Comparison of Some Virulence Factors and Antimicrobial Resistance ...

N. Egypt. J. Microbiol. Vol. 37, January, 2014.

1

COMPARISON OF SOME VIRULENCE FACTORS AND ANTIMICROBIAL RESISTANCE ASSOCIATED GENES OF BIOFILM AND NON-BIOFILM PRODUCING PSEUDOMONAS AERUGINOSA BY Ramadan Hassan, Rasha Barwa and Heba Adel*

FROM Microbiology Department, Faculty of Pharmacy, Mansoura University, Egypt. *Talkha Central Hospital, Mansoura, Egypt.

ABSTRACT Pseudomonas aeruginosa produces multiple virulence factors that have been engaged in pathogenesis. The aim of this study was to compare between some virulence factors and antimicrobial resistance associated genes of biofilm and nonbiofilm producing Pseudomonas aeruginosa isolated from Mansoura Hospitals. In this study, a total of 50 strains of Pseudomonas aeruginosa were isolated from 150 clinical specimens collected from Mansoura Hospitals. The phenotypic detection of biofilm revealed that thirty two isolates (64%) were considered as positive biofilm producers. The largest numbers of positive samples were from urine samples. The production of exopolysaccharides, such as PelA was required for Ps. aeruginosa biofilm formation. Detection of pelA gene revealed that it was harbored by chromosomal DNA of all biofilm producing isolates. Associations were assessed between biofilm production and virulence associated genes including Exotoxin A, lasB elastase and type III secretion system (exoS and exoY). Investigation of virulence factors associated genes revealed that 81.25%, 69.23%, 69.7 % and 91.6% of the isolates harboring toxA, lasB, exoS and exoY genes respectively were biofilm producers. Regarding resistance associated genes, 67.44% of AmpC producing isolates were biofilm producers. While investigation of the tripartite efflux system MexAB–OprM reveled that it was present only in eight Ps. aeruginosa isolates and all of them were biofilm producers. The present study confirmed that antimicrobial resistance and virulence associated genes were more prominent in biofilm-producing Ps. aeruginosa than in non-biofilm-producers.

INTRODUCTION Pseudomonas aeruginosa is a Gram negative opportunistic pathogen often embroiled in nosocomial infections and causes many severe and often fatal infections mostly affecting immunocompromised patients (Meyer et al., 1997). The bacterium’s intrinsic and acquired resistance to several structurally unrelated antibiotics is due to several adaptations, including active efflux systems, reduced cell wall permeability, plasmid acquisition, production of various enzymes or by biofilm formation (Deplano et al., 2005). The three most intensely studied chromosomally encoded resistance mechanisms in Ps. aeruginosa are the AmpC cephalosporinase, the OprD outer membrane porin, and the multidrug efflux pumps (Lister et al., 2009).

