Coexistence of Intracellular and Membrane-Bound Progesterone ...

0021-972X/05/$15.00/0 Printed in U.S.A.

The Journal of Clinical Endocrinology & Metabolism 90(1):474 – 483 Copyright © 2005 by The Endocrine Society doi: 10.1210/jc.2004-0793

Coexistence of Intracellular and Membrane-Bound Progesterone Receptors in Human Testis Chirag Shah, Deepak Modi, Geetanjali Sachdeva, Sushama Gadkar, and Chander Puri National Institute for Research in Reproductive Health, Indian Council of Medical Research, Mumbai 400012, Maharashtra, India Progesterone and progesterone receptors (PR) play a crucial role in female reproduction, but their roles in male reproductive physiology are largely unknown. Our previous studies demonstrated the presence of a specific membrane-bound PR in mature human spermatozoa that is known to regulate important sperm functions. The present study was undertaken to determine whether there exist PR in human testis and to investigate their molecular characteristics and expression profiles. PR mRNA and protein were detected in the spermatogenic cells, Sertoli cells, and occasionally the Leydig cells. PR protein was localized in nucleus and cytoplasm of spermatogonia, primary and secondary spermatocytes, and round spermatids in a stage-specific manner. Intense PR localization was observed in stages IV and V, whereas it was low at stages I, II, and III of spermatogenesis. RT-PCR studies revealed the presence of transcripts for PR in human testis and spermatogenic cells. In accordance with the reported molecular sizes of the known isoforms of PR, two mRNA transcripts of 3.8 and 2.8 kb for PR in adult human testis and spermatogenic cell RNA were

detected by Northern blot hybridization. Western blot analysis of testicular and spermatogenic cell lysates revealed two bands of 120 and 90 kDa, corresponding to the conventional PR. In these tissue lysates, an additional band of approximately 55 kDa was detected that was also observed as a single band in sperm lysates, indicating that this smaller protein may correspond to the membrane-bound PR. The membranebound PR protein was demonstrated on the spermatogenic cells when probed with progesterone-bound fluorescein conjugate. The results of the present study demonstrate the existence of both intracellular PR-B and PR-A mRNA and protein in the spermatogenic cells of the human testis. A membrane-bound PR was also localized in these cells. The varying levels of intracellular PR during different stages of spermatogenesis and the presence of the membrane-bound PR imply the significance of progesterone in male reproductive events such as regulation of spermatogenesis. (J Clin Endocrinol Metab 90: 474 – 483, 2005)

P

ROGESTERONE IS AN indispensable essential regulator of several female reproductive events such as ovulation, regulation of the menstrual cycle, implantation, and maintenance of pregnancy (1). The actions of progesterone are generally mediated via the conventional intracellular progesterone receptors (PR) that belong to the superfamily of transcription factors (2). These receptors are expressed in a variety of female fetal and adult tissues (3, 4). Gene-targeting strategies have demonstrated pleiotropic reproductive abnormalities in PR null female mice (5–7). PR knockout females show normal ovarian development but are anovulatory, presumably because of the failure of PR-mediated events in the granulosa cells (8). The knockout mice also display uterine factor infertility (5, 6). In contrast to the established unequivocal roles of progesterone in female reproductive physiology, there are limited data on the role of progesterone in male reproductive events. Progesterone is reported to induce hyperactive motility and acrosome reaction of mammalian spermatozoa (2, 9, 10).

There are reports demonstrating remarkable diurnal variation in the circulating levels of progesterone in male rats (11) and humans (12); high levels of progesterone have been detected in the testicular tissue (13). Recently, it has also been demonstrated that progesterone stimulates the expression of steroid acute regulatory gene (StAR), required for testosterone synthesis in the rat testis (14). These observations point toward the potential role of progesterone in testicular physiology. Our group and others have shown the presence of progesterone-binding protein on human spermatozoa (15, 16); the significance of the membrane-bound PR in sperm function is evident from our studies that show reduced expression of these receptors in infertile men (17). Along with spermatozoa, progesterone binding sites have also been detected in the testes of multiple species including immature rats (18), shark (19), sea trout (20), and octopus (21). However, the testicular PR in these species is present in the plasma membrane and has a different mode of action compared with the intracellular PR (2, 10). Although the reproductive phenotype of PR knockout male mice has not been reported in detail, mice null for steroid receptor coactivator-1 (SRC-1; an intracellular PR coactivator), show reduced testicular growth and fertility compared with their wild-type littermates (22). These observations entice us to hypothesize that PR may exist in testis, but to our knowledge there are no reports demonstrating its existence in the adult human testis. Thus, the present study was undertaken with the aim to investigate the existence of PR in human testis and its mo-

First Published Online October 27, 2004 Abbreviations: DBD, DNA-binding domain; dig, digoxigenin; ER, estrogen receptor; FITC, fluorescein isothiocyanate; FITC-P-BSA, FITC coupled to progesterone-BSA; FSHR, FSH receptor; HBD, hormonebinding domain; PBS-T, PBS with 0.5% Tween 20; PR, progesterone receptor(s); SSC, standard saline citrate; StAR, steroid acute regulatory gene. JCEM is published monthly by The Endocrine Society (http://www. endo-society.org), the foremost professional society serving the endocrine community.

474

Shah et al. • PR in Human Testis

J Clin Endocrinol Metab, January 2005, 90(1):474 – 483

lecular characterization. Profiling its expression and determining its cellular localization in human testis would help us in delineating the role of progesterone in testicular physiology. Subjects and Methods Subjects Testicular tissue was obtained from four cadavers (age 23–55 yr) from the Autopsy Unit of King Edward Memorial Hospital. These tissues were a part of another study (23) and were collected after appropriate ethical approval and informed consent. Semen samples were collected from healthy male volunteers after informed consent.

Tissue processing The testicular tissues immediately after collection were stripped off the tunica, and pieces were snap frozen and stored at –70 C until use. A small piece of 2– 4 mm was fixed in 10% buffered formaldehyde for 48 h and processed for paraffin embedding and sectioning. Total spermatogenic cells were isolated from the testicular tissue as described before (24). Briefly, seminiferous tubules were teased in chilled buffer [containing 10 mm Tris (pH 7.4), 1.5 mm EDTA, 10% glycerol, 25 mm sodium molybdate, and 1 mm dithiothreitol], quickly rinsed twice in chilled deionized water, and lightly homogenized in above buffer using an all-glass homogenizer. The homogenate was passed through glass wool, and the filtrate was centrifuged at 2500 rpm for 10 min. The resulting pellet was either frozen at –70 C or fixed in 70% ethanol until further use. Previous studies have demonstrated that the resulting pellet contains 90% of nonflagellated spermatogenic cells, and 10% of cells were flagellated (24, 25). Somatic cell contamination of the preparations was ruled out by RT-PCR for marker genes (described below). Semen samples were processed by the swim-up technique as described previously (26).

