New England, and by the Burroughs Wellcome Fund. The costs of publication of this article were defrayed in part by the payment of page charges. This article ...
Vol. 269,No. 11, Issue of March 18.pp. 8393-8401, 1994 Printed in U.S.A.
THEJOURNAL OF BIOI.WICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc
Cloning of the gp49B Gene of the Immunoglobulin Superfamily and Demonstration That One of Its Two Products Is an Early-expressed Mast Cell Surface Protein Originally Describedas gp49* (Received for publication, October 14, 1993, and in revised form, December 9, 1993)
Mariana C. Castells*§n,Xiaoyun WuO, Jonathan P. A r m S O , K. Frank AustenSO, and Howard R. KatzSO From the $Department of Medicine, Harvard Medical School, and the §Department of Rheumatology and Immunology, Brigham and Women$ Hospital, Boston, Massachusetts02115
gp49 was originally defined as a 49-kDa surface glyco- granule protease transcription and translation suchthat their protein preferentially expressed on mouse interleukin- phenotype acquires elementsof tissue mastcell subclasses. The 3-dependent, bone marrow-derived mast cells, which are surface expression of members of the immunoglobulin (Ig)suimmature progenitor cells. A previously cloned cDNA perfamily such as IgE Fc receptor (FceRI) ( 6 ) ,IgG Fc receptor (gp49A)indicated that gp49 was a member of the immu(FcyR)IIbllFcyRIIb2, and FcyRIII ( 7 ) is increased inSMC relanoglobulin (Ig) superfamily, and genomic DNA analysis tive to BMMC. In contrast, translation and surface expression indicated that twogenes might encode a gp49 family. We of gp49, a 49-kDa surface glycoprotein that is a member of the have now characterizeda 5.6-kilobase pair gene, gp49B, Ig superfamily(81, decreases with mastcell maturation (9, 10). that encodes two novel gp49 cDNAs, gp49B1 and gp49B2. gp49becomesserinephosphorylatedwhen BMMC are actiThe twocDNAs are identical except that gp49B2is miss- vated by bridging their FceRI or by phorbol myristate acetate ing exon 6, which encodes a predicted transmembrane (101, and molecular cloning of a cDNA encoding gp49, now domain. In contrast to gp49A, gp49B1 and gp49B2 have designated gp49A, revealed that the predicted cytoplasmic re32 additional aminoacids at their C termini containing 4 of the 6 consensus amino acids of the antigen receptor gion of the molecule was a target for phosphorylation by t h e homology 1 motif found on several signal-transducing protein kinase C family (8, 11). We now report the initial isolation of a gp49 gene, gp49B, and members of the Ig superfamily. When COS-7 cells were two cDNAs, gp49B1 and gp49B2, homologous to, but distinct transfected with either thegp49Bl orgp49B2cDNA, from, the gp49A cDNA. The genomic organizationof the gp49B only the gp49B1 transfectants bound the B23.1 monogene revealed a structure characteristic for members of the Ig clonal antibody that originally defined gp49. Reverse of transcriptase-polymerase chainreaction analysis of the superfamily (12, 13). Sequence analysis revealed the deletion transfectants established that both transcripts were ex- 2 cytosine residues in exon 8 of the gp49B gene that causes a pressed, suggesting that the product of the gp49B2tran- reading frame shift in the gp49B1 and gp49B2cDNAs, loss of script was not inserted in the plasma membrane. Thus, the stop codon, and an additional32 amino acids in the postcloning of the gp49B gene has established the organiza- transmembrane region of gp49B1 and gp49B2 as compared to tion of one of the gp49 genes and provided evidence of gp49A cDNA. This cytosolic extension contains a tyrosine loalternate splicing of transcripts from that gene. cated in a consensus site for phosphorylation, which in turn is The culture of mouse bone marrow cells in the presence of a source of interleukin-3 elicits the development and proliferation of a population of immature mastcells that are progenitors for the in vivo m a s t cell subclasses, mucosal and serosal mast cells (SMC)’ (1, 2). The culture of these bone marrow-derived m a s t cells (BMMC) with fibroblasts (3, 4) or c-kit ligand (5) increasesheparinbiosynthesisandmodifiestheirsecretory
an essential part of a somewhat larger consensus sequencefor signal transduction found on other members of the Ig superfamily (14). Transfection of COS-7 cells with the gp49B1 and gp49B2 cDNAs, the latter of which lacks the coding region for the transmembrane domain, resulted in surface expression of only gp49B1. Thus, the gp49B gene encodes twonovel cDNAs which, together with gp49A cDNA, identify a new multimember family of the Ig superfamilythat is expressed early in mast cell development.
* This work was supported in part by Grants AI-07306, AI-22531, AI-32101, AI-31599, AR-36308, HL-36110, and RR-05950 from the National Institutes of Health, by the Immunology Research Institute of New England, and by the Burroughs Wellcome Fund. Thecosts of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solelyto indicate this fact. The nucleotide sequence(s1 reported in this paperhas been submitted to the GenBankTMiEMBL Data Bank with accession number(s) U052644U05266. 11Towhom correspondence should be addressed: Harvard Medical School, Seeley G. Mudd Bldg., Rm. 607,250 Longwood Ave., BostonMA 02115. Tel.: 617-432-0949; Fax: 617-432-0979. The abbreviations used are: SMC, serosal mast cells; BMMC, bone marrow culture-derived mast cells; Ig, immunoglobulin; FctR, IgE Fc receptor; FcyR, IgG Fc receptor; MC4W, Kirsten sarcoma virus-immortalized mouse mast cell line; PCR, polymerase chain reaction; RT, reverse transcriptase; HBSS, Hanks’ balanced salt solution;AFtHlM, antigen receptor homology 1 motif.
