(Collembola, Hexapoda) from the Siberia, Russia

Zootaxa 4350 (1): 185–195 http://www.mapress.com/j/zt/ Copyright © 2017 Magnolia Press

Article

ISSN 1175-5326 (print edition)

ZOOTAXA

ISSN 1175-5334 (online edition)

https://doi.org/10.11646/zootaxa.4350.1.12 http://zoobank.org/urn:lsid:zoobank.org:pub:7B99CB67-1397-4319-B17F-83F22AB10CCA

A new troglobiotic Protaphorura (Collembola, Hexapoda) from the Siberia, Russia ANDREA PARIMUCHOVÁ1,4, ĽUBOMÍR KOVÁČ1, MARTINA ŽUROVCOVÁ2 & OĽGA IVANOVNA KADEBSKAYA3 1 Department of Zoology, Institute of Biology and Ecology, Faculty of Science, P. J. Šafárik University, Šrobárova 2, 041 54, Košice, Slovakia 2 Institute of Entomology, Biology Centre AS CR v. v. i., Branišovská 31, 37005 České Budějovice, Czech Republic 3 Mining Institute of Ural, Branch of Russian Academy of Sciences, Sibirskaya 78a, 614007 Perm, Russia 4 Corresponding author. E-mail: [email protected]

Abstract A new species of Protaphorura Absolon, 1901 (Collembola, Onychiuridae), P. cykini sp.nov., is described from a cold karst cave in the Irkutsk region, Siberia, Russia. It is an obligate cave species with the largest body size (4.3–5.6 mm) of all congeners. The species is further characteristic by the pseudocellar formula as 3(2)2/022/33343, high number of vesicles in postantennal organ (65–71) and subapical organite protected with two papillae. A partial sequence of cytochrome oxidase I (COI DNA barcoding marker) gene is used to verify the taxonomic status of the new species and the barcode sequence is compared with other congeners available in GenBank database. Distribution and diversity of cave Collembola of Siberia is discussed. Key words: obligate cave species, body size, DNA barcode, cold caves, Siberia

Introduction The subterranean Collembola of the Eastern Siberia have been studied by several authors, the distribution data were resumed by Kniss (2001) and Turbanov et al. (2016a,b,c) in their reviews of the cave fauna of Russia and adjacent countries. Recently, Juberthie et al. (2016) made a survey of the subterranean fauna of the Siberia and the Far East, Collembola included. Several new edaphic species were described or redescribed in the last years from the Eastern Siberia (Babenko 2007; Kaprus´& Pomorski 2008; Gulgenova & Potapov 2013; Babenko & Kaprus´ 2014; Kaprus´ et al. 2016), however, without attention to the cave representatives. Oligaphorura schoetti (LiePettersen, 1896) was specified as the only obligate cave collembolan in this region (Kniss 1991), the species listed later as a troglophile by Turbanov et al. (2016a,b,c). After this review, caves in the Baikal region seem to lack troglobiotic invertebrates, only troglophile invertebrates have been reported (spiders: 1spp., collembolans: 3 spp., beetles: 1 spp.) DNA barcoding was proposed as a novel approach to species identification (Hebert et al. 2003a). Divergences in COI sequences enable not only to assign the species into higher taxonomic categories, but are moreover reliable in the discrimination of closely allied or sibling species (e.g. Hebert et al., 2003b; Hogg & Hebert 2004; Stevens et al. 2006; Porco et al. 2010). In the present paper we describe a new Protaphorura species from a cave in the Pribaikalsky National Park that was collected during the common Russian-Slovakian geological expedition to caves of the Irkutsk region in 2014. Barcode sequences data of P. cykini sp. nov. are compared to those of six congeneric species, providing the molecular support to the validity of the new species.