In situ hybridization Testicular sections (n ⫽ 4) of 5 ␮m thickness were spread on 3-aminopropyltriethoxysilane-coated glass slides, dried at 37 C for 2 h, and stored at room temperature until use. The slides were incubated in xylene for 15 min twice followed by passing the sections through alcohol grades of 100, 80, and 70% for 5 min each. The sections were washed in diethyl pyrocarbonate-treated water followed by a wash in 0.1 m PBS for 5 min. Finally, the sections were incubated in 2⫻ standard saline citrate (SSC; 1⫻ SSC contains 0.15 m sodium chloride and 0.015 m sodium citrate, pH 7) for 10 min. Prehybridization was carried out in prehybridization cocktail (50% formamide, 4⫻ SSC, 10% dextran sulfate, 0.25% yeast tRNA, and 0.25% herring sperm DNA) at room temperature for 30 min in a moist chamber. The probe used was a PR oligonucleotide (Table 1), which was tail labeled with digoxigenin (dig) and prepared as detailed previously (27). The probe was diluted at a concentration of 5 pmol/␮l in prehybridization cocktail and applied on the sections. Hybridization was carried out at 42 C overnight in a moist chamber. The next day, the slides were sequentially washed at room temperature

thrice in 4⫻ SSC for 10 min each and twice in 2⫻ SSC for 10 min each followed by a final wash in 1⫻ SSC for 5 min. The sections were equilibrated in buffer 1 (0.01 m Tris/HCl, pH 7.4, with 20 mm NaCl) for 5 min at room temperature and blocked with 2% normal sheep serum containing 0.3% Triton X-100 for 30 min at room temperature. Alkaline phosphatase-conjugated anti-dig antibody (Roche, Mannheim, Germany) (diluted 1:500 in blocking solution) was applied on the sections and incubated at 4 C for 16 –18 h. After incubation, washing was carried out with buffer 1 containing 0.1% Triton X-100 at room temperature for 10 min twice followed by incubation in buffer 3 (0.01 m Tris/HCl, pH 9.5, with 20 mm NaCl). Detection was carried out with nitroblue tetrazolium salt and 5-bromo-4-chloro-2-indoyl phosphate solution prepared in buffer 3 according to the manufacturer’s instruction (Roche). The reaction was stopped after 20 min by washing the slides in water and then mounting in mounting media (glycerol/PBS in the ratio of 9:1).

Immunohistochemical localization The 5-␮m-thick paraffin-embedded testicular sections (n ⫽ 4) were fixed on grease-free slides, and immunohistochemical localization was performed as described previously (28, 29). In brief, the sections were deparaffinized in xylene for 15 min twice followed by hydration through descending grades of alcohol and finally rinsed in PBS. Inactivation of endogenous peroxidases was achieved by incubating the sections in 0.3% H2O2 in 100% alcohol for 30 min in the dark. The slides were blocked in 1% BSA in 0.01 m PBS at room temperature for 1 h followed by an overnight incubation with PR monoclonal antibody (1:100 diluted) that recognizes the ligand-binding domain (Affinity Bioreagents, Golden, CO; clone no. PR-AT4.14) or PR-B-specific monoclonal antibody (diluted 1:100 in PBS) that recognizes the N-terminal region of PR-B protein (Santa Cruz Biotechnology, Santa Cruz, CA; clone no. PR-B 30). The slides were washed twice in PBS with 0.5% Tween 20 (PBS-T) for 5 min and then incubated for 1 h at room temperature in biotin-conjugated goat antimouse secondary antibody (Dako, Glostrup, Denmark) diluted 1:500 in PBS. The slides were washed twice with PBS-T and incubated with ABC complex (Vectastain kit, Vector Laboratories, Burlingame, CA) for 30 min at room temperature. After stringent washings in PBS-T at room temperature for 30 min, the slides were treated with 0.05% diaminobenzidine in PBS with 0.06% H2O2 for 10 min. The slides were counterstained with 1% hematoxylin for 2 min, dehydrated in ascending grades of alcohol for 10 min each, and kept in xylene for 2 h followed by mounting in DPX. As positive controls, sections were immunostained for ␤-actin using a monoclonal antibody (Sigma-Aldrich Corp., Bangalore, India; clone no. AC-40) diluted at 1:5000. For negative controls, the primary antibody was replaced with rabbit serum. Staining of sections was repeated at least twice. Three random sections from four testes were examined independently by two individuals, and the identity of immunopositive cells and the intensity of immunostaining was noted on a stage diagram of human spermatogenesis (30). The intensity of PR staining (graded as 0 for no staining, 1 for weak staining, 2 for moderate staining, and 3 for strong staining) was recorded for all the cells. The data were interpreted as the mean of the intensity score obtained at each stage.

TABLE 1. Sequences of the primers/probes used for detection of PR/FSHR/StAR genes Gene/isoform

PR-B PR-AB PR oligonucleotide

Primers

Sequence (5⬘ to 3⬘)

PRB1 (F) PRB2 (R) PR1 (F) PR21 (R) PR-AS

TGACTGAGCTGAAGGCAAAG CGACAGCGACTGCTGGTC GATTCAGAAGCCAGCCAGAG TGCCACATGGTAAGGCATAA TAAGGCGTCATTGAGAGGCAGGATAGGCACTGGATGAAATCCATCACGGTGGT ACCACCATGATGGATTTCATCCAGTGCCTATCCTGCCTCTCAATGACGCCTTA GCGAATTCAGATGGCTGAATAAG GCGGATCCGCTCATCTAGTTGGGTTC GTGGTAGACCAGCCCATGGA GCTCTGATGACACCACTCTGC

PR-S FSHR StAR

FSHR (F) FSHR (R) StAR (F) StAR (R)

F, Forward primer; R, reverse primer; AS, antisense; S, sense.

