein encoded by the Prostate Specific Membrane Antigen (PSMA) gene has been the subject of intense interest in the fields of oncology, neuroscience, and nutritional science. In oncology it has been investigated as a prostate cancer marker and for its potential as a diagnostic and therapeutic target in humans (reviewed in Heston 1997a). In addition, PSMA has become the focus of even more intense interest owing to the recent findings that it is selectively expressed in the neovasculature of nearly all types of solid tumors, but not in the vasculature of normal tissue (Chang et al. 1999a, 1999b; Liu et al. 1997; Silver et al. 1997). Neuroscientists are interested in the physiological role played by this protein in the rat brain, where it is known as N-acetylated ␣-linked Lamino dipeptidase (NAALADase; reviewed in Coyle 1997; Neale et al. 2000). Nutritional scientists are interested in this protein and its role as a unique folate hydrolase located within the porcine and human intestine (Halsted et al. 1998). However, despite the fact that these scientific disciplines have been studying this protein for the last 10 years, it is only in the last 3 years that it has become apparent that these proteins are encoded by the same gene. Correspondence to: W.D.W. Heston; E-mail:
[email protected]
PSMA has been shown to possess both folate hydrolase (Pinto et al. 1996) and NAALADase activity (Carter et al. 1996) and has been designated glutamate carboxypeptidase II (EC 3.4.17.21) by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology. NAALADase refers to the glutamate carboxypeptidase activity of PSMA that hydrolyzes Nacetylaspartylglutamate (NAAG) to free glutamate and Nacetylaspartate (NAA), which are both excitatory neurotransmitters. The hydrolytic activity of NAALADase is non-competitively inhibited by quisqualate, a neurotoxin. Altered activity of NAALADase has been associated with various human neurological disorders including Schizophrenia (Coyle 1997), Alzheimer’s disease, and Huntington’s disease (Passani et al. 1997). In addition, increased levels of NAALADase have been observed in animal models for epilepsy (Meyerhoff et al. 1992) and amyotrophic lateral sclerosis (Tsai et al. 1993). Inhibition of this enzyme in rodents has been shown to reduce neurological damage caused by glutamate release following strokes (Slusher et al. 1999). The folate hydrolase activity of PSMA functions by exopeptidase hydrolysis of glutamate moieties from pteroylpoly-␥glutamates (poly-␥-glutamated folate) or folate derivatives (such as methotrexate poly-␥-glutamate; Pinto et al. 1996). In the human and pig jejunal brush border, PSMA is thought to process a heterogeneous mixture of dietary poly-␥-glutamated folates, which can then be transported across the intestinal mucosa (Halsted et al. 1998; Heston 1997a; Pinto et al. 1996). The function of PSMA in the human prostate is unknown. We have previously hypothesized that the folate hydrolase activity of the human PSMA gene products may be involved in the etiology and progression of prostate cancer. An alternatively spliced transcript of PSMA known as PSM’ encodes for a protein that is located in the cytosol (Grauer et al. 1998; Su et al. 1995). PSM’ is found predominantly in the normal prostate; however, at some stage during malignant transformation of the prostate, there is a switch in the mRNA splicing pattern, such that the predominant PSMA transcript encodes for the membrane-bound protein (Su et al. 1995). The cytosolically located folate hydrolase activity of PSM’ may place normal prostate cells at risk for developing a low folate intracellular environment, which in turn can directly lead to DNA damage and carcinogenesis (Heston 1997b; Heston et al. 1997). Genomic mapping of the human PSMA gene has revealed two highly similar genes on the p and q arms of Chromosome (Chr) 11 (Leek et al. 1995; Rinker-Schaeffer et al. 1995). The gene at 11p11-p12 encodes for the PSMA transcript expressed in the prostate (O’Keefe et al. 1998b), and the gene at 11q14 has been demonstrated to have a different expression pattern (O’Keefe et al.