Accepted by W.M. Weiner: 11 Aug. 2017; published: 16 Nov. 2017

185

Material and methods Locality. Karst of the Irkutsk region covers 350,000 km2 consisting basically of Cambrian limestones and dolomites (Juberthie et al. 2016). Okhotnichya Cave, discovered in 2006, is situated on northern slope of the Primorsky Range, on the western side of the Baikal Lake in elevation of 800–1000 m. The cave was created in onkolite and stromatolite limestones and dolomites of Upper Proterozoic Uluntui Formation. The cave system was developed in a series of subparallel disruptions of north-northeastern direction with the total length of 5700 m and depth of 77 m (Fig. 1a). Internal spaces include both wide and high narrow passages with characteristic fissure cross-section and height up to 25 m. The cave is known for diverse cryogenic mineral formations (Osintsev 2010, Bazarova et al. 2011; 2014). Collection of the material and morphological examination. Specimens of the new species were discovered in Okhotnichya Cave (Irkutsk region) during two visits in 2014–2016. They were collected by hand on cave walls and sediment, and immediately fixed in 96% ethylalcohol. In the laboratory the specimens were separately mounted on permanent slides in Swann medium (Liquido de Swann) modified after Rusek (1975) and studied in Leica DM 2500 microscope equipped with phase contrast and DIC optics, measuring eyepiece and drawing arm. The images were taken with Olympus 5.1 megapixel camera and edited with Adobe Photoshop CS3.

FIGURE 1a-d. a, Map of Okhotnichya Cave (Bazarova et al. 2014) with sampling sites; b, cave entrance, photo: O.I. Kadebskaya; c, habitus of Protaphorura cykini sp.nov., photo: P. Holúbek; d, aggregation of P. cykini sp. nov. on mouldy pika´s excrements (Ochotona sp.), photo: O.I. Kadebskaya.

Chaetotaxy of head, furca remnant and tibiotarsi is applied according to Jordana et al. (1997), Weiner (1996) and Deharveng (1983), respectively. Pattern of chaetae s, s´ and s´´ on abdominal terga and chaetotaxy of abdominal tergum VI follows Pomorski (1990); chaetotaxy of labium is based on Fjellberg’s study (1999). Length of claw was measured as a distance from distal margin of pretarsus to the top of claw along its internal side; width of claw was measured as width of pretarsus in conjunction with tibiotarsus. Abbreviations. Ant.—antennal segment, Th.—thoracic tergum, Abd.—abdominal tergum, Tita—tibiotarsus, AOIII—antennal organ of the third antennal segment, ms—microsensilum, ORF—open reading frame, PAO— postantennal organ, pso—pseudocellus, psx—parapseudocellus, VT—ventral tube, IBE FS UPJS—Institute of Biology and Ecology, Faculty of Science, P. J. Šafárik University, Košice, Slovakia.

186 · Zootaxa 4350 (1) © 2017 Magnolia Press

PARIMUCHOVÁ ET AL.

Molecular analyses. Specimens were collected and stored in pure ethanol at 4°C until analyzed. Total DNA was extracted with the Thermo Scientific GeneJET PCR Purification Kit as advised by the manufacturer. Polymerase chain reaction (PCR) (Saiki et al. 1988) was carried out using a 12.5 μL reaction volume (1 μL not quantified template DNA, 10x PCR Buffer (Top Bio), 10.5 mM of dNTP mix, 5 μM of each primer and 0.125 units of Taq (Top Bio) or 0.05 units of Ex Taq (Takara) polymerase) on GenePro (Bioer Co., Ltd, China) thermal cycler. A (568 bp) fragment of COI gene was amplified using the universal primers LCO1490 (5´-ggt caacaaatcataaagatattg g-3´) and HCO2198 (5´-taa actgggtgaccaaaaaat ca-3´; Folmer et al. 1994) under following thermal cycling conditions: 94°C for 1 min followed by 35 cycles of (94°C for 30 sec, 45°C for 40 sec and 72°C for 1 min) followed by 2 min in 72°C. After verification on agarose electrophoresis, reaction products were purified using Exo I -FastAP (Thermo Fisher Scientific). Sequencing of purified products was performed using HCO2198 at the GATC Biotech, Germany using the Sanger method. Sequences were manually edited and trimmed of unreadable short stretches (ca 30 bp at the 5’ and 3’ ends) with Bioedit v.7 (Hall 1999). Since none of them contained stop codons or indels and ORF was correct, all were considered to be true mitochondrial and not nuclear copies. Sequences were aligned with the MEGA v.6 (Tamura et al. 2013) software by Muscle (Codons) algorithm using the Invertebrate Mitochondrial Gene Code and default parameters. All the sequences were verified as being consistent with collembolan DNA using the GenBank BLASTn search. Standard DNA barcoding distance analysis was conducted using the corrected Kimura 2 parameter model (Kimura 1980). Sequences of five Protaphorura species with more than two sequences available were obtained from GenBank (see Appendix). Pairwise nucleotide divergences within and between Protaphorura congeneric species were calculated (Table 2). The distance tree was inferred using the Neighbor-Joining method (Saitou & Nei 1987) with robustness of the nodes evaluated by bootstrap (1,000 replications). All new sequences were submitted to GenBank (accession numbers: KY781190, KY781191, KY781192, KY781193, KY781194, KY781195).