2


Imported resistance to the β-lactams involves the production of extendedspectrum beta lactamase (ESBL), AmpC and metallo β-lactamases (MBL). ESBLs are typically inhibitor-susceptible beta-lactamases that hydrolyze penicillins, cephalosporins and aztreonam and are encoded by mobile genes. AmpC β-lactamases preferentially hydrolyze cephalosporins and cephamycins and resist inhibition by clavulanate, sulbactam and tazobactam. MBLs hydrolyze carbapenems and other betalactams. Resistance to carbapenems is of great concern as these are considered to be antibiotics of last resort to combat infections by multidrug-resistant bacteria, especially in intensive care units and burn wards (Kumar et al., 2012). Active efflux is an important non-enzymic mechanism that contributes to the development of multiple resistances to all strategic antipseudomonal antibiotics and is mediated by four genetically different three-component efflux systems that belong to the resistance–nodulation–division (RND) family: MexA–MexB–OprM, MexC– MexD–OprJ, MexE–MexF–OprN and MexX–MexY–OprM. The first component is a protein located in the cytoplasmic membrane (MexB, MexD, MexF and MexY) that operates as an energy dependent pump with wide substrate specificity. The second component is a gated outer membrane protein (OprM, OprJ, OprN and OprM). The third protein (MexA, MexC, MexE and MexX) is located in the periplasmic space and links the other two (Strateva and Yordanov, 2009). Pathogenesis involves production of both extracellular and cell associated virulence factors (Wagner et al., 2008). The virulence of Ps. aeruginosa is multifactorial and has been attributed to cell-associated factors like alginate, lipopolysaccharide (LPS), flagellum, pilus and non-pilus adhesins as well as with exoenzymes or secretory virulence factors like protease, elastase, phopholipase, pyocyanin, exotoxin A, exoenzyme S, hemolysins (rhamnolipids) and siderophores (Girard and Bloemberg, 2008). In addition to elaboration of virulence factors, Ps. aeruginosa has a tendency to form biofilms. These Biofilms are resistant to antimicrobial agents as well as to host defense mechanisms and hence are difficult to eradicate. Biofilms contribute towards pathogenicity of Ps. aeruginosa as these often lead to persistent and recurrent infections (Boles et al., 2004). Ps. aeruginosa secretes several proteases; including lasB elastase, lasA elastase and alkaline protease. They are known to degrade a large variety of tissue components such as proteinaceous elements of connective tissue and cleave the cell surface receptors on neutrophils (Lomholt et al., 2001). LasB elastase is a zinc metalloprotease that acts on a number of proteins including elastin. LasB elastase is highly efficient, with a proteolytic activity approximately 10 times that of Ps. aeruginosa alkaline protease and an activity toward casein approximately four times that of trypsin (Galloway, 1991). Exotoxin A is a major virulence factor of Ps. aeruginosa. This toxin binds to a specific receptor on animal cells, allowing endocytosis of the toxin. The toxin then blocks protein synthesis by ADP ribosylation of elongation factor 2, thereby triggering cell death (Morlon-Guyot et al., 2009) The type III secretion system (TTSS) of Ps. aeruginosa is a complex pilus-like structure allowing the translocation of effector proteins from the bacteria, across the bacterial membranes and into the eukaryotic cytoplasm through a needle-like appendage forming a pore in the eukaryotic membrane. There are four known toxins, variably expressed in different strains and isolates of Ps. aeruginosa: ExoY, ExoS, ExoT and ExoU (Kipnis et al., 2006).


3

Biofilm formation in Ps. aeruginosa is a highly regulated process that proceeds through a number of distinct stages. This development is controlled by a wide range of factors, of which two-component systems (TCSs) regulate the switch from a motile to a sessile bacterial lifestyle, either via the production of extracellular appendages or by the production of exopolysaccharides. Extracellular appendages, such as flagella, type IV pili and cup fimbriae are often involved in the initial attachment of bacteria to a surface. In Ps. aeruginosa, many of these surface structures are regulated by TCSs and some systems regulate more than one type of appendage. Furthermore, the production of exopolysaccharides, such as Pel and Psl, is required for Ps. aeruginosa biofilm formation (Mikkelsen et al., 2011). The polysaccharide Psl is rich in mannose and galactose and is involved in initial attachment and mature biofilm formation. Psl is produced during planktonic growth, mediating attachment to surfaces and contributing to microcolony formation. In mature biofilms, Psl is associated with the caps of mushroom-like microcolonies, forming a peripheral meshwork covering the cap region (Ma et al., 2009). A glucose-rich, cellulose-like polymer Pel is essential for the formation of a pellicle at the air-liquid interface (Friedman and Kolter, 2004). Increased Pel production has also been associated with the wrinkled colony phenotype (Ghafoor et al., 2011). It has recently been shown that Pel plays a role in cell-to-cell interactions in Ps. aeruginosa PA14 biofilms, providing a structural scaffold for the community at early stages of biofilm formation (Colvin et al., 2011). In the present investigation, we screened the biofilm production in 50 Ps. aeruginosa isolates and determined their susceptibility pattern against different antimicrobial agents then the genotype then the genotype (Tox A, lasB, ExoS, ExoY, AmpC, MexA, MexB and OprM) were determined and compared between biofilm and non-biofilm producing Pseudomonas aeruginosa isolated from Mansoura Hospitals