475

Annealing temperature (C)/expected size of RT-PCR products (bp)

52/242 55/766 42

53/86 53/592

476


RT-PCR Total RNA was extracted using Trizol reagent (Life Technologies, Inc., Grand Island, NY) from human testis (n ⫽ 4) and spermatogenic cells (n ⫽ 4). Five micrograms of total RNA was incubated with 5 U of ribonuclease-free deoxyribonuclease (DNase 1; Roche) in singlestrength reaction buffer at 37 C for 15 min. This was followed by removal of DNase using RNeasy spin column (QIAGEN Inc., Santa Clarita, CA). RT-PCR was carried out as described previously (26 –28). Briefly, firststrand cDNA was synthesized from DNA-free RNA samples using a commercial kit according to the manufacturer’s instructions (Roche); 1.6 ␮g random hexamer primers, 1 mm dNTPs, 5 mm MgCl2, 20 U of avian myeloblastosis virus reverse transcriptase, and 50 U of RNasin were used to synthesize the first strand of cDNA in a total volume of 20 ␮l. The reaction was incubated at 25 C for 10 min and then at 42 C for 1 h. At the end of the incubation period, AMV reverse transcriptase was denatured by incubating the reaction at 99 C for 5 min. Five microliters of the cDNA mix was amplified using 0.4 ␮m each primer as described (Table 1), 1 U Taq DNA polymerase (Life Technologies), 1.25 mm MgCl2, and 200 ␮m dNTPs in a 25-␮l reaction volume in a thermocycler (MJ Research Inc., Waltham, MA). Amplification was carried out for 35 cycles with each cycle consisting of denaturation at 94 C for 30 sec, annealing at the specified temperature for each set of primers (Table 1) for 30 sec, and extension at 72 C for 2 min. The products were analyzed on 1.2% agarose gel stained with ethidium bromide and visualized under UV transillumination. The negative control did not include reverse transcriptase in the reaction mixture. The RT-PCR products were cloned in pGMT vector as detailed previously (26) and sequenced commercially (Department of Biotechnology, National Facility, Delhi South Campus, New Delhi, India). The purity of spermatogenic cells was analyzed by determining the mRNA expression of FSH receptor (FSHR) and StAR as Sertoli and Leydig cell markers, respectively. The primers used for amplification of PR, FSHR, and StAR were commercially synthesized (Bangalore Genie, Bangalore, India, or Life Technologies), and the sequences are shown in Table 1.

Northern hybridization To determine the size of PR transcripts, Northern blotting was carried out according to standard protocol (31). Twenty micrograms of testicular and spermatogenic cell RNA were fractionated in 1.2% formaldehyde gels and transferred to nylon membrane (Roche). The membranes were prehybridized in DIG Easy hybridization granule solution (Roche) at 55 C for 2 h. Hybridization was carried out overnight at 55 C with an optimized concentration (25 ng/ml) of dig-labeled full-length PR cDNA probe (3.8 kb) excised from hPR1/pSG5 vector (a gift from Prof. Chambon, INSERM, France) as described previously (26). After hybridization, the membranes were washed in 2⫻ SSC with 0.1% SDS at room temperature, thrice for 15 min each, and then in 0.5⫻ SSC with 0.1% SDS at 60 C, thrice for 15 min each. The hybridized molecules were detected using nonradioactive chemiluminescent dig detection system as described earlier (32).

Western blot Testes and spermatogenic cells were homogenized in the lysis buffer [10 mm Tris (pH 7.4), 150 mm NaCl, 1 mm EDTA, 0.1% Triton X-100, 25

FIG. 1. Expression of PR transcripts in human testis detected by nonradioactive in situ hybridization using antisense (A) and sense (B) probe. Intense mRNA signals were detected in some of the secondary spermatocytes and round spermatids (arrow). The Leydig cells (Lc) and the peritubular cells (Pc) did not stain for PR mRNA. Magnification, ⫻40.


mm leupeptin, and 20 mm phenyl methyl sulfonyl fluoride) and centrifuged at 3000 rpm for 10 min at room temperature. Aliquots of all the preparations were stored at –20 C, and the concentration of total protein was determined (33). Sperm isolated by the swim-up technique (26) were treated with 0.1% digitonin at 4 C for 30 min (25) followed by lysis in the above buffer. Electrophoresis was carried out on 10% SDS-PAGE gel under reducing conditions (34). Briefly, the samples were heated at 95 C for 5 min with sample buffer and chilled immediately. Each lane was loaded with 50 ␮g of protein along with molecular weight marker (Amersham, Kwai Chung, Hong Kong). The separated proteins were transferred on a polyvinylidene difluoride membrane (35), followed by blocking in 10% nonfat dried milk powder in PBS at room temperature for 4 h. The blots were further incubated at 4 C for 18 –20 h with PR-AB monoclonal antibody diluted 1:100 in PBS. The blots were washed with PBS-T for 15 min thrice and then incubated for 2 h at room temperature with horseradish peroxidase-conjugated goat antimouse secondary antibody diluted 1:500 in PBS. The blots were washed with PBS-T eight times for 15 min each, and detection was carried out using the chemiluminescence detection system (Amersham) followed by exposure to x-ray films.

Direct fluorescence for PR Smears of sperm and spermatogenic cells fixed in 70% ethanol were made on clean grease-free slides and air dried. Direct fluorescence assay was performed according to the protocol detailed previously (17). Briefly, the smears were washed twice with PBS and once with PBS-T for 10 min at room temperature. After washing, the slides were incubated in 0.1% digitonin in PBS at 4 C for 30 min followed by washing with PBS-T for 5 min. The slides were incubated at 4 C for 18 –20 h in 0.1 ␮m fluorescein isothiocyanate (FITC) coupled to progesterone-BSA (FITC-P-BSA). The slides were subsequently washed six times with PBS-T for 10 min each, followed by mounting in glycerol-PBS. After staining, sperm slides were counterstained with propidium iodide solution at room temperature. Parallel negative controls (using FITC-BSA) were maintained in each experiment. The slides were examined under the ⫻100 objective of the fluorescence microscope (Olympus, Tokyo, Japan) and photographed using 400 ASA Kodak Gold film.

Results In situ localization of PR transcripts in human testis

Nonradioactive in situ hybridization was carried out on testicular sections to determine the cellular localization of PR transcripts in the testis. Strong positive signals were detected in the spermatogonia, primary and secondary spermatocytes, and round spermatids of the seminiferous tubules in adult human testis (Fig. 1A). The Leydig cells and peritubular cells and the vascular endothelium (not shown) were generally PR negative. In some areas of the seminiferous tubule, moderate to weak signals were generated, whereas other areas within the same tubule were stained intensely, indicating that the expression of PR mRNA in the spermatogenic cells could be stage specific (Fig. 1A). This pattern of local-


ization was consistently observed in the sections of all the testes analyzed. No signals were detected when a sense probe was used for hybridization (Fig. 1B). Localization of immunoreactive PR protein in human testis

Immunoreactive PR was localized in the cytoplasm and nuclei of the spermatogenic cells of the adult testis (Fig. 2). PR was also detected in the Sertoli cells (Fig. 2G, arrow) and some of the Leydig cells (Fig. 2B). The peritubular cells (Fig. 2, B and C) and the vascular endothelium (not shown) were consistently PR negative. No staining was detected in the negative control sections where the primary antibody was replaced by rabbit serum (Fig. 2J). The staining patterns were found to be similar to the antibody directed against the common epitope of PR-A and -B (PR-AB) and antibody recognizing the unique epitope of PR-B. Generally, the intensity of staining with the PR-AB monoclonal antibody was higher