Protaphorura cykini sp. nov. Parimuchová & Kováč (Figs. 2–16) Diagnosis. PAO with 65–71 simple vesicles. Pso formula dorsally: (2)32/022/33343, ventrally: 1/000/00000. Subcoxae 1 with 1,1,1 pso each. Antennae longer than head (Fig. 2). Subapical organite on Ant. IV with two papillae (Fig. 3; 12). VT with 12–15 distal and 2–3 basal chaetae on each side. Type material. Holotype (female) and 12 paratypes (4 females, 8 males): Russia, Siberia, Irkutsk region, Pribaikalsky National Park, Primorsky Range, Okhotnichya Cave, collected by hand on mouldy excrements of pika (Ochotona sp.) (Fig.1a, site 1), 12.vi. 2016, leg. O.I. Kadebskaya and A.V. Osintsev. Holotype and paratypes herein designated are deposited in IBE FS UPJS, Košice, Slovakia. Other material. Russia, Siberia Irkutsk region, Pribaikalsky National Park, Primorsky Range, Okhotnichya Cave, 3 females and 1 male collected by hand on excrements of pika (Ochotona sp.), (Fig.1a site 2) 4.x.2014, leg. O.I. Kadebskaya and P. Holúbek. Other material from type locality deposited in IBE FS UPJS, Košice, Slovakia. Description. Body length 4.3–4.7 mm in males, 5.2–5.6 mm in females, body shape typical of genus (Fig. 1c), with anal spines on distinct papillae. Colour white in ethyl alcohol. Granulation fine and uniform, coarser around pseudocelli (Fig. 9). Antennae slightly longer than head (head/ antenna ratio 1:1.1), area antennalis well marked (Fig. 2). Ant. I with 14–16 chaetae. AOIII with 5 guard chaetae, 5 papillae, 2 smooth sensory rods shorter than papillae and 2 morel-like sensory clubs of equal size. Microsensillum in ventro-lateral position, at level of last guard chaeta. Subapical organite of Ant. IV placed in cavity protected by two granulated papillae, one slightly forward the organite and the second behind it (Fig. 3; 12). Ms on Ant. IV in ventro-lateral position, in 1/2 of segment length. PAO with 65–71 simple vesicles (Fig. 14). Labial palp of type A with 8 proximal chaetae. Basomedian field of labium with 4+4 chaetae, 9–12 postlabial chaetae with left/right asymmetry (Fig. 6). Maxillary outer lobe with simple palp, 1 basal and 2 sublobal chaetae. Pso formula dorsally: (2)32/022/33343, ventrally: 1/000/00000. Subcoxae1 I–III with 1 pso each, psx absent. Ventral psx formula: 0/000/?111(2)00.

A NEW TROGLOBIOTIC PROTAPHORURA FROM SIBERIA

Zootaxa 4350 (1) © 2017 Magnolia Press ·

187

FIGURES 2–10. Protaphorura cykini sp. nov. 2, head and Th. I. (scale 50 μm). 3, subapical organite on Ant. IV with 2 cuticular papillae (scale 20 μm). 4, Abd.II tergum, right side (scale 50 μm). 5, Tita of leg II, external side, lateral view (scale 50 μm). 6, sublobal chaetae (scale 100 μm). 7, Abd. IV tergum, right side (scale 50 μm). 8, Abd.V tergum, left side (scale 100 μm). 9, granulation around pseudocelli and macrochaetae (scale 50 μm). 10, furca remnant (scale 50 μm).

Dorsal chaetotaxy more-less symmetrical with macrochaetae well differentiated. Th. I with 18–22 chaetae on each side. Chaetae s on Abd. I–III short, s´ missing (Fig. 4). Abd. IV as in Fig. 7. Abd. V always with chaeta s between pso a–b, ratio of chaetae M/s=7/5 (Fig. 8). Straight lines passing through the bases of K and K’ prespinal chaetae slightly convergent (Fig. 11).


PARIMUCHOVÁ ET AL.