EXPERIMENTALPROCEDURES Isolation and CultureofCells-Bone marrow cells from male BALBk mice (The Jackson Laboratory, Bar Harbor, ME) were cultured for 3-4 weeks in 50% enriched medium and 50% WEHI-3 (AmericanType Culture Collection, Rockville, MD) cell-conditioned medium as described (15).After 3 weeks, >97%of the nonadherent cells in culture were mast cells as assessed by metachromatic staining with toluidine blue (16).A Kirsten sarcoma virus-immortalized mast cell line, MC4W,was cultured as described (17). COS-7 cells were obtained from the American Type Culture Collection and were cultured as recommended by the supplier. Mouse SMC wereisolated by peritoneal lavage and purified as described (10, 18). Screening and Isolation of cDNA and Genomic Clones-A previously reported ( 8 ) 1-kilobase pair partial gp49A cDNA clone (cDNA-1) was used to isolate full-length clones for two homologous but novel cDNAs, designated gp49B1 and gp49B2, froma cDNA library made fromMC4W (17). This cDNA library was used, under screening conditions previously described, because MC4W cells express high levels of membrane
8393
8394
gp49B Gene Encodes l h o Members of a Mast Cell Protein Family
gp49 as assessedby flow cytometry with the ratB23.1 anti-gp49 monoCTGGGGGTCTTCATTTTGTGG-3') and an upstream primer in exon 3 clonal antibody (8). (5'-GCCAAGTTCAACATTCCAAGC-3') were used in the proceduredeFor genomic cloning, a PstI to 3' fragment from a full-length gp49A scribed above. After amplification and gel purification of the cDNAs cDNA was labeled by random priming (Boehringer Mannheim) with obtained, the products were separated in a 1% agarose minigel. L3,P1CTP (DuPont NEN) and was used to screen a genomic library DNA Blot Analysis-The amplified cDNAs from the RT reactions constructed fromadult BALB/c mouse liver DNAinthe EMBL-3 SP6m7 with RNA from BMMC, MC4W, and SMC were precipitated and elecvector (Clontech); one million plaques were screened, and plaque puri- trophoresed in a2% agarose gel in Tris acetate/EDTA buffer and transfication was completed for four clones. Because of a unique TaqI site in ferred to nitrocellulose by capillary transfer in 20 x SSC overnight for DNA blot analysis. Aspecific probe for gp49B1 was generated with PCR the gp49A cDNA, but not the gp49B1 and gp49B2 cDNAs, the clones weredigestedwithTaqI. DNA blot analysis with the gp49A cDNA by priming the gp49Bl cDNA at the beginning (5"GACTGGAAACATrevealed that threeof the clones did not have an internal TaqI site, andACCAGAAGA-3') andend (5'-TAGCCTTCTTTTTGTGCCCAT- 3') of of DNA in a exon 6. The amplified fragment was gel-purified and contained the one of these, clone 5*, which produced the greatest amount phage maxiprep, was selected for analysis and was subcloned by SacI entire sequence of exon 6 as assessed by size. Cycle sequencing condigestion into the plasmid Bluescript (pBS-SK-, Stratagene). firmed the identity of the fragment. A probe specific for gp49B2 was DNA Sequencing-The gp49B gene and gp49B1 andgp49B2 cDNAs generated by priming the gp49B2 cDNA at thebeginning of exon 5 and weresequencedinboth strands by the dideoxy chaintermination at the end of exon 7 with the same primers that were used in the (U. S. Biochemical Corp.). RT-PCR reaction described above. The amplified fragment was method of Sanger et al. (19) with Sequenase gelBecause the two subcloned genomic fragments were non-overlapping, purified and, as determined by cycle sequencing, contained the entire confirmation of the intron 3 sequence that contained the internal SacI sequence of exon 5 + exon 7, without exon 6. The two probes were site was carried out by direct sequencing of the product obtained by random primer-labeled with [a-"PICTP and used for blot analysis as polymerase chain reaction (PCR) amplification of the genomic clone described (8). using primers located in themiddle of exon 3 (5"GCCCAGTATTATCAExpression Vectors-The cDNAs coding for gp49B1 andgp49B2 were 3') and at the beginning of exon 4 (5'-CTGGGATTTTCATATGCT-3'). subjected to PCR with an upstream primer (5"GCTCTAGAGCCGAABoth primers (1.0 p ~ final , concentration) were annealed to genomic CATTGCCTGGACTCACC-3';nucleotides 1-21 in Fig. 1)to which an DNA (0.5 pg) and amplification was carried out in a Perkin Elmer Cetus XbaIlinkerwasadded,andwithdifferentdownstreamprimersto Thermal Cycler for 20 cycles (94 "C for 1 min, 45"C for 2 min, and 72 "C which a BamHI linker was added. For the gp49B1 cDNA, the downfor 3 m i d . Cycle sequencing of PCR-amplified fragments was done on (5"CGGGATCCCTGTTTCTCATTAGATGAATTG-3'; stream primer both DNA strands with the dsDNA Cycle SequencingSystem(Life nucleotides 1264-1284) started after the first polyadenylation signal, Technologies, Inc.), with the same primers as in the PCR reaction, a s and for the gp49B2 cDNA the downstream primer(5"CGGGATCCCAfollows. After precipitation and gel purification of the amplified DNA GACACTTTCTTTGCTTATACA-3'; nucleotides 1254-1275) started affrom the PCR reaction, 1 pmol of each of the two primers was endter the second polyadenylationsignal.Both PCR productswereselabeled with 2 pmol of [y-"P]ATP (DuPont NEN), and primers were quenced and were identicalt o the native cDNAs except for the linkers. added to50 fmol of the amplified DNA. Annealing and sequencing were Both cDNAs were then directionally subcloned into the eukaryotic exdone in four different tubes for each primer containing the termination pression vector pSWSV40 (PharmaciaLKB Biotechnology Inc.) after dideoxynucleotide triphosphates. Sequencing reactions were carried outdigestion of the cDNAs and plasmid with XbaI and BamHI restriction in a Perkin Elmer Cetus ThermalCycler for 30 cycles (1min at 95 "C, enzymes. 