118
D.J. Bacich et al.: Cloning of the mouse prostate-specific membrane antigen homolog
1998a, 1998b). Identification of the genes homologous to PSMA in the mouse and their expression patterns will be interesting since the PSMA and PSMA-like genes are reported to have diverged 22 million years ago (O’Keefe et al. 1998b), after the divergence of the mouse and human lineages. FOLH1 / Prostate-Specific Membrane Antigen / NAALADase has an important role in prostate carcinogenesis and progression, glutamatergic neurotransmission and folate absorption. In addition, FOLH1 is being used as a therapeutic target for prostate and other cancers, as well as for neurological disorders (Heston et al. 1997; Slusher et al. 1999). Suitable animal models are needed to elucidate the role and function that this protein has on these processes. Therefore, to understand the biological role of PSMA, we have chosen to use the mouse as our animal model. We describe here the cloning and characterization of the mouse homolog of FOLH1 / Prostate-Specific Membrane Antigen / NAALADase.
Materials and methods
ized to normal metaphase chromosomes derived from mouse embryo fibroblast cells in a solution containing 50% formamide, 10% dextran sufate, and 2 × SSC. Specific hybridization signals were detected by hybridizing with anti-digoxigenin antibodies followed by counterstaining with DAPI (see Fig. 3a).
Transfection of Folh1 into PC-3 cells. The Folh1 cDNA was subcloned into the pIRESneo eukaryotic expression vector (Clonetech). PC-3 cells were then transiently transfected with Folh1pIRESneo via the Lipofectamine Plus protocol (Life Technologies). The cells were harvested 48 h after transfection and assayed for NAALADase activity. As a control, PC-3 cells were mock transfected or transfected with the pIRESneo vector alone.
Folate hydrolase assay. Hydrolase activity was determined by using capillary electrophoresis as described earlier (Waltham et al. 1997). Transfected PC-3 cells were incubated with 5 M methotrexate triglutamate (MTX-Glu3) in the presence or absence of 100 M quisqualate. Medium was removed from the transfected cells at various time points and stored at −20°C until the medium could be analyzed by capillary separation and UV detection of MTX-Glu3 and its deglutamated derivatives.
Animals and RNA isolation. Tissues were isolated from NIH Swiss nude (nu/nu) mice (Taconic Farms, Germantown, NY), and RNA was isolated by using TRI REAGENT™ (Sigma Biosciences, St. Louis, Mo.).
Cloning and sequencing of mouse Folh1. A full-length cDNA encoding Folh1 (Genbank accession AF026380) was cloned from mouse hippocampal enriched tissue via RT-PCR by using degenerate primers based on regions of homology between the human and rat PSMA cDNAs or the mouse EST AA104937. For RT-PCR analyses, RNA (1 g) was reverse transcribed by using the Superscipt II RT-PCR kit (Life Technologies, Gaithersgurg, Md.). The primers used in the PCR included: primer RS [5⬘- AAGTTGCCAGAGATGTGGAA -3⬘], primer MAS [5⬘- GTCAATGCCAC CAAATACCC-3⬘], primer MS [5⬘-GAACATGCTTATAGGCATGAG-3⬘], and primer RAS [5⬘-TAGTCTACTTCTCTCAGAGTC-3⬘]. PCR cycles were: 94°C for 5 min followed by 35 cycles of 94°C for 1 min, 58°C for 1 min, and 72°C for 1 min. Two overlapping PCR products were generated from mouse brain cDNA, of 1179 bp and 1426 bp, corresponding to the entire open reading frame of FOLH1. The RT-PCR products were cloned into the vector pCR2.1 (Invitrogen, San Diego, Calif.), and at least three clones of each were sequenced. Five prime Rapid Amplification of cDNA Ends (5⬘RACE) was then performed to obtain the 5⬘ untranslated region by using the 5⬘ RACE system version 2.0 (Life Technologies) to generate 86 bases of mouse 5⬘UTR sequence. The 3⬘ end of the gene was cloned by using a primer homologous to the rat cDNA sequence RAS2488, 5⬘-GGGTATTTG GGAAGGGTG-3⬘, and a primer within the mouse open reading frame MS2254, 5⬘-GCTTCTAAGGCCTGGAGCGA-3⬘, to generate a 351-bp fragment. These four fragments were subcloned by digestion with appropriate restriction enzymes and were ligated together to generate the entire Folh1 cDNA sequence.