Furca remnant with distinct, arched cuticular fold with 2+2 chaetae in two rows (1+1 placed on fold, 1+1 posterior to fold) (Fig. 16), arrangement of manubrial chaetae as in Fig. 10. Male ventral organ absent even in males with genital plate well developed (Fig. 15). VT with 12–15 distal and 2–3 basal chaetae on each side. Legs. Tita of all legs with 11 chaetae in distal verticil (A+T), 7 chaetae and chaeta M in verticil B and 7 chaetae in verticil C. Two proximal chaetae Y (placed above verticil C) present (Fig. 5). Claw without lateral and inner teeth (Fig. 13). Ratio length/ width of claw ~2.2. Etymology. The species is named after R. A. Cykin, an important personality in speleology of the Siberia. Biology. Specimens of P. cykini sp. nov. were discovered in Okhotnichya Cave, aggregated on mouldy pika´s excrements (Ochotona sp.), approximately 80 m from the entrance. The cave is mesotrophic with organic material (needles, leaf litter) accumulated near the entrance (Fig. 1b), and deer´s and elk´s bones and excrements of small mammals (Ochotona sp. and Microtus sp.) dispersed across the whole cave system. Fungi colonizing organic remnants and excrements probably serve as important food source for collembolans occupying the cave (Fig. 1d). P. cykini sp. nov. displays troglomorphic traits, i.e. elongated antennae and claws and larger body compared to other congeners. It lives permanently in cold thermal conditions; in June 2016 the cave air temperature measured at collecting sites ranged from +1.1 to +1.9 °C and the floor ice was present on the bottom of the cave passages.

FIGURES 11–16. Protaphorura cykini sp. nov. 11, Abd. VI. 12, subapical organite on Ant. IV (only 1 of 2 papillae is seen). 13, claw of leg III. 14, PAO. 15, male genital plate.16, furcal cuticular fold.



189

FIGURE 17. Unrooted Neighbor-Joining tree of mitochondrial COI gene of seven Protaphorura species (Kimura 2-parameter method, 1000 replications, bootstrap values shown next to the branches).

Along with the new species, the collembolan Oligaphorura schoetti was collected in Okhotnichya Cave in the same period. Distribution. Known only from the type locality: Okhotnichya Cave, Primorski Range, Irkutsk Region, Siberia, Russia. Discussion. The new species possess a unique combination of diagnostic features (Table 1). With the body length from 4.3 to 5.6 mm, long PAO consisting of 65–71 simple vesicles and subapical organite of Ant. IV surrounded by two cuticular papillae, P. cykini sp.nov. is a well-defined species. Subapical organite protected by the papillae is characteristic of P. tschernovi from the Western Taimyr, Siberia, P. borealis from eastern Europe (Babenko & Kaprus´ 2014), and P. nikolai from the Primorsky Krai, Far East (Kaprus´ et al. 2016). In contrast to P. cykini, these three species have body length < 3 mm and psx on ventral side of the head. P. borealis and P. nikolai differ from the new species also in number of pso on subcoxae 1 of all legs (Table 1). Presence of 60 or more simple vesicles in PAO was documented mostly in large species such as P. macrodentata, P. borealis, P. armata multituberculata and also in P. aksuensis, the taxonomical status of the last two species being unclear. P. janosik is similar to new species in lacking psx on ventral side of head but differ in number of chaetae on Th. I tergum and in lack of cuticular papillae in subapical organite on Ant. IV. Only few Palaearctic Protaphorura species have been described from caves, namely P. stalagmitorum (Absolon, 1900); P. armata multituberculata (Stach, 1934); P. teres (Yosii, 1956); P. ombrophila (Stach, 1960); P. triparallata (Gisin, 1960); P. dallaii (Nosek & Paoletti, 1981); P. brevispinata (Yosii, 1966); P. septempapillata (Palissa, 1986); P. janosik Weiner, 1990; P. aconae Arbea & Jordana, 1994 and P. zlatiborensis Lučić, Ćurčić, Pavković-Lučić & Tomić, 2008. However, the first six species are considered as species dubia due to insufficient morphology data in their original descriptions (Parimuchová & Kováč 2016).


PARIMUCHOVÁ ET AL.



191

32/022/33343 32(3)/022/33343(2)

P. sayanica Kaprus´, Weiner &Paśnik 2016 2.7–2.9 1.8–2.3

4.3–5.6

P. tschernovi (Martynova, 1976) sensu Babenko &Kaprus´ (2014)

P.cykini sp.nov. 1/-

1/-

1/-

1/-

1/000/0001

1/-

0/-

?