477

than that observed for the PR-B-specific isoform (Fig. 2, A and D). Among the spermatogenic cells, the spermatogonia, primary and secondary spermatocytes, and the round spermatids stained positive for PR (Fig. 2, C and F). Detailed examination of the testicular sections further revealed immunoreactive PR in the head region of the testicular sperm (Fig. 2H, arrow). However, PR immunopositivity in the spermatogenic cells of the seminiferous tubules was heterogeneous. Some areas of the seminiferous tubules had moderate to weak signals, whereas other areas within the same tubule were stained intensely (Fig. 2. B and E), indicating that the expression of PR protein in the spermatogenic cells could be stage specific. In contrast, ␤-actin immunoreactivity was identical in all spermatogenic cells examined (Fig. 2I). This pattern of PR and ␤-actin staining was consistently observed in all the testicular specimens examined.

FIG. 2. Cellular localization of PR in human testis. Immunohistochemical localization of PR using the antibody that recognizes both A and B isoforms (A–C, G, and H) and only the B isoform (D–F). Immunoreactivity of PR was lower with the B isoform antibody (D) compared with the antibody recognizing both the isoforms (A). Expression of PR protein was most marked in the spermatogenic cells (B, C, E, and F) and the Sertoli cells (G; arrow). The Leydig cells (Lc) occasionally demonstrated PR expression (B), and peritubular cells (Pc) were PR negative. The expression of PR was stage specific because the intensity of staining was variable within the seminiferous tubules (B and E). Immunoreactive PR was detectable in the cytoplasm and nucleus of spermatogonia (Sg), spermatocytes (Sc), and round spermatids (Rs) at some stages of spermatogenesis (B, C, E, and F). Immature testicular sperm stained at the acrosomal region (H; arrow). ␤-Actin (positive control) was constitutively expressed (I). Negative control incubated with rabbit serum is shown in J. Magnifications, ⫻10 (A and D); ⫻40 (B, E, I, and J); ⫻100 (C, F, and G); H was captured using the ⫻100 objective and enlarged using an image analyzer.

478


Stage-specific expression of PR during spermatogenesis

Within the spermatogenic cells, expression of PR was found to be stage specific. The results of staging are summarized and illustrated pictorially in Fig. 3, A and B, and the relative intensity of staining at each stage is presented graphically in Fig. 3, C and D. The expression of PR was low in the cytoplasm of spermatogonia and spermatocytes at stages I, II, and III; no nuclear staining was evident in any of the cell types. However, there was a dramatic rise in the intensity of PR staining in both cytoplasm and the nucleus in all the cell types at stage IV, with maximal expression at stages IV and V of spermatogenesis. There was a slight decline in the intensity of PR staining in both cytoplasm and the nucleus at


stage VI of spermatogenesis compared with stage IV and V (Fig. 3A). Stage-specific differences were seen in the intensity of staining in all the cells including the spermatogonia. However, such dynamic variation in the expression of PR was not observed in the elongated spermatids. The elongated spermatids had nearly consistent expression of PR in the cytoplasm and almost insignificant expression in the nucleus irrespective of the stage (Fig. 3A). Detailed analysis of the nuclear and cytoplasmic PR staining with PR-AB antibody revealed temporal differences in peak PR immunostaining. Although at most stages the intensity of nuclear and cytoplasmic PR expression was iden-

FIG. 3. Diagrammatic representation of the stage-specific pattern of PR localization in human testis determined by immunohistochemistry. The diagrams were redrawn from that published by Clermont (30). The intensity of shading reflects the intensity of the immunopositive reaction within the different cell types (negative to ⫹3). A, Intensity of staining as determined using the antibody recognizing both the isoforms; B, pattern of staining generated using the antibody for the PR-B isoform. In A and B, spermatogenic cells are placed according to their developmental stages: Ad, spermatogonial type A dark; Ap, spermatogonia type A pale; B, type B; Pl, preleptotene; L, leptotene; Z, zygotene; P, pachytene; D, diplotene; 1–3, round spermatids; 4 – 8, elongating spermatids. I–VI represents various developmental stages of spermatogenesis. C and D, Graphic representations of the mean intensity of nuclear and cytoplasmic staining for PR-AB and PR-B in the spermatogenic cells, respectively. The intensity of staining in the nucleus and cytoplasm was independently scored as 0 for absent to 3 for intense staining. The mean staining intensity was calculated as the average of all the scores obtained at a given stage in different tubules.


tical, peak nuclear immunoreactivity was observed at stage V of spermatogenesis, whereas peak cytoplasmic staining was observed at stage IV (Fig. 3C). The pattern of PR-B staining during different stages of spermatogenesis was identical as described above, although the intensity of staining was relatively weak (Fig. 3B). PR-B immunoreactivity in cytoplasm was low at stages I, II, and III of spermatogenesis, and no nuclear staining was visible. The intensity of staining increased in both cytoplasm and nucleus at stages IV, V, and VI. Peak PR immunostaining in both cytoplasm and the nucleus was observed at stage V of spermatogenesis when the PR-B antibody was used for staining (Fig. 3D). No such variations were seen when sections stained for ␤-actin were analyzed (data not shown). Detection of PR mRNA isoforms in human testis

RT-PCR analysis was carried out in RNA samples from human testis and spermatogenic cells to detect the presence of PR mRNA. Using primers that amplify the sequences encompassing the common region for both the PR isoforms [DNA-binding domain (DBD) and hormone-binding domain (HBD)], a single band of expected size (766 bp) was observed in testicular (Fig. 4A, lane 1) and spermatogenic (Fig. 4A, lane 2) cells. Similarly, a product of expected size (242 bp) was detected when primers specific to the unique region of the PR-B isoform were used for amplification in testis (Fig. 4A, lane 3) and in spermatogenic cells (Fig. 4A, lane 4). No bands were observed when reverse transcriptase was omitted from the reaction mixture (Fig. 4A, lane 5). The PCR products were sequenced in both the directions, and similarity searches revealed their complete homology with that of the conventional PR. Northern blot analysis was carried out to determine the

FIG. 4. Detection of PR transcripts in testis and spermatogenic cells. A, PCR amplification of PR in the testis and spermatogenic cell cDNA with primers spanning the DBD and the HBD (766 bp; lanes 1 and 2) or N-terminal region unique to the B isoform (242 bp; lanes 3 and 4) of human PR. The negative control (without reverse transcriptase) is shown in lane 5. Lane M contains DNA molecular weight markers HaeIII-digested ØX 174 fragments. B, The transcript size for PR in testis and spermatogenic cell RNA was assessed by Northern blot probed with full-length digoxigenin-labeled PR-B probe. Two transcripts of 3.8 and 2.8 kb corresponding to PR-B and PR-A isoforms were detected in testicular (lane 1) and spermatogenic cell (lane 2) RNA.