Northern analyses. RNA (10 g) was separated on a denaturing 1% agarose gel containing 1× MOPS and 6.7% formaldehyde, before transfer to Nytran Plus membrane (Schleicher and Schuell, Keene, N.H.). Hybridization was performed in Hybrisol (Oncor, Gaithersburg, Md.) with a 32PCTP incorporated cRNA probe (2 × 106 cpm/ml) to the entire open reading frame of Folh1 at 56°C. The blots were washed in 0.1 × SSC, 0.1% SDS, at 65°C, and autoradiography was performed.
Chromosomal localization by FISH. A mouse P1 genomic library was screened by using a PCR-based method by Genome Systems (St. Louis, Mo). The oligonucleotides used corresponded to the 5⬘ end of the Folh1 cDNA sequence and are as follows: MPSMs-39 (5⬘- GTGGAAGAGA ACTGCTGAGGA-3⬘) and MPSMas75 (5⬘-TGTCCCAACACGGAGCCAGCGCTGGCG3⬘). Verification of the one P1 clone obtained was done by sequencing, and the P1 clone was used to map Folh1 by fluorescence in situ hybridization (Genome Systems). A second experiment was conducted in which a probe specific for the centromeric region of Chr 7 was cohybridized with the P1 clone to verify the identity of the chromosome to which the probe bound (data not shown). The probes were labeled with digoxigenin, then hybrid-
NAALADase assay. Enzyme activities were determined on either membrane fractions from NIH Swiss nude mice tissues (kidney, brain, and liver) and LNCaP cells, or on whole cell lysate from PC3 cells transiently transfected with either CMV driven Folh1 or empty vector control based on the standard method (Slusher et al. 1990).
Results and discussion Cloning of Folh1. The cDNA sequence of Folh1 has been deposited in Genbank (accession number AF026380). The ORF continues for 2256 bp and encodes for a 752-amino acid putative type II receptor, consisting of an N-terminal intracellular domain of 19 amino acids, a 25-amino acid transmembrane domain, and a 708amino acid extracellular domain (Fig. 1). Comparison of the deduced amino acid sequence with the known homologs of Folh1 revealed a significantly high similarity with rat NAALADase (96%), human PSMA (91%), and porcine folyl-poly-␥-glutamate carboxypeptidase (89%). There was also significant similarity of the amino acid sequence with human NAALADase II (82%), human NAALADase L protein (64%), and NAALADase L’s rat homolog ileal peptidase I100 (55%). In vivo, Folh1 has been observed as an approximately 94-kDa product, suggesting glycosylation of the protein at one or more of the 10 potential N-linked glycosylation sites (data not shown). Rat NAALADase, human PSMA, and porcine folylpoly-␥-glutamyl carboxypeptidase contain 9, 10, and 12 potential N-linked glycosylation sites respectively (Bzdega et al. 1997; Halsted et al. 1998; Israeli et al. 1993). Seven of the glycosylation sites of the PSMA homologs are conserved among the four species and so may play an important role in the carboxypeptidase activity or protein folding. As predicted by previous comparisons of the M28 peptidase family (Halsted et al. 1998; Rawlings and Barrett 1997), the zincbinding ligands at Asp389, Glu427, His555 for the first zinc atom, and Asp389, His379, and Asp455 for the second zinc atom were all conserved in Folh1. The conservation of the extracellular domain in the human, rat, pig, and mouse carboxypeptidase proteins suggests that much of this region is important for activity and/or function. The region of greatest homology among these forms and the other M28 peptidases encompasses the peptidase-active sites and zinc-binding domains. The rest of the extracellular domain is highly conserved among the PSMA homologs, but not with the other M28 peptidase family members, and probably corresponds to a unique ligand-binding site or other potential functions of these enzymes. Coyle and associates recently demonstrated by site-
D.J. Bacich et al.: Cloning of the mouse prostate-specific membrane antigen homolog
Fig. 1. Complete nucleotide and amino acid sequence for Folh1. The consensus nucleotide and deduced single letter amino acid sequence is shown. An asterisk shows the stop codon. The 10 potential N-linked glycosylation sites are shaded. The predicted 25 amino acid transmembrane domain deduced from hydrophilicity plot is boxed. The putative Zn2+ binding domain is underlined, with the residues predicted to be involved in
119
Zn2+ binding indicated with an unfilled arrow. Residues important in a putative ␣/ hydrolase catalytic site are indicated by a filled arrow, and four positively charged residues predicted to be involved in substrate binding are conserved and indicated by hexagons. The nucleotide sequence data is available from Genbank under the accession number AF026380.