?

Ventral pso

* based on recent data (Parimuchová et al, 2017) of material from the type locality

(2)32/022/33343

33/022/33342

1.5–1.7

P. nikolai Kaprus´, Weiner & Paśnik 2016

2.4–3.4

P.macrodentata (Hammer, 1953) sensu Babenko & Fjellberg (2016) 32/022/33342

33/022–3/33343

2.9–4.3

32/022/33343

P.janosik Weiner, 1990*

4.2

P. armata multituberculata (Stach, 1934)

33/022/33333

32/022/33333

1.6

P. aksuensis (Martynova, 1972)

Dorsal pso

P. borealis (Martynova, 1973, in Martynova 2.5–2.9 et al. 1973) sensu Babenko & Kaprus´ (2014)

Length (mm)

Species

65–71

30–42

1/000/111101m

0/000/?111(2)00

41–48

1/000/111101m

29–36

50–60

1/000/111001m

1/000/100000

36–58

40–65

1/000/111101m

0/000/0(1)0(1)0(1)000

54–62

90

+

+

-

+

-

-

+

?

?

PAO SOp vesicles

?

?

Psx

18–22

15–18

18–21

11–12

25–30

14–17

14–18

?

?

Th. I

111 pso + 000 psx

111pso + 111 psx

111pso + 111 psx

100pso + 000 psx

111pso + 111 psx

111 pso + 000 psx

000 pso + 111 psx

?

?

S-cox1

Primorski range, Siberia

Western Taimyr, Siberia

southern Siberia

Primorsky Krai, Far East

Canada, Chukotka Peninsula

Western and Eastern Carpathians

Eastern Europe to Alaska

Westphalia, Germany

Kyrgyzstan

Distribution

TABLE 1. Differential characters of Protaphorura species with > 30 vesicles in PAO and 2 pseudocelli on Th. II-III terga (SOp—papillae in subapical organite, S-cox1—number of pso and psx on subcoxae1)

Totally 22 troglobiotic collembolan species have been registered in southern karst regions of Russia (Turbanov et al. 2016a,b,c), most of them distributionally limited to Crimea and Caucasus Mts that undoubtedly represent diversity hotspots of the cave fauna. The both regions are centered along the latitudinal band 42–45° N, corresponding by geographic position to the mid-latitude biodiversity ridge in Europe defined by Culver et al. (2006). Considering the number of biospeleologically surveyed caves in Russia, diversity of the cave-adapted Collembola in this country is still underestimated. Although, we cannot expect much addition by the further explorations in Siberian caves, since biodiversity of this vast region was repeatedly diminished during the cold Pleistocene glacial periods. The recent cave adapted fauna of Siberia probably evolved from the ancestors that occupied the soil or superficial subterranean habitats during the warmer Pleistocene periods. Accordingly, we consider the new species a glacial relict, supported by the morphological traits that do not show marked troglomorphisms. Molecular data. Obtained sequences are part of the COI gene at the 5´ end corresponding to the position from 1564 to 2131 of the Drosophila yakuba mitochondrion (KF824900.1). We performed distance analysis by the Neighbor-joining distance tree (Fig. 17) based on the barcode sequences of the new species, P. borinensis Parimuchová & Kováč, 2016 and the species available in GenBank. Results strongly support the species differentiation. All the corresponding clusters have the highest bootstrap support, showing thus clear separation between the congeners (Hogg & Hebert 2004). Clustering of species analysed follows neither their geographic distribution nor morphological characteristics (Table 2). For example, interspecific K2P distances suggest that oligopseudocellar P. genheensis is the closest relative of P. cykini sp.nov. with the smallest genetic distance of 0.157 between the species involved in the analysis. P. janosik and P. borinensis, both from the Western-Carpathian caves, represent genetically well-separated species in spite of the low morphological differentiation (Parimuchová & Kováč 2016). TABLE 2. Inter- and intraspecific sequence divergences of mitochondrial COI gene in Protaphorura (K2P distances), n – number of sequences, standard errors in italics interspecific 1