2 min a t 55 "C, and 2 min at 70 "C). Stop solution was added t o each Zkansfections-Adherent COS-7 cells were isolated by treatment a t 90 "C for 10 min, and 2-pl samples with 0.054, trypsin, 0.53 tube (5 pl), the tubes were heated mM EDTA (Life Technologies, Inc.) incalciumof each reaction mixture were analyzed on an 8% polyacrylamide/urea andmagnesium-freeHanks'balancedsaltsolution(HBSS). Cell gel. After fixation and drying of the gel, autoradiography was performed samples (7.5 x lofi cells) were resuspended in 0.75 ml of cold (4 "C) overnight with Kodak X-Omat AR-5 film. serum-free electroporation medium (RPMI-1640 containing 100 Primer Extension Analysis-A synthetic oligonucleotide primer (10 unitdm1 penicillin G, 100 pg/ml streptomycin, 290 pg/ml L-glutamine, complementary t o posipmol) (3'-GTTCCATATCGTCGTGACAC-5') 100 PM nonessential amino acids, and 20mM HEPES base), and50 pg tions 57-76 and 36-55 (Fig. 1)of the gp49A and gp49B1 cDNA sense each of gp49B1 and gp49B2 cDNA-containing plasmids were added to strands, respectively, was subjectedt o a reaction withT4 polynucleotide different cell samples. The mixtureswere transferred to electroporation kinase and [r-:'"PlATP (3000 Cilmmol, 10 mCi/ml, DuPont NEN) accuvettes, and200 V/960 microfarads were applied with aBio-Rad Gene 5 pg of poly(A)- Pulser. Cellswere cultured in transfection medium without HEPES but cording to the Primer Extension System (Promega). enriched RNA from BMMC and MC4W was mixed with 1 pmol of the supplemented with 5%'fetal bovine serum at 37 "C and 7% CO, for 24 :'2P-labeled primer. The mixtures were heated for 20 min at 58 "C for h. A sample of COS-7 cells to which no DNA was added was also subannealing, and then the tubes were placed at room temperature to cool mitted to electroporation as a negative control. for 10 min. The reverse transcription reaction was carried out at 42 "C Immunofluorescence Analysis of the Cell Surface Bindingof the B23.1 1 unit of avianmyeloblastosisvirusreverse tranfor 30minwith Monoclonal Antibody-For in situ immunostaining,cells were grown on scriptase (RT) per tube in a total volume of 20 pl. Loading dye (20 pl) sterile glass microscope coverslips seeded into dishes. Cells were anawas added to each tube, the tubes were heated for 10 min at 90 "C, and lyzed for transient surface expression of gp49 proteins by incubation the samples wereloaded onto an 8%polyacrylamide, 7 M urea sequencwith 200 p1of either an optimal concentration of the B23.1 rat IgM ing gel and electrophoresedfor 2.5 hat 60 watts. In the same gel, a DNA monoclonal antibody (25 pg/ml) or an equal amount of rat IgM antisequencing ladder was used to provide size markers. In addition, a dinitrophenol monoclonal antibody (Zymed) in calcium- and magnesisequencing reaction using the same primer as in the extension reaction um-free HBSS containing 0.14 (w/v)bovine serum albumin and0.02% was done with a gp49B genomic subclone containing the 5"flanking (w/vj sodium azide (WB/A)for 30 min a t 4 "C. Cells were washed with region to intron 3of the gene to assist in determining the nucleotides cold at H/B/A, suspended in 200 p1of a saturating concentration of fluothe transcription initiation site(s) (13). rescein isothiocyanate-labeled F(ab'), fragments of goat anti-rat IgM RTPCR Reactions-Specific transcripts for gp49B1 andgp49B2 were (p-chain specific) (Jackson ImmunoResearch Laboratories, Avondale, determined by reverse transcription and amplification of the cDNAs PA), and incubatedfor 30 min at 4 "C. Cells were washed inWB/A and obtained with the Perkin Elmer Cetus GeneAmp RNA PCR kit. Briefly, fixed in 2% paraformaldehyde. Immunofluorescent staining was asa downstream primer (2.0 VM) at the end of exon 7 (5"CAACTGTsessed by comparison with the isotype-matchedcontrol in a Nikon OpTCAGCTCTGCATTG-3')was annealed to1 pg of total RNA isolated by tiphotepi-illumination fluorescence microscope, andpictureswere guanidine thiocyanate-phenovchloroform extraction and was extended taken on Kodak Ektar 1000 film. with RT (2.5 units) in a Perkin Elmer Cetus Thermal Cycler at 42 "C for 15 min, 99"C for 5 min, and 5 "C for 5 min, in a totalvolume of 20 pl. RESULTS AmpliTaq DNA polymerase (2.5 units) was added along with an upNucleotide Sequences of gp49Bl and gp49B2 cDNAs-AS stream primer (0.15 PM) located at the beginning of exon 5 (5"AAACCAAGGACCAGTCCTCTA-3'), in a totalvolume of 100 pl.The reaction shown in Fig. 1, the gp49B1 cDNA is composed of 21 nucleowas amplified with20 cycles: 1min a t 94 "C, 2 min at 46 "C, and 3 min of tides of 5"untranslated sequence, an open reading frame a t 72 "C. After DNAprecipitation, assessment of the size of the products 1005 nucleotides, and 260 nucleotides of 3'-untranslated se1% agarose minigel. Thespeciesobtainedwere gelwasdoneina quence containing a classical AATAAA polyadenylation signal purified and subjected to cycle sequencing and DNA blot analysis. To assess gp49B1 andgp49B2 transcripts inCOS-7 before and after trans- a n d a poly(A) tail beginning 24 bases downstream. gp49B2 fection, RNA was isolated, and a downstream primer in exon 8 (5'- cDNA is 100%homologous to gp49B1 from base 1 to base 715,
gp49B Gene Encodes Two Members of a Mast Cell Protein Family
FIG.1. Comparison of the nucleotide sequences of g p 4 9 4 gp49B1, and gp49B2 cDNAs. Dashesindicate identical nucleotides. Exons (determined from genomic sequencing of thegp49B geneshownin Fig. 3 ) are separated by uertical hrackets. The translation initiation site (ATG)is circled. The unique TaqI restrictionsiteisshowninthe gp49A cDNA sequence. Restriction sites used to generate a 5' probe (PstI toNcoI) and a 3' probe (SphI to HzndIII) are also shown in the gp49AcDNA sequence. The deletion of exon 6 in gp49B2 cDNA, and the deletion of the two cytosines in exon 8 of gp49B1 and gp49B2 are marked by vertical lines. The reading frame shift produced by the deletion of the two cytosines causesdifferent termination codons in gp49A (in exon 8) andgp49B1and gp49B2 (in exon 9 ) cDNAs. Those tripletsare circled and noted as A and B , respectively. Polyadenylation signal sequences are boxed.
8395
1 1 1
9P49A gp49B 1 gp49B2
60 39 39
gph9A gp49B1 gph9f57
120 99 99
gp49A gph9B 1 gpI19B3
180 159 159
gp09a gp49B 1 gp119B2
240 219 219
gph9A gp49B 1 gph9B2
300 279 279
gph9A gp49B 1 gph9R2
360 339 339
gp49A gp49B1 gp49BZ
420 399 399
gp49A gp49B 1 gp119B2
480 459 459
gp49A gp1198 1 gp119R2
540 519 519
gpQ9A gP119B1 gP1J982
600 579 579
gp49A gp49B 1 gp119BP
660 639 639
gp119A gp49B 1 gph9B2
720 699 699
gph9A gp119B 1 gp149B2
780 759 715
gph9A gP49B 1 gP49B2
840 819 716
gpIl9A gp49B 1 gph9B2
900 879 762
gp09a gp119B 1 gph9B2
960 937 820
gp49A gp49B1 gpO9R2
1020 997 880
g~119A gp49B 1 gph9B2
1080 1057 940
gpl19A gp119B 1 gp49B2
1140 1117 1000
gpb9A gp119B 1 gp119B2
1200 1177 1060
gp49A gp498 1 gp4982
1260 1237 1120
gpQ9A gph9B1 gpl19B2
1178
gp119R2
1238
u
TAGAACCATG AATAAA TGTATAAGCAAAGAhAGTGTCTTCAAAA(n)
is missing nucleotides 716-832 (117 nucleotides), and is identical to gp49B1 innucleotides 833-1286. At the site thatbegins the poly(A) tail of gp49B1, gp49B2 contains a n additional 111nucleotide sequence that includes anotherpolyadenylation signal followed by a poly(A) tail 28nucleotides downstream.