120
D.J. Bacich et al.: Cloning of the mouse prostate-specific membrane antigen homolog
Fig. 2. Northern Analyses of Folh1 in various mouse tissues. Total RNA was extracted from various tissues from adult nude (nu/nu) mice. The blot containing 10 g of RNA run in each lane was hybridized with a 2.4-kb Folh1 cRNA probe. The upper panel reveals that Folh1 is highly expressed in the mouse kidney and brain, and expressed at lower levels in the testis, ovary, and mandibular gland. No expression was seen in the other mouse tissues. The position of the 28 and 18S ribosomal bands are indicated, as well as the position of the major Folh1 band. The lower panel is the ethidium bromide staining of the RNA on the membrane, demonstrating equal loading and undergraded RNA.
directed mutagenesis that alteration of the conserved zinc ligandbinding sites significantly reduces or abolishes the enzymatic activity (Speno et al. 1999). The lack of any motif conservation among homologs in the intracellular and transmembrane domains suggests that these regions do not encode any functionally conserved active sites or motifs, and probably functions as a membrane-anchoring mechanism. However, human PSMA does have a unique dileucine repeat motif in the intracellular domain. Dileucine repeats have been shown to mediate internalization and targeting to endosomes and lysosomes (Letourneur and Klausner 1992). Human PSMA has been demonstrated to internalize, pos-
sibly mediating transport of folate into the cell (Liu et al. 1998). This may represent one of the unique functional differences among PSMA and its homologs. mRNA expression pattern of the mouse homolog of PSMA. Various mouse tissues were analyzed for Folh1 mRNA expression by Northern blot analysis, revealing the major Folh1 transcript is approximately 2.5 kb and is expressed predominantly in the hippocampal region of the brain and the kidney, with lower levels of expression seen in the ovary, testis, and mandibular gland (Fig. 2).
Fig. 3. (A) Chromosomal localization of Folh1 by fluorescence in situ hybridization, and (B) diagrammatic representation of the chromosomal localization of Folh1. Hybridization of the P1 clone containing the Folh1 gene to mouse Chr 7D1-D2 is indicated by the arrows.
