Cluster of Cases of Human Rickettsia felis Infection from Southern ...

JOURNAL OF CLINICAL MICROBIOLOGY, July 2006, p. 2669–2671 0095-1137/06/$08.00⫹0 doi:10.1128/JCM.00366-06 Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Vol. 44, No. 7

Cluster of Cases of Human Rickettsia felis Infection from Southern Europe (Spain) Diagnosed by PCR Jose´ A. Oteo,* Arańzazu Portillo, Sonia Santibań ˜ez, Jose´ R. Blanco, Laura Pe´rez-Martıńez, and Valvanera Ibarra ´ rea de Enfermedades Infecciosas, Complejo Hospitalario San Milla A ń-San Pedro-de La Rioja, Hospital de La Rioja, Logron õ, Spain Received 20 February 2006/Returned for modification 29 March 2006/Accepted 3 May 2006

The first cluster of cases of human Rickettsia felis infection in Spain diagnosed by PCR is reported. Serologic testing for Lyme borreliosis, cat-scratch disease, human anaplasmosis, and Q fever, as well as SFG and TG rickettsioses (immunoglobulin G [IgG] enzyme-linked immunosorbent assays and Western blotting for Lyme borreliosis and IgG indirect immunofluorescence assays for the remaining ones) were negative for both patients. DNA was extracted from the human acute blood-EDTA and serum specimens and also from a dog serum sample (all before antibiotic therapy) by using a blood DNA spin kit (Genomed; Genycell Biotech Espan ã, S.L., Granada, Spain) according to the manufacturer’s instructions. These extracts were used as templates in PCRs to investigate the arthropod-borne diseases above indicated (Table 1). Due to the low sensitivity of detection of spirochetes in blood samples, PCR assays for Borrelia burgdorferi sensu lato were not performed. Curiously, PCR amplifications of gltA, ompA, and ompB rickettsial genes were successful for samples from both patients and from the dog under conditions previously described (3, 12). Negative controls (one of them with template DNA but without primers and the other with primers and containing water instead of template DNA) were run at the same time under the same conditions as the samples and produced no detectable product. The nucleotide sequences obtained from the PCR products were identical to each other and, by BLAST analyses, were closest to Rickettsia felis sharing 99.3% (295 of 297), 100% (468 of 468), and 99.7% (381 of 382) identities with the partial sequences of the gltA, ompA, and ompB genes, respectively. The remaining PCR results were negative. Chiggers collected in Piqueras area were also investigated for the presence of the same microorganisms mentioned above by using the PCR primers listed in Table 1. According to our results, none of the more than 1,000 larvae of N. autumnalis studied was infected with B. burgdorferi sensu lato, Bartonella sp., Anaplasma phagocytophilum, Coxiella burnetii, or Rickettsia sp. The woman received doxycycline (200 mg/day) for 10 days; she recovered within 2 days, and she remains well. The dog received terramycine, and it quickly recovered. The man, who was afebrile, did not receive antimicrobials (he had skin lesions of the chiggers that resolved with antihistamines and steroids). Neither the people nor the dog developed IgG antibodies to rickettsias or to other investigated microorganisms during the follow-up. The lack of an antibody response to SFG and/or TG