MATERIALS AND METHODS I- Clinical isolates: A total of 150 isolates were collected from Mansoura Hospitals. The specimens were immediately processed and were identified according to Govan (1996). Fifty isolates were identified as Ps. aeruginosa and they were selected for study. These isolates were recovered from urine (22 isolates), wound (14 isolates), burn (8 isolates), sputum (6 isolates) of patients in Mansoura Hospitals, Mansoura, Dakahlia Governorate, Egypt. II- Antimicrobial susceptibility testing: All isolates were screened for susceptibility to twelve antimicrobial discs namely; amikacin (30 µg), gentamicin (10 µg), tobramicin (10 µg) carbencillin (100 µg), cloxacillin (30 µg), piperacillin (100 µg), ceftriaxone (30 µg), cefotaxime (30 µg), ceftazidime (30 µg), imipenem (10 µg) levofloxacin (5 µg) and ciprofloxacin (5 µg) using the standard disc diffusion method of National Committee for Clinical Laboratory Standards (NCCLS) (2003) All discs were supplied from Oxoid Company.

4


III- Phenotypic test for detection of biofilm: All isolates were screened for biofilm formation as described by Mathur et al.,( 2006). A loopful of test organisms was inoculated in 10 ml of trypticase soy broth with 1% glucose in test tubes. The tubes were incubated at 37°C for 24 h. After incubation, tubes were decanted and washed with phosphate buffer saline (pH 7.4) and dried. Tubes were then stained with crystal violet (1%). Excess stain was washed with deionized water. Tubes were dried in inverted position. Biofilm formation was considered positive when a visible film lined the wall and the bottom of the tube. The experiment was performed in triplicate. IV- Genotypic detection of some virulence and resistance associated genes: 1) Genomic DNA extraction: The genomic DNA of Ps. aeruginosa isolates were prepared using GeneJETTM Genomic DNA Purification Kit K0721, K0722 supplied by Fermentas, according to the manufacturer's instructions DNA was eluted by adding 200 µl of elution buffer (10 mM Tris-C1, pH 9.0, 0.5 Mm EDTA) and visualized by electrophoresis on horizontal gels containing 0.8 % agarose. 2)

PCR analysis of biofilm and some virulence factors associated genes (Anke et al., 2013):

Biofilm associated gene (pelA) and virulence factors associated genes (toxA, lasB, exoS and exoY) were detected and amplified using the following reaction: 12.5 µl Dream TaqTM Green PCR Master Mix (2x) (Dream TaqTM DNA polymerase, optimized Dream TaqTM Green buffer, MgCl2, dNTPS, yellow and blue dyes which function as loading dyes when reaction products were analyzed by agarose gel electrophoresis), 1.25 µl of forward primer (10 µM), 1.25 µl of reverse primer (10 µM) (Table 1), 3 µl of the DNA template and 7 µl of nuclease Free water was added for a total of 25 µl per reaction. Negative control reactions (PCR without isolated DNA templates of the bacterial isolates) were performed.

Table (1): Specific amplification primer sets for biofilm and the tested virulence genes among Ps. aeruginosa isolates.

Gene name pelA toxA lasB exoS exoY

Type

Sequence

Fw

5’…AAGAACGGATGGCTGAAGG

Rv Fw Rv Fw

5’…TTCCTCACCTCGGTCTCG 5’…GACAACGCCCTCAGCATCAACAGC 5’…CGCTGGCCCATTCGCTCCAGC 5’…TCATCACCGTCGACATGAAC

Rv

5’…TGCCCTTCTTGATGTCGTAG

Fw Rv Fw Rv

5’…AGGCATTGCCCATGACCTTG 5’…ATACTCTGCTGACCTCGCTC 5’…TGCCATAGAATCCGTCCTC 5’…GATGACCGCCGATTATGAC

Fw: Forward.

Rv: Reverse.

5


The PCR reactions was performed according to the conditions in table (2) Table (2): Conditions for amplification of biofilm and some virulence factors associated genes. Step

Number of cycles

Temprature

Time

1

95 oC

2 min

95 oC

30 sec

65 oC for Tox A

40 sec

1. Initial denaturation: 2. a.denaturation b.annealing

35

o

60 C for other genes 72oC

c.extention 1

3. Final extention:

o

72 C

1 min 5 min

The generated amplicons were visualized on 1.2% agarose gel electrophoresis stained with ethidium bromide and illuminated under UV transilluminator. 3)

PCR analysis of some resistance associated genes (Abdi-Ali et al., 2007):