intraspecific

n

2

3

4

5

6

0.017

0.019

0.015

0.015

0.017

0.018

0.017

0.004

5

0.017

0.016

0.019

0.017

0.018

0.002

0.001

6

0.018

0.019

0.018

0.017

0.011

0.003

2

0.016

0.017

0.018

0.014

0.003

5

0.017

0.019

0.001

0.001

6

0.017

0.008

0.003

3

-

-

1

1

P. janosik

2

P. cykini sp.nov.

0.180

3

P. aurantiaca

0.184

0.192

4

P. genheensis

0.148

0.157

0.170

5

P. changbaiensis

0.142

0.201

0.193

0.170

6

P. maoerensis

0.166

0.180

0.192

0.171

0.178

7

P. borinensis

0.194

0.193

0.170

0.183

0.194

0.169

Acknowledgements We are grateful to P. Holúbek (Liptovský Mikuláš, Slovakia) and A.V. Osintsev (Irkutsk, Russia) for their help during collection the specimens of the new species in Okhotnichya Cave. We are thankful to both reviewers for their constructive comments to the earlier manuscript version.

References Absolon, K. (1900) Vorläufige Mittheilung über die Aphoruriden aus den Höhlen des mährischen Karstes. Zoologischer Anzeiger, 23, 406–414. Absolon, K. (1901) Weitere Nachricht über europäische Höhlencollembolen und über die Gattung Aphorura A. D. MacG. Zoologischer Anzeiger, 24, 385–389. Arbea, J.I. & Jordana, R. (1994) Cuatro nuevas especies de la familia Onychiuridae de la Península Ibérica (Collembola, Poduromorpha). Publicaciones de Biología de la Universidad de Navarra, Serie Zoológica, 24, 39–59.


PARIMUCHOVÁ ET AL.