CASE REPORT In September 2005, a 26-year-old woman with fever (38°C) and skin lesions and her 30-year-old husband were evaluated in our hospital. She felt unwell and began with itching skin lesions, mainly located on flexion areas of the lower extremities. On examination, she had fever, malaise, arthralgia, and pruritic papular rash over the lower extremities, abdomen, and chest. He showed the same clinical picture, although fever was absent. No other symptoms or signs were observed. Both patients and their dog had visited a forest area on the northwest of La Rioja (known as “Alto de Piqueras”) 2 days previously. The dog was afebrile but symptomatic (fatigue, vomiting, and diarrhea). Multiple red points identified as chiggers (larvae of trombiculid mites, Neotrombicula autumnalis) were observed over the dog. At that time, neither ticks nor fleas were found. Nevertheless, fleas had parasitized the dog, and both patients said they had been bitten by fleas. No exposure to cats was mentioned. According to our previous experience, a presumptive diagnosis of human trombiculiasis was made. Over the last 5 years, we have diagnosed seasonal outbreaks of this disease in people who have visited the putative forest area in autumn and have presented with this itching rash (6). Nevertheless, a prospective protocol for vector-borne diseases, which included the main tick and flea-borne infections endemic in Spain (Lyme borreliosis, Bartonella infections, human anaplasmosis, Q fever and spotted fever group [SFG], and typhus group [TG] rickettsioses), was followed. Laboratory investigations showed slightly elevated liver enzymes. The values for the female patient were as follows: aspartate amino transferase, 50 IU/liter; alanine amino transferase, 45 IU/liter; and lactate dehydrogenase, 456 IU/liter. C-reactive protein was elevated (15 mg/liter; normal, ⬍10), and the remaining biochemical values were normal. The values for the male patient were as follows: aspartate amino transferase, 39 IU/liter; alanine amino transferase, 42 IU/liter; gamma-glutamyl-transpeptidase, 79 IU/liter; and lactate dehydrogenase, 498 IU/liter. The numbers of leukocytes, platelets, and erythrocytes were normal for both patients. ´ rea de Enfermedades * Corresponding author. Mailing address: A Infecciosas, Hospital de La Rioja, Avda. Viana, 1, 26001 Logron õ (La Rioja), Spain. Phone: 34 941297273. Fax: 34 941297267. E-mail: jaoteo @riojasalud.es.

2669

2670

CASE REPORTS

J. CLIN. MICROBIOL. TABLE 1. PCR primer pairs used in this study

Pathogen

Gene a

PCR type

Primer

Primer sequence (5⬘33⬘)

Reference

Borrelia burgdorferi sensu lato

rrs

Single stage

BORF 16S3B

CGCTGGCAGTGCGTCTTAA GCGGCTGCTGGCACGTAATTAGC

5 5

Bartonella sp.

rpoB

Single stage

1400F 2300R

CGC ATT GGC TTA CTT CGT ATG GTA GAC TGA TTA GAA CGC TG

13 13

Anaplasma phagocytophilum

16S RNA

Nested

ge3a ge10r ge9f ge2

CACATGCAAGTCGAACGGATTATTC TTCCGTTAAGAAGGATCTAATCTCC AACGGATTATTCTTTATAGCTTGCT GGCAGTATTAAAAGCAGCTCCAGG

2, 2, 2, 2,

Coxiella burnetii

IS1111

Single stage

Trans 1 Trans 2

TATGTATCCACCGTAGCCAGTC CCCAACAACACCTCCTTATTC

16 16

Rickettsia sp.

gltA

Nested

ompA

Seminested

ompB

Nested

RpCS.877p RpCS.1258n RpCS.896p RpCS.1,233n Rr190.70p Rr190.701n Rr190.602n rompB OF rompB OR rompB SFG IF rompB SFG/TG IR rompB TG IF

GGGGGCCTGCTCACGGCGG ATTGCAAAAAGTACAGTGAACA GGCTAATGAAGCAGTGATAA GCGACGGTATACCCATAGC ATGGCGAATATTTCTCCAAAA GTTCCGTTAATGGCAGCATCT AGTGCAGCATTCGCTCCCCCT GTAACCGGAAGTAATCGTTTCGTAA GCTTTATAACCAGCTAAACCACC GTTTAATACGTGCTGCTAACCAA GGTTTGGCCCATATACCATAAG AAGATCCTTCTGATGTTGCAACA

3, 12 3, 12 3, 12 3, 12 12 12 12 3 3 3 3 3

a

8 8 8 8

PCR amplification for the detection of B. burgdorferi sensu lato was not determined with either blood or serum specimens.