479

size of PR transcripts in testis and spermatogenic cells. Two transcripts of 3.8 and 2.8 kb were detected when total RNA from testis and spermatogenic cells (Fig. 4B, lanes 1 and 2, respectively) was probed using a dig-labeled full-length PR-B probe. These results suggest that the mRNA for both the isoforms of PR is expressed in the testis as well as in spermatogenic cells. To test the purity of spermatogenic cell preparation, amplification of Sertoli and Leydig cell markers was performed by RT-PCR. Bands of expected size were obtained in testicular RNA for FSHR (Fig. 5, lanes 1 and 3) and StAR (Fig. 5, lane 5) but not in spermatogenic cell RNA for FSHR (Fig. 5, lane 6) and StAR (Fig. 5, lane 8), indicating that the preparation was free of somatic cell contamination. No bands were observed when reverse transcriptase was omitted from the reaction mixture for FSHR (Fig. 5, lanes 2 and 4) and for StAR (Fig. 5, lanes 7 and 9). Western blot for PR in testis and spermatozoa

Molecular size of the PR protein was studied by Western blot analysis using PR monoclonal antibody (for PR-AB isoform) in protein extract of human testis, spermatogenic cells, and mature spermatozoa (Fig. 6A). Three bands of approximately 120, 90, and 55 kDa were obtained in testicular and spermatogenic cell protein extract (Fig. 6A, lanes 1 and 2). A single band of approximately 55 kDa was detected in spermatozoa protein extract using the same monoclonal antibody (Fig. 6A, lane 3). No bands were visible in the case of negative controls where the antibody was replaced by normal rabbit serum (Fig. 6B).

FIG. 5. Determination of purity of spermatogenic cell preparations by RT-PCR for Sertoli and Leydig cell markers. Using specific primers for FSHR (Sertoli cell marker), a band of 86 bp was detected in testicular cDNA (lanes 1 and 3; negative control, lanes 2 and 4) but not in spermatogenic cell cDNA preparations (lane 7; negative control, lane 8). For StAR mRNA (Leydig cell marker) a band of 592 bp was detected by RT-PCR in testicular cDNA (lane 5) but not in spermatogenic cell cDNA (lane 9) preparations. The respective negative controls (without reverse transcriptase) are shown in lanes 6 and 10. Lane M contains DNA molecular weight markers Hae III-digested ØX 174 fragments.

480


FIG. 6. Western blot analysis to detect PR protein in testis (lane 1), spermatogenic cells (lane 2), and spermatozoa (lane 3). A, Using the antibody that recognizes both A and B isoforms of human PR, three bands of 120, 90, and approximately 55 kDa were detected in testicular and spermatogenic cell lysates. A single band of approximately 55 kDa was detected in sperm lysate. B, A duplicate blot probed with normal rabbit serum did not show any signals.

Expression of membrane-bound PR

Membrane-bound PR in the spermatogenic cells and on human spermatozoa was detected by a direct fluorescence assay using FITC-P-BSA conjugate. Using this membraneimpermeable ligand, PR was detected on the round spermatids (Fig. 7A) and also on the head/acrosomal region of the ejaculated spermatozoa (Fig. 7B). No staining was detected when FITC-BSA alone was used for the assay (Fig. 7C). Discussion

Our previous findings demonstrating the presence of membrane-bound PR in mature human spermatozoa (15, 17, 25, 26) prompted us to explore whether similar mediators of progesterone action also exist in human testicular tissue and, if they exist, then to investigate their molecular characteristics and expression patterns. Interestingly, we detected not only the membrane-bound PR but also the conventional PR in human testis. Furthermore, mRNA and protein for both the isoforms of the conventional PR (PR-B and PR-A) were found to be present in testis. A stage-specific pattern of PR expression was observed in spermatogenic cells, suggesting a temporal regulation of intracellular PR expression. To our


knowledge, this is the first report demonstrating the existence of both conventional and the membrane-bound PR in the human testis. To determine the cellular localization of the PR transcripts and protein, in situ hybridization and immunohistochemistry was performed on testicular sections. Signals for PR mRNA were observed predominantly in spermatogenic cells and Sertoli cells; the Leydig cells and the peritubular cells were generally negative for PR mRNA. Within each seminiferous tubule, the spermatogonia and spermatocytes in certain areas were strongly stained for PR mRNA, whereas the expression was barely detectable in other regions of the same tubule, indicating that the transcription of PR in the human testis may be stage specific. However, the precise stages at which the mRNA staining for PR was intense could not be ascertained because the sections were not counterstained. PR protein was immunolocalized in the nuclei and cytoplasm of the spermatogenic cells, Sertoli cells, and occasionally the Leydig cells. The nuclear and cytoplasmic expression of PR indicated the possibility of progesterone actions being mediated via the genomic mode in testes. Interestingly, estrogen receptor (ER), another member of the steroid receptor superfamily, is also expressed in the nucleus and cytoplasm of the Sertoli cells and the spermatogenic cells of the human testis (36), suggesting that in the testis, the spermatogenic cells are target sites of steroid action. In contrast to ER and PR, androgen receptors are exclusively expressed in the somatic cells of the testis (37). These observations suggest that the effects of estrogen and progesterone may be more generalized in the testis compared with androgens, which cannot act directly on spermatogenic cells. Although at present the intratubular physiological levels of progesterone are unknown, it is plausible that the progesterone synthesized in Leydig cells along with androgens and estrogens may act in a paracrine manner on the spermatogenic cells to regulate spermatogenesis. The functional relevance of testicular response to progesterone is evident in reports demonstrating the disruption of spermatogenesis and spermiogenesis after administration of progestins in men (38, 39). The effects of supraphysiological levels of progesterone on spermatogenesis have been reported to be a result not only of its central effects on the hypothalamus but also by a mechanism independent of gonadotropin suppression (39). We propose that the gonadotropin-independent effects of progesterone in the

FIG. 7. Detection of progesterone-binding protein on the membrane of spermatogenic cells and ejaculated human spermatozoa by direct fluorescence. A and B, Using FITC-P-BSA, intense green signal was detected on the membrane of spermatogenic cells (A) and on the acrosomal region of spermatozoa (B). C, Spermatozoa stained with FITC-BSA alone (as negative control). Green fluorescence indicates positive staining for membrane-bound PR, and red indicates negative staining (counterstained with propidium iodide) as visualized with the ⫻100 oil immersion objective.