Babenko, A.B. (2007) Collembolan fauna of the Turukhansk Territory. Russian Entomological Journal, 16 (4), 361–383. Babenko, A.B. & Kaprus´, I. (2014) Species of the genus Protaphorura (Collembola: Onychiuridae) described on material of Yu.I. Chernov from Western Taimyr. Entomological Review, 94 (4), 581–601. https://doi.org/10.1134/S0013873814040113 Bazarova, E.P., Gutareva, O.S., Kononov, A.M., Ushchapovskaya, Z.F., Nartova, N.V. & Osintsev, A.V. (2011) Minerals of the Okhotnichya Cave (Baikal Region, Irkutsk oblast). Speleologia i karstologia, 7, 5–14. [in Russian] Bazarova, E.P., Kononov, A.M., Gutareva, O.S., Nartova, N.V. (2014) Specific characteristics of cryogenic mineral formations of Okhotnichya Cave in Pre-Baikal Area (Irkutsk Region). Earth´s Cryosphere, 18 (3), 62–71. Culver, D.C., Deharveng, L., Bedos, A., Lewis, J.J., Madden, M., Reddell, J.R., Sket, B., Trontelj, P. & White, D. (2006) The mid-latitude biodiversity ridge in terrestrial cave fauna. Ecography, 29, 120–128. https://doi.org/10.1111/j.2005.0906-7590.04435.x Deharveng, L. (1983) Morphologie évolutive des Collemboles Neanurinae en particulier de la lignée Neanurienne. Travaux du Laboratoire d´Ecobiologie des Arthropodes Édaphiques Toulouse, 4 (2), 1–63. Fjellberg, A. (1999) The labial palp in Collembola. Zoologischer Anzeiger, 237, 309–330. Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994) DNA primers for the amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3, 294–299. Gisin, H. (1960) Collembolenfauna Europas. Museum d'Histoire Naturelle, Genève, 312 pp. Gulgenova, A. & Potapov, M. (2013) New ‘oligopseudocellar’ Protaphorura species (Collembola: Onychiuridae) from East Palaearctic. Soil Organisms, 85 (3), 203–213. Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95–98. Hammer, M. (1953) Investigations on the microfauna of Northern Canada. Part II. Collembola. Acta Arctica, 6, 1–108. Hebert, P.D.N., Cywinska, A., Ball, S.L. & de Waard, J.R., (2003a) Biological identifications through DNA barcodes. Proceedings of the Royal Society, Biological Sciences, 270 (1512), 313–321. https://doi.org/10.1098/rspb.2002.2218 Hebert, P.D.N., Sujeevan, R. & deWaard, J.R. (2003b) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London, 270 (Supplement), 96–99. https://doi.org/10.1098/rsbl.2003.0025 Hogg, I.D. & Hebert, P.D.N. (2004) Biological identification of springtails (Hexapoda: Collembola) from the Canadian Arctic, using mitochondrial DNA barcodes. Canadian Journal of Zoology, 82, 749–754. https://doi.org/10.1139/z04-041 Jordana, R., Arbea, J.I., Simón, C. & Luciáñez, M.J. (1997) Collembola, Poduromorpha. Fauna Ibérica, 8, 1–807. [Museo Nacional de Ciencias Naturales, CSIC Madrid] Juberthie, C., Sidorov, D., Decu, V., Mikhaljova, E. & Semenchenko, K. (2016) Subterranean fauna from Siberia and Russian Far East. Encyclopaedia Biospeologica (Siberia-Far East special Issue). Ecologica Montenegrina, 7, 507–529. Kaprus´, I. & Pomorski, R.J. (2008) Review of the Palaearctic Protaphorura Absolon, 1901 species of octopunctata group (Collembola: Onychiuridae). Annales Zoologici, 58 (4), 667–688. https://doi.org/10.3161/000345408X396602 Kaprus´, I., Weiner, W.M. & Paśnik, G. (2016) Collembola of the genus Protaphorura Absolon, 1901 (Onychiuridae) in the Eastern Palearctic: morphology, distribution, identification key. ZooKeys, 620, 119–150. https://doi.org/10.3897/zookeys.620.9372 Kimura, M. (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16, 111–120. https://doi.org/10.1007/BF01731581 Kniss, V.A. (1991) Sur la faune cavernicole du Parc national de Baikal (U.R.S.S.). Mémoires de Biospéologie, 18, 301–303. Kniss, V.A. (2001) Cave fauna of Russia and adjacent countries - history of study, composition and distribution. Pensoft Publishers, Ufa, 238 pp. [in Russian] Lie-Pettersen, O.J. (1896) Norges Collembola, Fortagnelse over de i Norge hidtie observada Arten. Bergens Museums Aarbog, 8, 3–26. Lučić, L.R., Ćurčić, B.P.M., Pavković-Lučić, S.B. & Tomić, V.T. (2008) Protaphorura zlatiborensis, a new cave-dwelling species (Onychiuridae, Collembola) from the Balkan Peninsula (Serbia). Archives of Biological Sciences, 60 (4), 661–665. https://doi.org/10.2298/ABS0804661L Martynova, E.F. (1972) Springtails (Collembola) inhabiting the outlets of subterranean water in the Kirgiz and Uzbek SSR. Trudy Zoologicheskogo Instituta, Leningrad, 51, 146–150. [in Russian] Martynova, E.F. (1976) Species of the genus Onychiurus Gervais, 1841 (Collembola, Onychiuridae) of the north and north-east Asia. In: Cherepanov, A.I. (Ed.), Novye i maloizvestnye vidy fauny Sibiri. Novosti Fauny Sibiri. Vol. 10. Nauka, Sibirskoe Otdelenie, Novosibirsk, pp. 5–44. [in Russian] Martynova, E.F., Gorodkov, K.B. & Tshelnokov, V.G. (1973) Springtails (Collembola) from Wrangel Island. Entomologicheskoe Obozrenie, 52 (1), 76–93. [in Russian] Nosek, J. & Paoletti, M.G. (1981) A new cave species of Collembola, Onychiurus (Protaphorura) dallaii n. sp. Bollettino della