Resistance associated genes (MexA, MexB, OprM and AmpC) were detected and amplified using the following reaction: 12.5 µL fermentas Dream TaqTM Green PCR Master Mix (2x) (dNTPs, MgCl2 and polymerase), 1 µl of forward primer, 1 µl of reverse primer (10 µM) (Table 3), 1 µl of isolated DNA template and 9.5 µl of nuclease free water were added for a total of 25 µl per reaction. Negative control reactions were performed. Table (3): Specific amplification primer sets for the tested resistance genes among Ps. aeruginosa isolates. Gene name

Type

MexA

Fw

5’…GTGAACGGCATCATCCTCAAGCG

Rv

5’…CTTCTGCTTGACGCCTTCCTGCAA

Fw

5’...CTCGGAGAGTAACTCCGACGG

Rv

5’…CAGGGTGTTGATCGAGAAGCC

Fw

5’…GCAGTACCTGGCGACCGAACAG

Rv

5’…CAGGGTGTTGATCGAGAAGCC

Fw

5’…AGCAAGACCTTCACCGCCAC

Rv

5’…GAGATAGCCGAACAGGCCGA

MexB

OprM

AmpC

Sequence

Fw: Forward.

Rv: Reverse.

6


The PCR reactions was performed according to the conditions in table (4) Table (4): Conditions for amplification of the tested resistance associated genes. Step

1. Initial denaturation:

Number of cycles

Temprature

Time

1

95 oC

5 min

94 oC

30 sec for MexA gene,MexB and OprM

2. a.denaturation

15 sec for AmpC b.annealing

35

c.extention 3. Final extention:

1

50 oC for MexA gene,MexB and OprM

40 sec for MexA gene,MexB and OprM

60oC for AmpC

30 sec for AmpC

72oC

1 min

72oC

5 min

The generated amplicons were visualized on 1.2% agarose gel electrophoresis stained with ethidium bromide and illuminated under UV transilluminator. V- Statistical analysis Statistical analysis was performed using the χ2 test. Differences were considered significant at p ≤ 0.05.

RESULTS A total of 150 clinical isolates were collected from different patients distributed among Mansoura Hospitals, Dakahlia Governorate, Egypt. Fifty isolates were identified as Ps. aeruginosa using standard biotyping methods. Most isolates were obtained from urine (44 %) and wound (28%). It was found that all Ps. aeruginosa isolates were resistant to carbencillin, cefotaxime and cloxacillin. The majority of isolates (74% and 70%) were resistant to ceftriaxone and gentamicin respectively. On the other hand, they showed different levels of resistance to the other 7 antimicrobials. Where 52 % of isolates were resistant to piperacillin, 46% of isolates were resistant to tobramicin, 44% of isolates were resistant to ceftazidime, 38% of isolates were resistant to imipenem, 34% of isolates were resistant to levofloxacin, 20% of isolates were resistant to ciprofloxacin and only 12 % of isolates were resistant to amikacin. The percent resistance to the tested antimicrobial agents among Ps. aeruginosa isolates were illustrated in figure (1).


7

Fig (1): Percent resistance to the tested antimicrobial agents among Ps. aeruginosa isolates. The isolates were investigated for their production of biofilm. It was found that thirty two isolates (64 %) exhibited visible films lined the wall and bottom of the tubes and were considered as positive biofilm producers. The largest number of positive samples were from urine samples (n=14). The frequency of isolation and biofilm production by Ps. aeruginosa isolates from various clinical sources were illustrated in table (5). Table (5): The frequency of isolation and biofilm production by Ps. aeruginosa isolates from various clinical sources. Clinical sources Urine Wound Burn Sputum Total

Total isolates (%) 22 (44%) 14 (28%) 8 (16%) 6 (12%) 50

Biofilm production (%) 14 (63.6%) 7 (50%) 5 (62.5%) 6 (100%) 32 (64%)