testis may be modulated by PR that are expressed in the spermatogenic cells. The expression of PR mRNA and protein in the spermatogonial cells was stage specific. Immunoreactive PR levels were low in the cytoplasm and the nucleus of most cells at stage I of spermatogenesis, and the expression dropped further at stages II and III where the nuclear immunoreactivity was almost negligible (Fig. 3). This probably is indicative of low or negligible level of progesterone-induced transcriptional activity in the initial stages of spermatogenesis. However, the levels of immunoreactive PR protein were higher in the cells at stage IV and V, and a slight reduction in the intensity of staining was seen in stage VI of spermatogenesis. This pattern of PR staining was specific and not because of protein degradation, because irrespective of the stage, ␤actin was constitutively expressed in all the spermatogenic cells of the testicular tubules. Such a stage-specific requirement of several gene products has been reported in the mammalian testes and is a subject of extensive investigations (40, 41). The relative higher abundance of PR mRNA and protein in some stages of spermatogenesis implies that the transcription of PR in the testis may require expression of specific factors that may be coexpressed during these developmental stages. The stage-specific switching on and off of PR expression suggests that each cell during its course of development may experience several independent waves of progesterone effects; whether such temporal priming of progesterone is a requirement for spermatogonial maturation and/or stage transition remains to be established. The pattern of PR expression observed in the spermatogenic cells in this study differ from that reported for ER. The expression of PR being stage specific, it was generalized in all cell types at that particular stage. In contrast, the expression of ER␤ is cell type specific, independent of the stage (36). It has been demonstrated that ER␤ protein in the human testis is expressed in the spermatogonial cells and round spermatids; the meiotic cells have negligible expression irrespective of the stage (36). Thus, it appears that there exist spatial and chronological differences in the requirements of estrogen and progesterone by the spermatogenic cells during maturation. Although at present the precise role of progesterone in the testis remains speculative, an increase in PR expression after stage III hints at the possible involvement of progesterone and progesterone-regulated gene products in the regulation of spermatogenesis after spermiation (Fig. 3). Indeed, administration of supraphysiological levels of progestins to males has been shown to result in the disruption of spermiation (reviewed in Ref. 38) that is independent of gonadotropin suppression (39). The pattern of stage-specific expression of immunoreactive PR detected using the common antibody against both the isoforms (PR-AB) was generally similar to that observed when a specific antibody against the PR-B isoform was used, except that PR-B immunostaining was relatively less intense than that compared with PR-AB. Although it is possible that the differences in the staining intensities could be because of the inherent differences in the activity of the two antibodies, it is likely that an increased PR immunostaining using the common antibody could be a result of its ability to recognize both isoforms of PR. Interestingly, some differences were


481

seen when the expression profiles of the staining generated by the two antibodies were compared. Similar to PR-AB antibody, PR-B immunoreactivity in cytoplasm was lower in stages I, II, and III. The peak cytoplasmic PR-B staining was evident in stage V, whereas the peak of cytoplasmic PR-AB staining was detected in stage IV (Fig. 3). This indicates that PR-A may be up-regulated at stage IV of spermatogenesis. In this context, it is tempting to speculate that the possible induction of PR-A at stage IV after spermiation may be an essential signal required for all the germ cells in that stage to begin a new phase of differentiation. Indeed, based on detailed phenotypic and molecular analysis of the PR-A knockout female mice, it has been postulated that PR-B may be responsible for proliferative activity and PR-A may be required for differentiation (7). Although in this study, it has not been feasible for us to provide conclusive evidence on the differential expression patterns of PR-A and PR-B in spermatogenic cells at different stages of spermatogenesis, studies aimed toward dissecting the localization and functions of each isoform may give us insights into the regulation of progesterone response in human testis. We also made attempts to detect isoforms of PR transcripts in the human testis. A single band of expected size for PR was detected in the testicular and spermatogenic cell cDNA when primers spanning the DBD and HBD of the conventional PR were used for RT-PCR. The RT-PCR products obtained in testicular and spermatogenic cells were cloned, and the sequences obtained were completely homologous to the conventional PR. These results are in agreement with previous studies where PR transcripts have been detected in monkey testis and in the human testicular cDNA library (42– 44). The present study further demonstrates that PR is transcribed in the spermatogenic cells. The purity of the spermatogenic cell preparation is evident by the absence of transcripts for Sertoli cell (FSHR) and Leydig cell (StAR) markers. However, differences were noted in the PR cDNA sequence obtained in these studies when compared with the sequences of PR clones identified in the human testicular cDNA library (43, 44). The PR clones in the testicular cDNA library had insertion of some novel sequences of approximately 200 bp (termed exon S and exon T) in the DBD and HBD region (43, 44), but we failed to detect the presence of any such additional sequences in the testicular PR mRNA sequences encompassing the same region. At present, the reasons for such discrepant findings are unclear; the differences in experimental approaches used may be a possible reason for such disagreement. Using primers that specifically amplify the region unique to PR-B, a single band of expected size and sequence was obtained in testicular and spermatogenic cell cDNA. Because the PR-A sequence completely overlaps with that of PR-B, it had not been possible to detect PR-A transcripts by RT-PCR, but our studies provide strong evidence for the presence of transcript for the B isoform in testis. Northern analysis of testicular and spermatogenic cell RNA probed with dig-labeled full-length PR-B cDNA clone revealed two transcripts of approximately 3.8 and 2.8 kb encoding for PR-B and PR-A isoforms, respectively. Corroborating these results, two bands of approximately 120 and 94 kDa, corresponding to PR-B and PR-A, respectively, were detected in testicular and spermatogenic cell protein lysates