Rickettsia could be due to the lack of sensitivity of the immunofluorescence assay method and also to the early antimicrobial therapy.

In the last 20 years, and thanks to the development of valuable methods such as culture and PCR, new Rickettsia species have been involved as human pathogens (9). R. felis is one of them. This flea-borne SFG Rickettsia sp. was first recognized as a human pathogen in Texas in 1994 (15). Since then, only a few patients—from Mexico, Brazil, and Germany—have been diagnosed with R. felis infection by molecular biologic techniques (PCR) (11, 14, 17). More studies have provided evidence of the presence of this microorganism in cat fleas (Ctenocephalides felis and Ctenocephalides canis) and, according to results based on PCR assays, R. felis-infected fleas are common in Spain (1, 7). However, to the best of our knowledge, in Spain no human R. felis infections have previously been confirmed by using PCR, although very recently serologic evidence of human R. felis infections has been demonstrated in the Canary Islands (10). Our report describes the first group of cases of R. felis infection in humans diagnosed by PCR in Spain (southern Europe) and the second group of cases documented by PCR in Europe overall. Since R. felis infection is an emerging human infectious disease, it should be considered in patients with fever and/or rash after flea bites or contact with cats. According to previous reports, headache, abdominal pain, nausea, vomiting, and diarrhea, as well as central nervous system involvement (photophobia, hearing loss, and/or meningism) are common clinical manifestations (11, 17). In our case, the detection of R. felis in a man without symptoms of typical rickettsia is very interesting,

since it suggests that this infection may be more prevalent than was previously thought. Furthermore, chiggers have medical and veterinary importance, and they are vectors of Orientia tsutsugamushi (scrub typhus) in Asia. Their role as vectors of diseases has not been demonstrated in Europe, although at least 10% of the trombiculidae harbored A. phagocytophilum in the referred area (Piqueras) according to Fernandez-Soto et al. (4). The real implications of chiggers as disease-bearing vectors are unknown, but chiggers might facilitate infections through skin lesions. Our report describes the second PCR-confirmed cases of human R. felis infection in Europe, and it supports that R. felis should be considered in the diagnosis of flea-borne rickettsioses, especially after flea bites, even in patients without a rash or in asymptomatic people. We thank the veterinary team of the Centro Veterinario Iregua, Lardero (La Rioja, Spain), as well as Juan Herrera and his team from the Consejerıá de Turismo, Medio Ambiente y Polı´tica TerritorialGobierno de La Rioja (Spain), for their contributions to this study. We are also grateful to the veterinarians Santos Jimeńez, Consejerıá de Salud-Gobierno de La Rioja (Spain), and Jose´ Manuel Venzal, predoctoral fellow at the Universidad de Zaragoza (Spain), for their help in the capture of chiggers. This study was supported in part by grants from the Government of La Rioja (ANGI 2004/17; Plan Riojano I⫹D⫹I, 2003–2007) and also by the Fondo de Investigacio ń Sanitaria (FIS G03/057), Ministerio de Sanidad y Consumo (Spain). REFERENCES 1. Blanco, J. R., L. Pe´rez-Martıńez, M. Vallejo, S. Santiba ń ˜ ez, A. Portillo, and J. A. Oteo. Prevalence of Rickettsia felis-like and Bartonella spp. in Ctenocephalides felis and Ctenocephalides canis from La Rioja (northern Spain). Ann. N. Y. Acad. Sci., in press. 2. Chen, S. M., J. S. Dumler, J. S. Bakken, and D. H. Walker. 1994. Identifi-

VOL. 44, 2006

3. 4.

5.