gph9R2
gp49A and gp49B1 cDNAs have an overall homology of 97%:, but there are two regions of variability. A TuqI restriction enzyme site present ingp49A a t nucleotide 298 is not present in gp49B1 or gp49B2, and 2 cytosines present a t nucleotides 929 and 930 in gp49A are absent in gp49B1 and gp49B2. The re-
8396
gp49B Gene Encodes n o Members of a Mast Cell Protein Family
FIG. 2.Comparison of the predicted
by amino acidsequencesencoded gp49A, gp49B1, and gp49B2 cDNh. Dashes indicateidenticalaminoacids. Conserved cysteinesare shown as vertical boxes and are numbered. Consensus sites for glycosylation (N-X-SPT) are shown as dotted areas. The potential siteof protein kinase C phosphorylationis indicated (*j. In the putative cytoplasmic domain, each of the 4consensusaminoacids of the ARHlM is shown in dotted a area and the tyrosine that ispotentiallyphosphorylated is indicated(#I. Amino acids deleted in gp49B2 are marked as a dotted area with slashes.
gp49A: gp49B1: gp49B2 :
58 58 58
gp49A: gp49B1: gp49B2:
116 116 116
gp49A: gp49B1: gp49B2:
174 174 174
gp49A: gp49B1: gp49B2 :
232 232 232
gp49A: gp49B1: gp49B2 :
303 335 296
gp49A: gp49B1: gp49B2 :
sulting reading frame shift in gp49BUgp49B2 eliminates the stop codon at the region analogous to nucleotides 952-954 of T A ~ LIE ALIGN scores for gp49B regions I and II of the extracellular domain gp49A and extends thecoding region of gp49BlIgp49B2 by 98 compared with Ig superfamily domains of the C1, C2, and V sets nucleotides. Analysis of the Predicted Amino Acid Sequences of gp49Bl ALIGN Scores and gp49B2 Relative to gp49A"The predicted amino acid sequences from the gp49B1 and gp49B2 cDNAs encode proteins C2 set with a signal peptide sequence of 23 amino acidsand predicted 5.4 a , B - ~ P human ,~ (IV) 5.5 M, of 35,037 and 30,454 for mature gp49B1 and gp49B2, re1.7 CD2, rat (11) 1.5 3.9 CD3-E, mouse 1.6 spectively (Fig. 2). The extracellular domains of gp49B1 and 3.3 CEA, human (IV) 4.4 gp49B2 (215 and 209 amino acids, respectively) are identical 4.2 CEA, human (VI) 4.0 except for the deletion of the last 6 amino acids in gp49B2 FcyRII, mouse (11) 4.1 2.7 before the predicted transmembrane domain. There are two 4.1 Myelin-associated gp, rat (111) 4.2 1.4 NCAM, chicken (IV) 4.3 potential N-linked glycosylation sites in gp49B1 and gp49B2, 2.9 1.8 NCAM, chicken (VI one fewer than in gp49A. Both gp49B1 and gp49B2 have 4 5.1 3.3 PDGFR, human (I) conserved cysteines at the same positions as in gp49A (Fig. 2) C1 set and the motif Gly-X-Tyr-X-Cys,characteristic of members of P,-Microglobulin, human 0.9 4.4 4.2 IgC heavy, human (I) 1.0 the C2 set of the Ig superfamily, is present a t residues 94-98 1.9 2.8 IgC heavy, human (11) just before the second cysteine and at residues192-196 before 3.5 IgC heavy, human (111) 1.5 the fourthcysteine (with a conservative substitution of phenyl2.1 2.1 IgC A, human alanine for tyrosine) as is the case forgp49A. To establish 2.6 IgC K, human 1.0 4.4 1.5 MHC I ( a s ) ,human formally that gp49B1 and gp49B2 are also members of the Ig 4.9 3.2 MHC I1 human superfamily, the two Ig-like regions of the extracellulardomain -0.1 1.1 TCR Cp, human of gp49B1 and members of the Ig superfamily were compared 1.4 2.7 TCR Cy, human according to theprocedure established by Williams and Barclay V set (12), exactly as performed previously for gp49A ( 8 ) .Alignments 2.3 3.5 CD4, human (I) 1.0 6.0 CD8 chain 11, mouse were done with the dynamic programming algorithm of Alts2.2 2.1 IgV A, mouse chul and Erickson (20), and an ALIGN score was generated 2.5 IgV heavy, human 3.9 with the Dayhoff cost matrix (21).ALIGN scores of 3.1,4.3, and 2.7 2.8 MRC-0x2, rat 5.2 S.D. units indicate that there is a and 2.8 1.3 Po protein, r a t 2.1 3.5 Polymeric Ig receptor, mouse (I) chance, respectively, that alignment has occurred by chance. 1.9 1.8 TCR Va, mouse ALIGN scores 2 3.0 indicate that the similaritiesbetween the 2.6 3.2 Thy-1, rat compared sequences are significantly greater thanwould occur 2.3 2.6 TCR V D, human by chance alone (12). a Regions are indicated in parentheses. The scores from these comparisons for gp49B1 and gp49B2 gp, glycoprotein; CEA, carcinoma embryonic antigen; NCAM, neuare shown in Table I. Regions I and I1 of gp49B1 and gp49B2 ral cell adhesion molecule; PDGFR, platelet-derived growth factor reshowed 7 and 6 of 10 scores 2 3.0, respectively, against domains ceptor, TCR, Tcell receptor, IgC and IgV, constant and variable regions, from the C2 set. In addition, region I1 of gp49B1 and gp49B2 respectively, of Ig. showed 5 of 10 scores 2 3.0 against domains from the C1 set. "
gp49B Gene Encodes ?Euo Members of a Mast Cell Protein Family
8397
W701 0081 Olbl 0261 0321 0'01 0'81 0561
06'11
0721 0801 0881
0961 LOLL 1121
1201
I281 1361 1441
1521 1601 16111
1761 1861
ZOO1 2011
6161 2161 2261 2121
6261
6121 6A01
.
..