482 J Clin Endocrinol Metab, January 2005, 90(1):474 – 483

when probed with a monoclonal antibody immunoreactive to both the isoforms. However, a smaller protein of approximately 55 kDa was also detected in these cell lysates. Based on sequence analysis of testicular PR clones demonstrating some novel exons, PR protein of smaller size (⬃29 kDa) has been proposed to be translated in the testis (43). PR isoforms of 60 and 47 kDa for PR-C and PR-M, respectively, have been reported in breast cancer tissues and adipose and aortic cells (45, 46). It is possible that the 55-kDa PR protein detected in testicular and spermatogenic lysates may be one of the smaller isoforms of the conventional PR. However, we were unable to detect additional PR transcripts in testicular and spermatogenic cell mRNA by Northern blotting. It is likely that the smaller PR protein detected in the testis and in spermatozoa is a posttranslationally modified or a proteolytically cleaved form of the conventional PR, or it is possible that the transcripts for the smaller form of PR may be expressed in the testis but are rare and not detectable by Northern analysis. Interestingly, a single band of approximately 55 kDa is detected in sperm lysates that is known to have the membrane-bound PR (47, 48). This size is within the range reported by most of the studies using PR antibodies (16, 49) and also by ligand blot assay (16). Thus, it is likely that the approximately 55-kDa protein present in the testicular and spermatogenic cell lysate may be the membrane-bound PR present along with the conventional PR. To investigate whether the membrane-bound PR also exists in the testis, direct fluorescence studies using membraneimpermeable progesterone conjugate were performed. A subset of spermatogenic cells exhibited intense fluorescence on the cell surface, indicating that the membrane-bound PR may also be expressed in the spermatogenic cells of the human testis. Indeed, immunogold electron microscopic studies carried out using the PR antibodies demonstrate an integral localization of the protein on the acrosomal membrane of rat testicular spermatids (D’Souza, S., C. Shah, G. Sachdeva, and C. P. Puri, submitted for publication). This result demonstrates that along with the intracellular PR, the membrane-bound PR also exists in testis. The membranebound PR has been reported in a number of reproductive and nonreproductive tissues and is known to act via a transcriptionally independent mechanism (10). Although in this study we have not carried out in-depth characterization of membrane-bound PR, our results provides initial evidence for its presence in testis, its nongenomic actions as reported in other systems (reviewed in Refs. 2, 10, 50, 51) need to be explored. In summary, the results of the present study demonstrate for the first time the existence of both PR mRNA and protein in the spermatogenic cells of the human testis and also a smaller protein that probably corresponds to the membranebound PR in the testis and spermatogenic cells. The expression of the two (conventional and membrane-bound) forms of PR in the spermatogenic cells of the testis points toward important roles of progesterone in spermatogenesis and sperm functions. Unraveling the mechanisms of action of PR in the testis will not only be of importance in understanding testicular physiology but will also be of help in development of the strategies for male contraception and fertility regulation.


Acknowledgments This work was generously funded by the Indian Council of Medical Research, India (National Institute for Research in Reproductive Health/ MS/4/2004). We are grateful to Prof. P. Chambon, (INSERM, France) for providing full-length cDNA clone of human PR-B form (hPR1/pSG5). C.S. is grateful to the Council of Scientific and Industrial Research, New Delhi, for providing a senior research fellowship and also a travel grant award. We also thank the dean Dr. N. Kshirsagar, King Edward Memorial Hospital, for allowing us to collect the semen samples and tissues. We are thankful to Dr. S. Mahale and Dr. A. Maitra for the primers of FSHR and StAR. We are thankful to Dr. M. Sharma and Dr. N. Balasinor for their help in staging spermatogenesis. We are also thankful to Dr. V. Khole for critical evaluation of the manuscript and her valuable suggestions. The artwork by Mr. H. Karekar is appreciated. Received April 29, 2004. Accepted October 14, 2004. Address all correspondence and requests for reprints to: Chander Puri, Director, National Institute for Research in Reproductive Health, Indian Council of Medical Research, Jehangir Merwanji Street, Parel, Mumbai 400012, Maharashtra, India. E-mail: [email protected]. A part of these results was presented at the Third International Meeting on Rapid Response of Steroid Hormones, Florence, Italy, September 2003.

References 1. Clarke CL, Sutherland RL 1990 Progestin regulation of cellular proliferation. Endocr Rev 11:266 –301 2. Losel R, Wehling M 2003 Nongenomic actions of steroid hormones. Nat Rev Mol Cell Biol 4:46 –56 3. Press FM, Greene GL 1988 Localization of progesterone receptor with monoclonal antibodies to the human progestin receptor. Endocrinology 122:1165– 1175 4. Inoue T, Akahira J, Takeyama J, Suzuki T, Darnel AD, Kaneko C, Kurokawa Y, Satomi S, Sasano H 2001 Spatial and topological distribution of progesterone receptor A and B isoforms during human development. Mol Cell Endocrinol 182:83– 89 5. Lydon JP, DeMayo FJ, Funk CR, Mani SK, Hughes AR, Montgomery CA, Shyamala G, Conneely OM, O’Malley BW 1995 Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes Dev 9:2266 – 2278 6. Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP, Conneely OM 2000 Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 289:1751–1754 7. Conneely OM, Mulac-Jericevic B, Lydon JP 2003 Progesterone-dependent regulation of female reproductive activity by two distinct progesterone receptor isoforms. Steroids 68:771–778 8. Shao R, Markstro¨m E, Friberg PA, Johansson M, Billig H 2003 Expression of progesterone receptor (PR) A and B isoforms in mouse granulosa cells: stagedependent PR-mediated regulation of apoptosis and cell proliferation. Biol Reprod 68:914 –921 9. Calogero AE, Burrello N, Barone N, Palermo I, Grasso U, D’Agata R 2000 Effects of progesterone on sperm function: mechanism of action. Hum Reprod 15:28 – 45 10. Losel RM, Falkenstein E, Feuring M, Schultz A, Tillmann HC, RossolHaseroth K, Wehling M 2003 Nongenomic steroid action: controversies, questions, and answers. Physiol Rev 83:965–1016 11. Kalra PS, Kalra SP 1977 Circadian periodicities of serum androgens, progesterone, gonadotropins and luteinizing hormone releasing hormone in male rats: the effect of hypothalamic deafferentation, castration, and adrenalectomy. Endocrinology 101:821–1827 12. Opstad K 1994 Circadian rhythm of hormones is extinguished during prolonged physical stress, sleep and energy deficiency in young men. Eur J Endocrinol 131:56 – 66 13. Leinonen P, Hammond G, Vikho R 1980 Testosterone and some of its precursors and metabolites in the human epididymis. J Clin Endocrinol Metab 51:423– 428 14. Schwarzenbach H, Manna PR, Stocco DM, Chakrabarti G, Mukhopadhyay AK 2003 Stimulatory effect of progesterone on the expression of steroidogenic acute regulatory protein in MA-10 Leydig cells. Biol Reprod 68:1054 –1063 15. Shah CA, Modi D, Gadkar S, Sachdeva G, Puri CP 2003 Progesterone receptors on human spermatozoa. Ind J Exp Biol 41:773–780 16. Luconi M, Bonnaccorsi L, Maggi M, Pecchioli P, Krausz C, Forti G, Baldi E 1998 Identification and characterization of functional nongenomic progesterone receptors on human sperm membrane. J Clin Endocrinol Metab 83:877– 885 17. Gadkar S, Shah CA, Sachdeva G, Samant U, Puri CP 2002 Progesterone receptor as an indicator of sperm function. Biol Reprod 67:1327–1336