193

Società Entomologica Italiana, 113 (8–10), 136–138. Osintsev, A.V. (2010) Large caves of the Baikal region – the newest research. Speleologia i speleostologia: razvitie i vzaimodejstvie nauk. Sbornik materialov mezhdunarodnoj nauchno-prakticheskoj konferencii. Naberezhnie Chelny, 2010, 99–101. [in Russian] Palissa, A. (1986) Onychiurus (Protaphorura) septempapillatus n. sp., ein neuer Höhlencollembole aus der Salzgrabenhöhle im Berchtesgadener Land (Collembola, Onychiuridae). Deutsche Entomologische Zeitschrift, 33, 227–231. https://doi.org/ 10.1002/mmnd.4800330314 Parimuchová, A. & Kováč, Ľ. (2016) A new cave species of the genus Protaphorura Absolon, 1901 (Collembola, Onychiuridae) from the Western Carpathians (Slovakia) with critical comments to the Palaearctic representatives of the genus. Zootaxa, 4098 (2), 254–272. https://doi.org/10.11646/zootaxa.4098.2.3 Parimuchová A., Kováč Ľ., Žurovcová M., Miklisová D. & Paučulová L. (2017) A glacial relict in the Carpathian caves – population variability or a species complex? Arthropod Systematics & Phylogeny (in press). Pomorski, R.J. (1990) Morphological-systematic studies on the variability of pseudocelli and some morphological characters in Onychiurus of the “armatus-group” (Collembola, Onychiuridae). Part II. On synonyms within the “armatus-group”, with special reference to diagnostic characters. Annales Zoologici, 43, 535–576. Porco, D., Bedos, A. & Deharveng, L. (2010) Description and DNA barcoding assessment of the new species Deutonura gibbosa (Collembola: Neanuridae: Neanurinae), a common springtail of Alps and Jura. Zootaxa, 2639, 59–68. Rusek, J. (1975) Eine Präparationstechnik für Springschwänze und ähnliche Gliederfüsser. Mikrokosmos, 12, 376–381. Saiki, R.K., Gelfand, D.H. & Stoffel, S. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 239, 150–160. https://doi.org/10.1126/science.2448875 Saitou, N. & Nei, M. (1987) The neighbor-joining method—a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4, 406–425. Stach, J. (1934) Die in den Höhlen Europas vorkommenden Arten der Gattung Onychiurus Gervais. Annales Musei Zoologici Polonici, 10, 111–222. Stach, J. (1960) Materialien zur Kenntnis der Collembolen Fauna Afghanistans. II Teil. Acta Zoologica Cracoviensia, 5 (12), 507–581. Stevens, M.I., Fjellberg, A., Greenslade, P., Hogg, I.D. & Sunnucks, P. (2006) Redescription of the Antarctic springtail Desoria klovstadi using morphological and molecular evidence. Polar Biology, 29, 820–830. https://doi.org/10.1007/s00300-006-0120-y Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution, 12, 2725–2729. https://doi.org/10.1093/molbev/mst197 Turbanov, I.S., Palatov, D.M. & Golovatch, S.I. (2016a) The state of the art of biospeleology in Russia and other countries of the former Soviet Union: a review of the cave (endogean) invertebrate fauna. 1. Introduction—Crustacea. Entomological Review, 96 (7), 926–963. https://doi.org/10.1134/S0013873816070162 Turbanov, I.S., Palatov, D.M. & Golovatch, S.I. (2016b) The state of the art of biospeleology in Russia and other countries of the former Soviet Union: a review of the cave (endogean) invertebrate fauna. 2. Arachnida—Acknowledgments. Entomological Review, 96 (9), 1297–1333. https://doi.org/10.1134/S0013873816090116 Turbanov, I.S., Palatov, D.M. & Golovatch, S.I. (2016c) The state of the art of biospeleology in Russia and other countries of the former Soviet Union: a review of the cave (endogean) invertebrate fauna. 3. References. Entomological Review, 96 (9), 1334–1358. https://doi.org/10.1134/S0013873816090128 Weiner, W.M. (1990) Onychiuridae of Poland. New species of Protaphorura Absolon, 1901 from the Tatra Mts. Acta Zoologica Cracoviensia, 33 (18), 453–457. Weiner, W.M. (1996) Generic revision of Onychiurinae (Collembola: Onychiuridae) with cladistic analysis. Annales de la Société Entomologique de France, New Series, 32 (2), 163–200. Yosii, R. (1956) Höhlencollembolen Japans II. Japanese Journal of Zoology, 11 (5), 609–627. Yosii, R. (1966) On some Collembola of Afghanistan, India and Ceylon, collected by the KUPHE-Expedition, 1960. Results of the Kyoto University Scientific Expedition to the Karakoram and Hindukush, 8, 333–405.


PARIMUCHOVÁ ET AL.

APPENDIX Protaphorura species from GenBank database used for nucleotide divergences of the mitochondrial COI gene species

GenBank Accesion No.

P. genheensis KU508240.1 KU508237.1 KU508232.1 KU508157.1 KU508156.1 P. changbaiensis KU508135.1 KU508134.1 KU508130.1 KU508129.1 KU508128.1 KU508127.1 P. maoerensis KU508169.1 KU508168.1 KU508167.1 P. aurantiaca KT808371.1 KT808372.1 KT808373.1 P. janosik KY513473 KY513493 KY513510 KY513526 KY513546



195