2601 2681 2561 2641
Exon 8
2121
2101
2111 2961
Exon 4
7011
3041 ,111 1201
1281
1111 3101 1211 1161 ]**I 3S21 1601 3681 1761 1-1 1921
Exon 9
I161
,&*I 1121
1601 1681 7761 1841
7921
5001
4081
Exon 5
FIG.3. Sequence analysisof the gp49B gene. Exons are enclosed in large boxes. The internal SacI site in intron 3, the termination codon in exon 9, and several putative GATA regulatory sites in the 5"flanking region are each enclosed in small boxes. The first nucleotide of the major transcription initiation site is marked as +l.
Regions I and I1of gp49Bl and gp49B2 were also compared with sequences from 10 integral membrane proteins having cysteine residues at a similar spacing to that observed in Ig superfamily domains,but which are notmembers of this family ( 8 ) ; for both regions I and I1of gp49B1 and gp49B2, 9 of 10 (data not shown). These findings indicate that scores were ~3.0 like gp49A ( 8 ) ,gp49B1 and gp49B2 belong to the C2 set of the Ig superfamily. In addition to deletion of the six extracellular amino acids just preceding thetransmembranedomain,the predicted amino acid sequence of gp49B2 lacks the entire23-amino acid sequence that forms the transmembrane domain and the first 10 amino acids at the start of the cytoplasmic region (Fig. 2). The cytoplasmic regions of gp49B1 and gp49B2 are 74 and 64 amino acids long, respectively, and contain a serine a t position 273 in gp49B1 and 234 in gp49B2 within the motif Ser-X-Lys that is a consensus sequence for protein kinase C phosphorylation (11).The C-terminal regions of gp49B1 and gp49B2 also partially conform to the antigenreceptor homology 1motif in (ARHlM) ((D/EVI,(D/EV12YX,(LIIVI~YX2(LII))present many of the subunits of members of the multichain immune recognition receptor family (14). gp49B1 and gp49B2 have 4 of the 6 amino acids of the motif, DX7DX2YX2L,including the tyrosine at the consensus residue for potential phosphorylation. Isolation and Characterization of a gp49B Gene-A 10-kilobase pair genomic clone was isolated from a BALB/c mouse
liver genomic library screened with gp49A cDNA, and two restriction fragments of 6.5 and3.0 kDa weregenerated from this clone by SacI digestion. Both fragments hybridized in DNA blots with a full-lengthgp49A cDNAprobe. The 6.5-kDa species hybridized with a cDNA probe (SphI to HindIII) from the 3' region of gp49A, and the 3.0-kDa species reacted with a probe (PstI toNcoI) from the 5' region of the gp49A cDNA (data not shown). Thus, the clone appeared to contain the entire gp49 coding sequence. Despite the great degree of sequence homology between gp49A and gp49Bl cDNAs, the former has a TaqI site not present in the latter (Fig. I). DNA blot analysis of a TaqI digest of the genomic clone with a PstI to Hind111 probe from the gp49A cDNA revealed hybridization to only one species (data not shown), indicating that there was no internal TaqI site and that thegenomic clone did not encode gp49A. To determine if the gene encoded gp49B1, the two genomic subclones were sequenced in both directions (Fig. 3). The intron/ exon boundaries were determined according to the rules of Breathnach and Chambon (22). The complete gene spans 5.6 kilobase pairs and contains 9 exons. All exons have 100% homology with the gp49B1 cDNA, and exon 9 has an additional 109 nucleotides that correspond to the additional 3' sequences in the gp49B2 cDNA. The first exon (77 nucleotides) contains the entire 5"untranslated region and a large part of the signal peptide, and it is separated by a small intron (145nucleotides) from the second exon (36 nucleotides) that encodes the rest of the signal peptide. Intron 2 spans 200 nucleotides. Two C2-type
1's of a Mast Cell Protein Family
Exon 5 / 7
Exon 6
"
FIC:. 5. DNA blot analysis of cDNA fragments amplified by RTPCR using 1 pg of total RNA from HMMC and MCIW with primers at the beginning of exon 5 and at the end of exon 7. Probing
was done w i t h a n CXOIl 5i5 ( X 9 nuclcotidc.sl PCK-generated probe from gp49B2 cDNA (Icfl hrcrchct) and with a n exon 6 (115 nucleotides) PCRgenerated probe from gp49B1 cDNA(righ/ hrnchef ). Control lane shows the cxo11 5/T probe hybridized with itself. hp, base pairs. tion start site and nucleotide -1566 (Fig. 3).Tandem repeatsof CA (11times) followed by GA (22 times)are located from nucleFIG.4. Primer extension analysis of BMMC and M C 4 W KNA. Major and minor transcription initiation sltcs ~ I ' C ,marked \ r ~ t hurrows. otides -344 to -279. Uetectiorr of gp49BI and gp49B2 mRNA in Mast Cells-To Lnnc 1. DNA molecular weight markers ( i n nucleotides). I , c l n a 2, sequence of 5 pg of DNA from a genomic subclone containing the 5'- distinguish mRNA encoding gp49B1 from that encoding flanking region ofthe gp49U gene to which tht. same primer used i n the gp49B2, total RNA from BMMC and MC4W was subjected to primer extension reactions w a s annealed. L u / w 3 , primer extension reaction of 5 pg of poly(A) RNA from HMMC. Lane 4. primerextrnsion reverse transcription with a primer matching the sequence of gp49B1 and gp49B2 cDNA at the end of exon 7. The generated reaction o f 5 pg of poly(A) RNA from MC4W. Op. base pairs. cL)NAs were amplified by PCR with the same primer plus a Ig domains are encoded by two exons with similar sizes (exon 3 , primer matching the gp49Bl/gp49B2 sequence at thestart of 285 nucleotides; exon 4, 303 nucleotides) separated by a small exon 5 , and the products were resolvedby electrophoresis on a followed by a large intron 4 (1006 2'2 agarose gel. Ethidium stainingof the gel revealed that two intron 3 (142 nucleotides) and nucleotides). Intron 3 contains the internal SucI site that was species of 89 and 206 nucleotides were produced from each cell cleaved during subcloningof the genomic clone. Sequencing of type (data not shown). To identify these species, a gp49B1a PCR fragment generated from the genomic clone with prim- specific probe was generated by PCR of exon 6 of the gp49B1 ers located in the middle of exon 3 and the beginningof exon 4 cUNA, and a generic probe for gp49B1 and gp49B2 was generconfirmed the Sac1 junction, as well as the entire intron 3 ated by PCR of exons 5 and 7 of the gp49B2 cDNA. When the sequenceshowninPig. 3. Exon 5 (36 nucleotides)contains agarose gel was blotted and hybridized sequentially with each of'the probes, the exon6 probe labeled only the 206-nucleotide additional extracellular domain and exon 6 (117 nucleotides) encodes the plasma membrane-proximal portion of the extra- species, indicating its derivation from gp49B1 mRNA (Fig. 5 ) . cellular domain, the entire tral1smenlbrane domain, and the The 89-nucleotide fragment was only labeled with the exon 5/7 beginning of the cytoplasmic domain. The remainder of the probe, indicating that the band was generated from gp49B2 of cytoplasmic domain is encoded by exons 7 ( 5 3 nucleotides), 8 mKNA lacking coding for exon 6. Due to the large degree (66 nucleotides), and 9 (447 nucleotides). the latter of which homology with gp49A in this region, the 89-nucleotide species contains the termination codon (TGAJ. Introns 5 , 6, 7, and 8 was excised, extracted from the agarose gel, and subjected to (856,614,1148,and107nucleotides,respectively)separate cycle sequencing from the sense strand toverify that it wasa these exons. Two polyadenylation signals are found in exon 9, product of the gp49B gene. As shown in Fig. 6 A , the 89-nucle101 nucleotides apart, allowing for two different transcription otide fragmentsfrom both BMMC and MC4W were missing the terminations, one corresponding to gp49B1 cDNA and the other exon 6 sequence, and the antisense sequence confirmed the to gp49B2 cDNA (Fig. 1). presence of three nucleotides characteristic of gp49B (marked Sites und the 5'- with an asterisk in Fig. 6A). Purified, mature in vivo derived Analysis of the'IkunscriptionInitiation Flanking Region-Primer extension analysis was performed SMC were assessed for the presence of gp49B transcripts with with poly(A) RNA from BMMC and MC4W cells and an anti- the same primers in a similar RT-PCR reaction. 