18. Rossato M, Nogara A, Merico M, Ferlin A, Foresta C 1999 Identification of functional binding sites for progesterone in rat Leydig cell plasma membrane. Steroids 64:168 –175 19. Cuevas ME, Callard G 1992 Androgen and progesterone receptors in shark (Squalus) testis: characteristics and stage-related distribution. Endocrinology 130:2173–2182 20. Thomas P, Breckenridge-Miller D, Detweiler C 1997 Binding characteristics and regulation of the 17␣,20␣,21-trihydroxy-4-pregnen-3-one (20␣-S) receptor on testicular and sperm plasma membranes of spotted sea trout (Cynoscion nebulosus). Fish Physiol Biochem 17:109 –116 21. D’Aniello A, Di Cosmo A, Di Cristo C, Assisi L, Botte V, Di Fiore MM 1996 Occurrence of sex steroid hormones and their binding proteins in Octopus vulgaris Lam. Biochem Biophys Res Commun 227:782–788 22. Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai MJ, O’Malley BW 1998 Partial hormone resistance in mice with disruption of the steroidal receptor coactivator-1 (SRC-1) gene. Science 279:1922–1925 23. Modi D 2003 Molecular and cytogenetic investigations in human sex chromosome aneuploidies. PhD thesis, University of Mumbai, India 24. Salhanick AI, Terner C 1979 Androgen synthesis in absence of Leydig and Sertoli cells in a germ cell fraction from rat seminiferous tubules. Biol Reprod 21:293–300 25. Ambhaikar MB, Puri CP 1998 Cell surface binding sites for progesterone on human spermatozoa. Mol Hum Reprod 4:413– 421 26. Sachdeva G, Shah CA, Kholkute SD, Puri CP 2000 Detection of progesterone receptor transcript in human spermatozoa. Biol Reprod 62:1610 –1614 27. Puri CP, Katkam RR, Sachdeva G, Patil V, Manjramakar D, Kholkute SD 2000 Endometrial contraception: modulation of molecular determinants of uterine receptivity. Steroids 65:783–794 28. Sachdeva G, Patil V, Katkam RR, Manjramkar DD, Puri CP 2001 Expression profile of endometrial leukemia inhibitory factor, transforming growth factor ␤2 (TGF␤2) and TGF␤2R in infertile bonnet monkeys. Biol Reprod 65:1– 8 29. Modi D, Sane S, Bhartiya D 2003 Accelerated germ cell apoptosis in sex chromosome aneuploid fetal human gonads. Mol Hum Reprod 9:219 –225 30. Clermont Y 1963 The cycle of the seminiferous epithelium in man. Am J Anat 112:35–51 31. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular cloning: a laboratory manual. 2nd ed. New York: Cold Spring Harbor Laboratory Press 32. Sachdeva G, Kaur G, Bamezai R 1995 Noise free chemiluminescent detection of human T cell receptor and interleukin 2 receptor genes after optimization of digoxigenin labeled probe concentration. Ind J Exp Biol 33:173–183 33. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ 1951 Protein measurement with folin phenol reagent. J Biol Chem 193:265–272 34. Lamelli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680 – 685 35. Towbin H, Stachlin T, Gordon J 1979 Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheet: procedures and some applications. Proc Natl Acad Sci USA 76:4350 – 4354


483

36. Saunders PTK, Millar MR, Macpherson S, Irvine DS, Groome NP, Evans LR, Sharpe RM, Scobie GA 2002 ER␤1 and The ER␤2 splice variant (ER␤cx/␤2) are expressed in distinct cell populations in the adult human testis. J Clin Endocrinol Metab 87:2706 –2715 37. Van Roijen JH, Van Assen S, Van Der Kwast TH, De Rooij DG, Boersma WJ, Vreeburg JT, Weber RF 1995 Androgen receptor immunoexpression in the testes of subfertile men. J Androl 16:510 –516 38. Reddy PRK 2000 Hormonal contraception for human males: prospects. Asian J Androl 2:46 –50 39. McLachlan RI, Robertson, Pruysers E, Ugoni A, Matsumoto AM, Anawalt BD, Bremner WJ, Meriggiola C 2004 Relationship between serum gonadotropins and spermatogenic suppression in men undergoing steroidal contraceptive treatment. J Clin Endocrinol Metab 89:1142–1149 40. Stephane V, Dominique S, Satomi N, Shin-Ichi N, Julien S, Francois C, Minoo R 1998 Stage-specific expression of the Kit receptor and its ligand (KL) during male gametogenesis in the mouse: a Kit-KL interaction critical for meiosis. Development 125:4585– 4593 41. Steger K, Behr R, Kleiner I, Weinbauer GF, Bergmann M 2004 Expression of activator of CREM in the testis (ACT) during normal and impaired spermatogenesis: correlation with CREM expression. Mol Hum Reprod 10:129 –135 42. Heikinheimo O, Mahony MC, Gordon K, Hsiu J, Hogden G, Gibbsons W 1995 Estrogen and progesterone receptor mRNA are expressed in distinct pattern in male reproductive organs. J Assist Reprod Genets 12:198 –204 43. Hirata S, Shoda T, Kato J, Hoshi K 2000 The novel isoform of the progesterone receptor cDNA in the human testis and detection of its mRNA in the human uterine endometrium. Oncology 59:39 – 44 44. Hirata S, Shoda T, Kato J, Hoshi K 2002 The novel exon, exon T, of the human progesterone receptor gene and the genomic organization of the gene. J Steroid Biochem Mol Biol 80:365–367 45. Wei LL, Miner R 1994 Evidence for the existence of a third progesterone receptor protein in human breast cancer cell line T47D. Cancer Res 54:340 –343 46. Saner KJ, Welter BH, Zhang F, Hansen E, Dupont B, Wei Y, Price TM 2003 Cloning and expression of a novel, truncated, progesterone receptor. Mol Cell Endocrinol 200:155–163 47. Blackmore PF, Fisher JF, Spilman CH, Bleasdale JE 1996 Unusual steroid specificity of the cell surface progesterone receptor on human sperm. Mol Pharmacol 49:727–739 48. Blackmore PF, Lattanzio F 1991 Cell surface localization of a novel nongenomic progesterone receptor on the head of human sperm. Biochem Biophys Res Commun 181:331–336 49. Sabeur K, Edwards DP, Meizel S 1996 Human sperm plasma membrane progesterone receptor(s) and the acrosome reaction. Biol Reprod 54:993–1001 50. Bramely T 2003 Non-genomic progesterone receptors in the mammalian ovary: some unresolved issues. Reproduction 125:3–15 51. Thomas P, Zhu Y, Pace M 2002 Progestin membrane receptors involved in the meiotic maturation of teleost oocytes: a review with some new findings. Steroids 67:511–517

JCEM is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.