6. 7. 8. 9.

cation of granulocytotropic Ehrlichia species as the etiologic agent of human disease. J. Clin. Microbiol. 32:589–595. Choi, Y. J., W. J. Jang, J. H. Kim, J. S. Ryu, S. H. Lee, K. H. Park, H. S. Paik, Y. S. Koh, M. S. Choi, and I. S. Kim. 2005. Spotted fever group and typhus group rickettsioses in humans, South Korea. Emerg. Infect. Dis. 11:237–244. Ferna ńdez-Soto, P., R. Pe´rez-Sanchez, and A. Encinas-Grandes. 2001. Molecular detection of Ehrlichia phagocytophila genogroup organisms in larvae of Neotrombicula autumnalis (Acari: Trombiculidae) captured in Spain. J. Parasitol. 87:1482–1483. Gil, H., M. Barral, R. Escudero, A. L. Garcıá-Pe´rez, and P. Anda. 2005. Identification of a new Borrelia species among small mammals in areas of northern Spain where Lyme disease is endemic. Appl. Environ. Microbiol. 71:1336–1345. Jimeńez, S., I. Gasto ń, A. Pe´rez, and J. A. Oteo. 2001. A seasonal outbreak of human parasitation by chiggers in La Rioja (Northern Spain). Clin. Microbiol. Infect. 7(s1):348. Ma ´rquez, F. J., M. A. Muniain, J. M. Pe´rez, and J. Pacho ń. 2002. Presence of Rickettsia felis in the cat flea from southwestern Europe. Emerg. Infect. Dis. 8:89–91. Massung, R. F., K. Slater, J. H. Owens, W. L. Nicholson, T. N. Mather, V. B. Solberg, and J. G. Olson. 1998. Nested PCR assay for detection of granulocytic ehrlichiae. J. Clin. Microbiol. 36:1090–1095. Parola, P., C. D. Paddock, and D. Raoult. 2005. Tick-borne rickettsioses around the world: emerging diseases challenging old concepts. Clin. Microbiol. Rev. 18:719–756.

CASE REPORTS

2671

´ ngel-Moreno, M. Bolan 10. Pe´rez-Arellano, J. L., F. Fenollar, A. A ˜ os, M. Herna ńdez, E. Santana, M. Hemmersbach-Miller, A. M. Martin, and D. Raoult. 2005. Human Rickettsia felis infection, Canary Islands, Spain. Emerg. Infect. Dis. 11:1961–1964. 11. Raoult, D., B. La Scola, M. Enea, P. E. Fournier, V. Roux, F. Fenollar, M. A. Galvao, and X. de Lamballerie. 2001. A flea-associated Rickettsia pathogenic for humans. Emerg. Infect. Dis. 7:73–81. 12. Regnery, R. L., C. L. Spruill, and B. D. Plikaytis. 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 173:1576–1589. 13. Renesto, P., J. Gouvernet, M. Drancourt, V. Roux, and D. Raoult. 2001. Use of rpoB gene analysis for detection and identification of Bartonella species. J. Clin. Microbiol. 39:430–437. 14. Richter, J., P. E. Fournier, J. Petridou, D. Ha üssinger, and D. Raoult. 2002. Rickettsia felis infection acquired in Europe and documented by polymerase chain reaction. Emerg. Infect. Dis. 8:207–208. 15. Schriefer, M. E., J. B. Sacci, Jr., J. S. Dumler, M. G. Bullen, and A. F. Azad. 1994. Identification of a novel rickettsial infection in a patient diagnosed with murine typhus. J. Clin. Microbiol. 32:949–954. 16. Willems, H., D. Thiele, R. Fro ¨lich-Ritter, and H. Krauss. 1994. Detection of Coxiella burnetii in cow’s milk using the polymerase chain reaction (PCR). J. Vet. Med. 41:580–587. 17. Zavala-Vela ´zquez, J. E., J. A. Ruiz-Sosa, R. A. Sa ńchez-Elıás, G. BecerraCarmona, and D. H. Walker. 2000. Rickettsia felis rickettsiosis in Yucatan. Lancet 356:1079–1080.