D.J. Bacich et al.: Cloning of the mouse prostate-specific membrane antigen homolog
121
In addition to the major 2.5-kb transcript, a faint higher band of approximately 8 kb was also observed in the kidney. Surprisingly, no expression was seen in the mouse prostate or proximal small intestine, two tissues that express high levels of PSMA in humans (Israeli et al. 1994; Silver et al. 1997). No expression was observed in the colon, liver, lung, spleen, heart, and seminal vesicles. This expression pattern is very similar to that reported in the rat, though significantly different from that seen in human and pig. In humans, the major site of expression is in the prostate, and we did not detect any Folh1 mRNA in the mouse prostate. Chromosomal localization by FISH. To determine the chromosomal localization of the Folh1 gene, initial fluorescent in situ hybridization (FISH) experiments demonstrated specific hybridization of the P1 clone, containing the Folh1 gene, to the distal portion of a medium-sized chromosome that was thought to be Chr 7, as determined by DAPI staining (Fig. 3a). The P1 probe was then cohybridized with a probe specific for the centromeric region of Chr 7, confirming that Folh1 localizes to Chr 7. Measurement of Chr 7 from 10 separate metaphase cells demonstrated that the P1 clone specifically hybridized to a location that is 47% of the distance from the heterochromatic-euchromatic boundary to the telomere of Chr 7, an area that corresponds to band 7D1-D2 (Fig. 3b). In total, 80 metaphase cells were analyzed, with 69 exhibiting specific labeling. Genes on mouse Chr 7D1-D2 share a conserved synteny with genes on human Chr 11q14. Considerable controversy resulted over the chromosomal localization of human PSMA, with two loci being candidates for the gene, namely 11q14 and 11p11-p12. Recent studies from our laboratory confirmed that the human PSMA gene is located at 11p11-p12 (O’Keefe et al. 1998b). We also demonstrated that there is a homolog of the PSMA gene located at 11q14 and that the human gene was duplicated 22 million years ago (O’Keefe et al. 1998b). Since the divergence of human and mouse occurred considerably earlier than 22 million years ago, it is not surprising that only one Folh1 locus was identified. The presence of only one Folh1 locus was also confirmed by Southern analysis (data not shown). This indicates that the evolutionary ancestor of the PSMA gene originated on human Chr 11q14. Given that the mouse homolog is not expressed in the prostate, it suggests that the prostate-specific enhancer(s) that controls the expression of PSMA in the human prostate evolved subsequent to the duplication. Although NAALADase II maps to human Chr 11q14.3-q21, a region syntenic with 7D1-D2 in the mouse, this gene has only 67% identity with Folh1, whereas the PSMA-like gene described by O’Keefe et al. (1998b), which also resides at 11q14, has approximately 86% identity with Folh1. NAALADase activity in mouse tissues. To determine whether various mouse tissues that express Folh1 mRNA corresponded with glutamyl carboxypeptidase activity, NAALADase reactions were performed. As seen in Fig. 4a, considerable NAALADase activity was observed in membrane preparations from mouse kidney and brain, as expected; very low levels were measured in testis and mandibular gland, and negligible activity was detected in prostate, liver, and heart. NAALADase assays were performed in triplicate and in at least two different experiments, both in the presence and absence of quisqualate, a specific inhibitor of the human, rat, and pig NAALADase. This strongly suggests that the peptidase activity of Folh1 is similar to that of the human PSMA homolog. Recently, low levels of NAALADase activity were reported in the mouse prostate (Tiffany et al. 1999). However we were unable to detect any significant NAALADase activity in this tissue above background levels, and we did not detect any Folh1 mRNA transcripts in this tissue either by Northern analyses or the more sensitive RT-PCR method. This may be owing to strain differences in the mice used, or expression of another carboxypeptidase. We are
Fig. 4. (a) NAALADase activity in various mouse tissues and (b) in PC3 cells cells transfected with vector alone or vector carrying the Folh1 cDNA sequence. Membrane preparations from the tissues or transiently transfected PC3 cells were isolated and examine for NAALADase activity as described in Materials and methods. The human prostate cancer cell line LNCaP was used as a positive control. Significant levels of NAALADase expression were observed in the mouse brain and kidney, and in PC3 cells transfected with the Folh1 cDNA sequence. Both the human and mouse forms of the enzyme are specifically inhibited by the addition of 100 M quisqualic acid (+Quis).