2% agarosegel senseoligonucleotideprimercomplementarytonucleotides electrophoresis disclosed a heterogeneousband(s)extending 36-55 of the gp49131 cDNA sequence. Transcription initiation from the 89-nucleotide to 206-nucleotide region. Cycle sequencsites were determined by comparison with molecular weight ing fromthe anti-sense strand of the limited amountof product revealed the presenceof at least a gp49B1 transcript (Fig. 6B ), standards and by parallel sequencing of the gp49B genomic subclone that contained the 5"flanking region with the same containing the junction of exon 6 and exon 7, as well a s 5 primer used for extension analysis. Both BMMC and MC4W specific nucleotidesthatdistinguishgp49Afromgp49B,4 poly(A) mRNA had a major transcription start site 77 nucleo- nucleotides in exon 6, and 1 nucleotide in exon 7. tides upstream of the 3' end of exon 1 (Fig. 4),which is also 22 Danscription of mRNAs and Membrane Expression ofgp49B nucleotides upstream of the start of t h e cL)NAs for gp49B1 and Protein in 'fiansfected C O S 7 Cells-RNA from non-transfected gp49B2. In addition, both BMMC and MC4W had two minor COS-7 cells and C O S 7 cells transfected with either gp49B1 start sites 88 and 103 nucleotidesupstream of the end of cDNA or gp49B2 cDNA was subjected toKT-PCR with primers exon 1. located in exons 3 and 8 t h a t are selective for both gp49B1 and Analysis of the genomic sequences upstream ofthe putative gp49B2. Non-transfected C O S 7 cells did not transcribe anyof transcription initiationsites did not reveala classical TATA box the gp49 mRNAs (Fig. 7A, lane 3 ) . Cells transfected with the at nucleotides -28 to -30 (Pig. 3). However, a sequence at gp49B1 cDNA transcribed a product that had the same molecunucleotide -136 (CCAATC) fromthe major transcription initia- lar weight (767 nucleotides)as t h a t of the gp49B1cDNA when tion site is a consensus sequence for a CCAAT binding tran- amplified with the same setof primers (Fig. 7A, lanes 4 and 1 , scription factor (22). Seven consensus sites for GA'I'A family respectively), indicating the presence of gp49B1 transcripts. binding proteins (23) were found between the major transcrip- Cells transfected with the gp49B2 cDNA disclosed a product
gp49B Gene Encodes
Trvo Members of Mast a
-
MC4 A BMMC
W
A C G T
*G *G
VI
*
C
3
Cell Protein Family
8399
(Fig. 7A, l a w 2 ) a t a lower molecular weight (650 nucleotides) than that of gp49B1, indicative of gp49B2 that lacks the 117nucleotide exon 6. To determine whether the transcripts were detectableproas tein, control and transfected COS-7 cells grown on coverslips were stained by indirect immunofluorescence with the B23.1 rat monoclonal antibody that originally defined gp49. Coverslips with COS-7 cells that had been electroporated but not transfected did not present any fluorescence staining with the B23.1antibody(datanotshowp).Incontrast, COS-7 cells transfected with gp49B1 presented a bright fluorescence pattern limited to the plasma membrane (Fig. 7 B ) . COS-7 cells transfected with gp49B2 did not present any membrane fluorescencewhenstainedwiththeB23.1antibody(datanot shown).Whenstainedwithanequalamount of isotypematched irrelevant primary antibody, all cells were negativefor surface membrane fluorescence. DISCUSSION
.8
C
a
'
* T (745)
* Exon 7
TCTCAGATTGTGTGlTCTTCACAGAAGCAT
Exon 5
CATCTTCAGTGGGTGTAGAGGACTGGTCC
*
B
SMC ' A C G T '
We previously reported that gp49, defined by the B23.1 rat monoclonal antibody (9), is expressed on the surfaceof mast cell progenitors (10) and that a cDNA encoding gp49 (now designated gp49A) obtained from a mouse mast cell library revealed t h a t t h eencoded protein is a member of the Ig superfamily ( 8 ) . We now report the cloning of a gene, gp49B, belonging to the gp49 family and the cloningof two additional cDNAs, gp49B1 and gp49B2, that are homologous to, but distinct from, gp49A. The cDNA designated gp49B1 is distinguished from gp49A by virtue of a 3% difference in the nucleotide sequences, which engenders some notable distinctions (Fig. 1). These include the deletion of 2 adjacent cytosines in gp49B1 (positions 929 and 930 of gp49A) and a lack of a To91 restriction enzyme site (position 298 in gp49A) in gp49B1. At the predicted amino acid level, gp49B1 is 9% different from gp49A from amino acid 1 to 303, and then diverges completely for its remaining C-terminal 32 amino acids (Fig. 2). The high level of sequence homology and the ALIGN analysis (Table I ) indicate that gp49B1, like gp49A ( 8 ) , contains two C2-type Ig domains, and establishes that there is a gp49 family within the Ig superfamily that is expressed in mast cells. The cloning and sequencing of the gp49B gene (Fig. 3) encoding gp49B1 and gp49B2 revealed a n intron-exon organization and structural features that are consistent with genes encoding members of the Ig superfamily (Fig. 8). The two Iglike C2-type domains are encoded by different exons (3 and 4) of similar size (24). The transmembrane domain is encoded by a single exon, and the cytoplasmic domain contains three exons as in major histocompatibility complex class I and neural cell adhesionmolecule(NCAM)genes(11,25).Thegp49Bgene lacks the classical transcription initiation TATA box but has a CCAAT-binding consensus site located at position -136 from the major transcriptionstart site (Figs.3 and 4). Multiple transcription initiation sites were found by primer extension. Other members of the Ig superfamily also have multiple transcription initiation sites and lack classical transcription initiation elements (26). For example, the a chain of FceRI of rat mastcells contains a CCAAT binding element at position -79, but no TATA box immediately upstream of the major transcription initiation site (27). Within 1566 nucleotides upstream of the major transcription initiation site of thegp49Bgene,eight
with the exon 5/7 probe in Fig. 5 . Sequence of the anti-sense strand is shown with three nucleotides specific for gp49B2 (nucleotides 690,698, Exon 6 CGGATACCAGTATGGGCACAAAAAGAAGGCTA and 745 of the gp49B2 cDNA, Fig. 1 ) marked with asterisks.B, cycle sequence analysis of the heterogeneous 89-206 RT-PCR product from Exon 7 ATGCTTCTGTGMGMCACACAATCTGAGMCA total RNA of purified SMC. Sequenceof the sense strandis shown with FIG.6. A, cycle sequence analysis of the 89-nucleotide products gen- 5 nucleotides specific for gp49B1 (nucleotides 812, 814, 816, 825, and erated byRT-PCR fromtotal RNAof BMMC and MC4W that hybridized862 of the gp49B1 cDNA, Fig. 1) marked with asterisks.
* * *
*
*
gp49B Gene Encodes
8400
1
e!!
2
3
flu0
Members of a Mast Cell Protein Family
4
767-
650FIG. 8. Schematic diagram of the gp4SB gene and the two cDNAs, gp4SB1 and gp49B2. bp, base pairs.
A " I
t
i ,
,
.
"
B
. .
.
FIG.7. A,1% agarose gel analysis of the products of the PCR reaction with gp49B1 cDNA(lane1 j and of the RT-PCR reactions with RNA from COS-7 cells transfected with gp49B1 cDNA-containing plasmid (lane 4 ) , with gp49B2 cDNA-containing plasmid (lane 2j, and from electroporated but non-transfected COS-7 cells (lane 3). The primers used for lunes 1-4 are the same and are located in exon 3 and exon 8 (see "Experimental Procedures"). E , indirect immunofluorescent staining with B23.1 rat monoclonal antibody of COS-7 cells transfected with gp49B1 cDNA. Immunofluorescent plasma membrane ring can be seen in threecells (arrows).C, Nomarski interference contrast microscopy of the same field shown in E , in which there are four cells.
consensus sites for the binding of GATA family transcription factors are found, suggestingthat these proteins may serveas regulatory elements for expression of gp49B gene products,as is the case for mast cell secretory granule carboxypeptidaseA (28). The gene for VCAM-1, another member of the Ig superfamily (29), also has GATA-binding sites in its 5"flanking region (23). An additional cDNA, designated gp49B2,encodes a truncated form of gp49B1;based uponthe genomic cloning, gp49B2 has a deletion of exon 6 that encodes the putative transmembrane domain (Figs. 1 and 2). RT-PCR withcycle sequence analysis confirmed the presence of mRNA transcripts for both
gp49B1 and gp49B2 in BMMC, derived from normal bone marrow and maintained with growthfactors,and in MC4W, a transformed mast cell line (Figs. 5 and 6).SMC had gp49B1 transcripts as assessed by cycle sequencing,but because of the apparent size heterogeneityof the PCR product(s),the resolutionneededtoanalyzeforgp49B2unambiguouslywasnot achieved. Alternate splicing to produce putative soluble forms is seen in other members of the Ig family, such as the a! chain of the rat FceRI (27) and the rat NCAM. NCAM has five C2type extracellular domains and at least 27 developmentally regulated, alternatively spliced forms(301, whichinclude forms lacking the transmembrane domain and differentusage of polyadenylation sites. A cDNA encoding a species of FcyRIIA that lacks a transmembrane domain but contains the cytoplasmic tail has been isolated from a human erythroleukemia cell line library; this species appears to be translated into protein and secreted from cells (31). The molecular cloning of members of the gp49 family has revealed several structural similarities and distinctions. The extracellular domains of the three molecules share the two Ig-like C2-type domains. The cytoplasmic domains of the three species all expressa serine residue that is located in a consensus sequence for phosphorylationby the protein kinase C family ( 11); B23.1anti-gp49 antibody immunoprecipitates isolated from BMMC activated by bridging their FceRI or by stimulationwith phorbol myristate acetate containphosphoserine, suggesting that one or more gp49 species is a substrate for a protein kinase C (10). The cytoplasmic tails of gp49B1 and gp49B2 contain 4 of the 6 amino acidsof the consensus ARHlM involved in signal transduction elicited by the T cell receptor CD3 complex viathe y, 6, and/or 5 chain and by the common y chain of Fc&I and FcyRIII (32).The tyrosinethat is located at a consensus site for phosphorylation and is present in gp49B1 and gp49B2 is notable because transfection studies in B lymphocytes indicate that mutation of either of the two tyrosines of the ARHlM of the y chain prevents efficient internalization and antigen processing after presentation of immune complexes (33).Some membersof the Ig superfamilythat have two C2-type extracellular domains, such as the a and p chains of the T cell receptor and the a chains of FceRI and FcyRIII, associate with other molecules that express the ARHlM, such as members of the 5/y family (13). From the C2 set, only FcyRIIA has two C2-type domains and contains in its cytoplasmic domain the ARHlM (34).Transfectionstudies indicate that the complete cytoplasmictail of FcyRIIA mediates both an increase in intracellular calcium and endocytosis upon receptor ligation. Removal of the C-terminal17 amino acids such that a partial ARHlM remains (containingthe same 4 of 6 consensus amino acids expressed in gp49B1 and gp49B2) ablates the receptor-mediated calciumincrease but does not inhibit receptor endocytosis (35). The cloningof homologous but distinct gp49B1 and gp49B2 cDNAs and the gene for gp49B raised the issue of whether products of this gene would be distributed to the plasma membrane and create an epitope recognized by the B23.1 mono-
gp49B Gene Encodes ltvo Members of Mast a Cell Protein Family clonal antibody that was used to define the mast cell surface marker. Transient transfection of COS-7 cells with either the gp49B1 or gp49B2 cDNAs revealed that only recipients of the gp49B1 bound the B23.1 antibody by cell surface immunofluorescence staining (Fig. 7 B ) ,indicating that thegp49B1 protein is inserted into the plasma membrane and that the gp49B gene codes for molecules expressing the B23.1 epitope. That the failure of gp49B2 transfectants to express surface molecules bearing the B23.1 epitope was not due to an inability to transcribe the cDNA was shown byRT-PCR analysis, which revealed gp49B2 transcripts in thesecells (Fig. 7A ). Because the product of gp49B2 is predicted t o lack a transmembrane domain, the protein,if translated, would most likely be secreted andor stored inside the cells. Recent studies indicate that the binding of the B23.1 antigp49 monoclonal antibody is detected as early as 1 day after culture of mouse bone marrow cells in a source of interleukin3.2 These data suggest that one or more forms of gp49 may be among the earliestsurface markers of mast cell development, and thatmembers of the gp49 family mayplay a rolein cell-cell or cell-cytokine interactions thatoccur during thedevelopment of mast cells from multipotent progenitors. Acknowledgment-We assistance.