confident that the mouse prostates that we examined did not express Folh1. NAALADase and folate hydrolase activity of PC-3 cells transfected with Folh1. To determine whether Folh1 possesses NAALADase activity, membrane preparations of PC-3 cells transiently transfected with Folh1 were analyzed for NAALADase activity, as described in Materials and methods. Folh1-transfected PC-3 cells possessed NAAG hydrolysis activity (Fig. 4b). Addition of 100 M quisqualate to the reaction inhibited this enzymatic activity by 91% ± 5%, which is consistent with the reported human, pig, and rat NAALADase sensitivity. Mock and pIRESneotransfected PC-3 cells produced only background levels of NAAG hydrolysis (Fig. 4b), while LNCaP cell membranes that contain the PSMA protein demonstrated quisqualate-sensitive NAAG hydrolysis. To determine whether Folh1 possesses folate hydrolase activity, we examined the percentage of MTX-Glu3, MTX-Glu2, MTXGlu, and MTX in the media of PC-3 cells either mock transfected, transfected with an expression vector containing the Folh1 cDNA sequence, transfected with vector alone, or PC-3 cells stably transfected to express human PSMA at 0-, 3-, and 6-h time points. These experiments were performed in the presence and absence of 100 M quisqualate. Figure 5a demonstrates that 3 h after adding the PC3 cells transfected with Folh1, 10% of MTX-Glu3 was converted to MTX-Glu2, and after 6 h a further 12% had been converted to MTX-Glu2, and 4% of the original MTX-Glu3 had been hydrolyzed to MTX-Glu. The addition of 100 M quisqualate to the culture medium completely inhibited this folate hydrolase activity. The PC3 cells transfected with human PSMA (Fig. 5b) converted 88% of the MTX-Glu3 to less glutamated states of
122
D.J. Bacich et al.: Cloning of the mouse prostate-specific membrane antigen homolog
Fig. 5. Hydrolysis of methotrexate tri-glutamate (MTX-Glun) over time in (a) PC3 cells transfected with vector carrying the Folh1 cDNA sequence, (b) PC3 cells transfected with vector carrying the human PSM cDNA sequence, and (c) PC3 cells transfected with vector alone (negative control). Both human PSM and its mouse homolog, Folh1, demonstrate sequential deglutamation of MTX-Glu3. Substrate hydrolysis to methotrexate was completely inhibited by the addition of 100 M quisqualate (+Quis) to the cells.
methotrexate, and 94% of the MTX-Glu3 had been deglutamated to MTX by the 6-h time period. The presence of 100 M quisqualate in the culture medium resulted in inhibition of 94% of the activity. A direct comparison of the folate hydrolase activity between PSMA and Folh1 can not be drawn from this experiment because the method and transfection efficiencies were different between these groups. There was virtually no folate hydrolase activity measured in PC3 cells mock transfected (data not shown) and PC3 cells transfected with empty vector (see Fig. 5c), confirming that the folate hydrolase activity seen in the PC3 cells transfected with Folh1 or PSMA was owing to the expression of the enzymes on the cells surface. All species examined thus far have revealed some expression of FOLH1 in the brain and kidney. Although NAALADase activity and its function in the nervous system have been studied extensively (reviewed in Neale et al. 2000) the significant role that these homologs play in the kidney is yet to be elucidated. The species differences in tissue expression of these enzymes has aided in identifying the activities of these proteins. Accordingly, it appears that the carboxypeptidase may have different specificity based upon the cell type and tissue where it is being expressed, and subsequently the available substrates. Interestingly, the carboxypeptidase activities for both NAAG and folylpoly-␥-glutamate are conserved in all species examined, suggesting that activities for both substrates may be important. The predominant PSMA transcript in normal human prostate, PSM’, encodes a cytosolic form of the enzyme. In humans, we hypothesize that expression of an intracellular folate hydrolase in the prostate puts the organ at risk for intracellular folate deficiency and subsequent DNA damage. The incidence of prostate cancer in rodents is approximately 1000-fold less than the incidence in men. We did not detect any Folh1 RNA transcripts in the mouse pros-
tate. In addition, Folh1 transcripts equivalent to PSM’ were not detected in any tissues, and, from sequence analysis, we would not expect a similar alternative splicing event to occur in the mouse, rat, or pig. It is clear that the Folh1 / NAALADase / PSMA / folylpoly␥-glutamate carboxypeptidase proteins are important in neurotransmission, intestinal folic acid transport, the initiation and/or the progression of prostate cancer, and possible functions in the kidney and the neovasculature associated with almost all solid tumors. Animal models modified in their expression of PSMA would be useful in understanding these functions and activities in vivo. The lack of Folh1 expression in the mouse prostate allows generation of a transgenic mouse model to examine the role and effect that specifically expressing human PSMA and PSM’ in the prostate have in the development of human prostate cancer. In addition, knock-out mouse models targeting NAALADase would be useful in investigating the role this enzyme plays in the biological function of the kidney and the brain. Acknowledgments. We thank Bob Huryk for technical assistance with the mouse dissections and Dr. Denise O’Keefe for helpful discussion. Supported in part by grants from the National Institute of Health, DK/CA 47650, NIH Center Core Grant CA 08748, and Dr. Bacich is the recipient of the CNRU-designated Young Investigator Award and is supported in part by the NIH-funded Clinical Nutrition Research Unit Grant CA 29502. Dr. Bacich is also supported in part by a grant from the A.F.U.D./ AUA Research Scholar Program and the Yamonouchi Foundation.