thank Julie E. Benes for excellent technical REFERENCES
1. Nakano, T., Sonoda, T., Hayashi, C., Yamatodani,A,,Kanayama, Y., Yamamura, T., Asai, H., Yonezawa, T., Kitamura, Y., and Galli, S.J. (1985) J . Exp. Med. 162, 1025-1043 2. Otsu, K., Nakano, T., Kanakura, Y., Asai, H., Katz,H. R., Austen, K. F., Stevens, R. L., Galli, S. J., and Kitamura, Y. (1987) J. Exp.Med. 165, 615-627 3. Levi-Schaffer, F., Austen, K. F., Gravallese, P. M., and Stevens, R. L. (1986) Proc. Natl. Acad. Sci. U. S. A . 83, 6485-6488 4. Dayton, E.T., Pharr, P., Ogawa, M., Serafin, W. E.,Austen, K. F., Levi-Schaffer, F., and Stevens, R. L. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 569-572 5. Gurish, M. E , Ghildyal, N., McNeil, H. P., Austen, K. F., Gillis, S., and Stevens, R. L. (1992) J. Exp. Med. 175, 1003-1012 6. Galli, S.J., Dvorak,A. M., Marcum, J.A., Ishizaka,T., Nabel, G., DerSimonian,
7. 8.
9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35.
H. R. Katz, unpublished observation.
840 1
H., Pyne,K., Goldin, J. M., Rosenberg, R. D., Cantor, H., and Dvorak,H. F. (1982) J. Cell Biol. 9 5 , 4 3 5 4 4 4 Katz, H. R., Arm, J. P., Benson, A. C., and Austen,K. F. (199OiJ. Zmmunol. 145, 3412-3417 Arm, J. P., Gurish, M. F., Reynolds, D. S., Scott, H. C., Gartner, C. S., Austen, K. F., and Katz, H. R. (1991) J. Biol. Chem. 266, 1596615973 Katz, H. R., LeBlanc, P.A., and Russell, S.W. (1983) Proc. Natl. Acad Sci. U. S. A . 80, 591G5918 Katz, H. R., Benson, A. C., and Austen, K. F. (1989) J. Immunol. 142, 919926 Kennelly, P. J., and Krebs, E. G. (1991) J . Biol. Chem. 266, 15555-15558 Williams, A. F., and Barclay, A. N. (1988) Annu. Rev. Immunol. 6, 381-405 Ye, Z.-S., Kinet, J.-P., and Paul, W. E. (1992) J. Zmmunol. 149, 897-900 Keegan, A. D., and Paul, W. E.(1992) Zmmunol. Today 13,63-68 Razin, E., Ihle,J . N., Seldin, D., Mencia-Huerta, J., Katz, H.R., LeBlanc, P. A,, Hein, A., Caulfield, J. P.,Austen, K. F., and Stevens, R. L. (1984) J. Zmmunol. 132, 1479-1486 Razin, E., Mencia-Huerta,J., Stevens, R. L., Lewis, R. A., Liu, E , Corey, E. J., and Austen, K. F. (1983) J. Exp. Med. 157, 189-201 Reynolds, D. S., Serafin, W. E., Faller, D. V., Wall, D. A,, Abbas,A. K., Dvorak, A. M., Austen, K. F., and Stevens, R. L. (1988) J . Biol. Chem. 263, 1278312791 Katz, H. R., Raizman, M. B., Gartner, C. S., Scott, H. C., Benson, A. C., and Austen, K. F. (1992) J . Zmmunol. 148, 868-871 Sanger, F., Nicklen, S., andCoulson,A. R. (1977)Proc.Natl. Acad. Sci. U. S. A. 74,5463-5467 Altschul, S. F., and Erickson, B. W. (1986) Bull. Math. Biol. 48, 603-616 Dayhoff, M. O., Barker, W. C., and Hunt, L. T.(1983) Methods Enzymol. 91, 524-545 Breathnach, R., and Chambon, P. (1981) Annu. Reu. Biochem. 50,349-383 Orkin, S.H. (1992) Blood 80, 575-581 Williams, A. F. (1987) Zmmunol. Today 8, 298-303 Cunningham, B. A., Hemperly, J. J., Murray, B. A., Prediger, E. A., Brackenbury, R., and Edelman, G.M. (1987) Science 236, 799-806 Hogarth, P. M., Witort, E., Hulett, M. D., Bonnerot, C., Even, J., Fridman, W. H., and McKenzie, I. F. C. (1991) J . Immunol. 146,369-376 Tepler, I., Shimizu, A,, and Leder, P. (1989) J. Biol. Chem. 264, 59126915 Zon, L. I., Gurish, M. E , Stevens, R. L., Mather, C.,Reynolds, D. S.,Austen, K. F., and Orkin, S. H. (1991) J. Biol. Chem. 266,2294%22953 Springer, T. A. (1990) Nature 3 4 6 , 4 2 5 4 3 4 Reyes, A. A,, Small, S. J., and Akeson,R. (1991) Mol. Cell. Biol. 11, 1654-1661 Rappaport, E.F., Cassel, D. L, Walterhouse, D. O., McKensie, S. E., Surrey, S., Keller, M. A, Schreiher, A. D., and Schwartz, E. (1993) Exp. Nematol. 21, 689-696 Reth, M. (1989) Nature 338, 383-384 Amigorena, S., Salmero, J., Davoust, J., Fridman, W. H., Bonnerot, C. (1992) Nature 358,337-341 Brooks, D. G . , Qiu, W. Q., Luster, A. D., and Ravetch, J. V (1989) J. Exp. Med. 170, 1369-1385 Odin, J. A,, Edberg, J. C., Painter, C. J.,Kimberly, R. P., Unkeless, J. C. (1991) Science 254, 1785-1788