References Bzdega T, Turi T, Wroblewska B, She D, Chung HS et al. (1997) Molecular cloning of a peptidase against N-acetylaspartylglutamate from a rat hippocampal cDNA library. J Neurochem 69, 2270–2277
D.J. Bacich et al.: Cloning of the mouse prostate-specific membrane antigen homolog Carter RE, Feldman AR, Coyle JT (1996) Prostate-specific membrane antigen is a hydrolase with substrate and pharmacologic characteristics of a neuropeptidase. Proc Natl Acad Sci USA 93:749–753 Chang SS, O’Keefe DS, Bacich DJ, Reuter VE, Heston WD et al. (1999a) Prostate-specific membrane antigen is produced in tumor-associated neovasculature. Clin Cancer Res 5:2674–2681 Chang SS, Reuter VE, Heston WD, Bander NH, Grauer LS et al. (1999b) Five different anti-prostate-specific membrane antigen (PSMA) antibodies confirm PSMA expression in tumor-associated neovasculature. Cancer Res 59:3192–3198 Coyle JT (1997) The nagging question of the function of N-acetylaspartylglutamate. Neurobiol Dis 4:231–238 Grauer LS, Lawler KD, Marignac JL, Kumar A, Goel AS et al. (1998) Identification, purification, and subcellular localization of prostatespecific membrane antigen PSM⬘ protein in the LNCaP prostatic carcinoma cell line. Cancer Res 58:4787–4789 Halsted CH, Ling EH, Luthi-Carter R, Villanueva JA, Gardner JM et al. (1998) Folylpoly-gamma-glutamate carboxypeptidase from pig jejunum. Molecular characterization and relation to glutamate carboxypeptidase II. J Biol Chem 273:20417–20424 Heston WDW (1997a) Characterization and glutamyl preferring carboxypeptidase function of prostate specific membrane antigen: a novel folate hydrolase. Urology 49:104–112 Heston WDW (1997b) Gene therapy or fruits and vegetables? A biased perspective on prostatic carcinogenesis and hypothetical approaches to its control. Mol Urol 1, 11–20 Heston WDW, Tong WP, Pinto JT (1997) Prostate-Specific Membrane Antigen, a unique folate hydrolase: potential target for prodrug therapy. Mol Urol 1:215–219 Israeli RS, Powell CT, Fair WR, Heston WD (1993) Molecular cloning of a complementary DNA encoding a prostate-specific membrane antigen. Cancer Res 53:227–230 Israeli RS, Powell CT, Corr JG, Fair WR, Heston WD (1994) Expression of the prostate-specific membrane antigen. Cancer Res 54:1807–1811 Leek J, Lench N, Maraj B, Bailey A, Carr IM et al. (1995) Prostate-specific membrane antigen: evidence for the existence of a second related human gene. Br J Cancer 72:583–588 Letourneur F, Klausner RD (1992) A novel di-leucine motif and a tyrosinebased motif independently mediate lysosomal targeting and endocytosis of CD3 chains. Cell 69:1143–1157 Liu H, Moy P, Kim S, Xia Y, Rajasekaran A et al. (1997) Monoclonal antibodies to the extracellular domain of prostate-specific membrane antigen also react with tumor vascular endothelium. Cancer Res 57: 3629–3634 Liu H, Rajasekaran AK, Moy P, Xia Y, Kim S et al. (1998) Constitutive and antibody-induced internalization of prostate-specific membrane antigen. Cancer Res 58:4055–4060 Meyerhoff JL, Carter RE, Yourick DL, Slusher BS, Coyle JT (1992) Activity of a NAAG-hydrolyzing enzyme in brain may affect seizure susceptibility in genetically epilepsy-prone rats. Epilepsy Res Suppl 9:163– 172 Neale JH, Bzdega T, Wroblewska B (2000) N-Acetylaspartylglutamate:
123
the most abundant peptide neurotransmitter in the mammalian central nervous system. J Neurochem 75, 443–452 O’Keefe DS, Bacich DJ, Horiguchi Y, Nowak NJ, Fair WR et al. (1998a) Mapping, genomic organization and promoter analysis of the prostate specific membrane antigen gene. Preceedings of New Research Approaches in the Prevention and Cure of Prostate Cancer, 10th Anniversary of the AACR Special Conferences in Cancer Research., Indian Wells, Calif. O’Keefe DS, Su SL, Bacich DJ, Horiguchi Y, Luo Y et al. (1998b) Mapping, genomic organization and promoter analysis of the human prostate-specific membrane antigen gene. Biochim Biophys Acta 1443:113– 127 Passani LA, Vonsattel JP, Carter RE, Coyle JT (1997) N-acetylaspartylglutamate, N-acetylaspartate, and N-acetylated alpha-linked acidic dipeptidase in human brain and their alterations in Huntington and Alzheimer’s diseases. Mol Chem Neuropathol 31:97–118 Pinto JT, Suffoletto BP, Berzin TM, Qiao CH, Lin S et al. (1996) Prostatespecific membrane antigen: a novel folate hydrolase in human prostatic carcinoma cells. Clin Cancer Res 2:1445–1451 Rawlings ND, Barrett AJ (1997) Structure of membrane glutamate carboxypeptidase. Biochim Biophys Acta 1339:247–252 Rinker-Schaeffer CW, Hawkins AL, Su SL, Israeli RS, Griffin CA et al. (1995) Localization and physical mapping of the prostate-specific membrane antigen (PSM) gene to human chromosome 11. Genomics 30, 105–108 Silver DA, Pellicer I, Fair WR, Heston WD, Cordon-Cardo C (1997) Prostate-specific membrane antigen expression in normal and malignant human tissues. Clin Cancer Res 3:81–85 Slusher BS, Robinson MB, Tsai G, Simmons ML, Richards SS et al. (1990) Rat brain N-acetylated alpha-linked acidic dipeptidase activity. Purification and immunologic characterization. J Biol Chem 265:21297–21301 Slusher BS, Vornov JJ, Thomas AG, Hurn PD, Harukuni I et al. (1999) Selective inhibition of NAALADase, which converts NAAG to glutamate, reduces ischemic brain injury. Nat Med 5:1396–1402 Speno HS, Luthi-Carter R, Macias WL, Valentine SL, Joshi AR et al. (1999) Site-directed mutagenesis of predicted active site residues in glutamate carboxypeptidase II. Mol Pharmacol 55:179–185 Su SL, Huang IP, Fair WR, Powell CT, Heston WD (1995) Alternatively spliced variants of prostate-specific membrane antigen RNA: ratio of expression as a potential measurement of progression. Cancer Res 55: 1441–1443 Tiffany CW, Lapidus RG, Merion A, Calvin DC, Slusher BS (1999) Characterization of the enzymatic activity of PSM: comparison with brain NAALADase [In Process Citation]. Prostate 39:28–35 Tsai G, Cork LC, Slusher BS, Price D, Coyle JT (1993) Abnormal acidic amino acids and N-acetylaspartylglutamate in hereditary canine motoneuron disease. Brain Res 629:305–309 Waltham MC, Lin S, Li WW, Goker E, Gritsman H et al. (1997) Capillary electrophoresis of methotrexate polyglutamates and its application in evaluation of gamma-glutamyl hydrolase activity. J Chromatogr B Biomed Sci Appl 689, 387–392