PCR detection of pelA gene showed that it was harbored by chromosomal DNA of all biofilm producing isolates with amplicon size of 148 bp as shown in figure (2). Virulence factors associated genes (toxA, lasB, exoS and exoY) were amplified from genomic DNA of all Ps. aeruginosa isolates. PCR detection of toxA reveled that it was harbored by chromosomal DNA of 16 (32%) isolates with amplicon size of 390 bp. Thirteen of these isolates (81.25%) were biofilm producers (figure 3). Regarding lasB gene it was detected in 13 (26%) isolates with amplicon size of 490 bp. Nine of these isolates (69.23%) were biofilm producers (figure 4). For exoY gene, it was harbored by chromosomal DNA of 43 (86%) isolates with amplicon size of 145 bp. Thirty of these isolate (69.7%) were biofilm producers(figure 5). On the other hand exoS was detected only in 12 isolates with amplicon size of 372 bp. Eleven of these isolates (91.6%) were biofilm producers (figure 6). The distribution of virulence-associated genes between biofilm and non biofilm producing Ps. aeruginosa were given in figure (7). Statistical analysis revealed that there was significant increase of all virulence associated genes in biofilm producers than those in the non producers (p < 0.05).

8


bp

148 bp

Fig. (2): Agarose gel electrophoresis of pelA gene amplicones. Lanes from 23 to 38 represent the numbers of the isolates. Lane M was 100 bp DNA marker, where the isolates No. (23, 24 25, 26, 27, 28, 29, 30, 35, 37 and 38) showed positive results while isolates No. (31, 32, 33, 34 and 36)showed negative results. bp

390 bp

Fig. (3): Agarose gel electrophoresis of toxA gene amplicones. Lanes from 11 to 25 represent the numbers of the isolates. Lane M was 100 bp DNA marker, where the isolates No. (11, 12, 13, 14, 15, 17, 21, 22 and 23) showed positive results, while the isolates No. (16, 18, 19, 20, 24 and 25) showed negative results. bp

490 bp

Fig. (4): Agarose gel electrophoresis of lasB gene amplicones. Lanes from 1 to 16 represent the numbers of the isolates. Lane M was 100 bp DNA marker, where the isolates No. (1, 2, 3, 7, 8, 9, 10 and 13) showed positive results, while the isolates No. (4, 5, 6, 11, 12, 14, 15 and 16) showed negative results.

9


bp

145 bp

Fig. (5): Agarose gel electrophoresis of exoY gene amplicones. Lanes from 15 to 35 represent the numbers of the isolates. Lane M was 100 bp DNA marker, where the isolates No. (15, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 34 and 35) showed positive results, while the isolates No. (16 and 33) showed negative results.

bp

372 bp

Fig. (6): Agarose gel electrophoresis of exoS gene amplicones. Lanes from 33 to 48 represent the numbers of the isolates. Lane M was 100 bp DNA marker, where the isolates No. (41, 44, 45, 46, 47 and 48) showed positive results, while the isolates No. (33, 34, 35, 36, 37, 38, 39, 40, 42 and 43) showed negative results.

Fig (7): Distribution of virulence-associated genes between biofilm and non biofilm producing Ps. aeruginosa. Resistance associated genes (MexA, MexB, OprM and AmpC) were amplified from genomic DNA of all Ps. aeruginosa isolates. PCR detection of MexA reveled that it was harbored by chromosomal DNA of 15 (30%) isolates with amplicon size of 1000 bp. Thirteen of these isolates (86.6%) were biofilm producers. Regarding MexB it was detected in 31 (62%) isolates with amplicon size of 1000 bp. Twenty of

10


these isolates (64.52%) were biofilm producers. On the other hand OprM was detected in 27 isolates with amplicon size of 900 bp. Seventeen of these isolates (62.96%) were biofilm producers. Investigation of the tripartite efflux system MexAB–OprM reveled that it was present only in eight Ps. aeruginosa isolates and all of them were biofilm producers (figure 8. A, B and C). Analysis of AmpC gene in Ps. aeruginosa isolates showed that it was harbored by chromosomal DNA of 43 (86%) isolates with amplicon size of 380 bp (figure 9). Twenty nine of these isolates (67.44%) were biofilm producers. The distribution of resistance-associated genes between biofilm and non biofilm producing Ps. aeruginosa are given in (figure 10). Statistical analysis revealed that there was significant increase of all resistance associated genes in biofilm producers than those in the non producers (p < 0.05). bp

1000 bp

bp

1000 bp

bp

900 bp

Fig. (8): Agarose gel electrophoresis of: A)

MexA gene amplicones. Lanes from 5 to 28 represent the numbers of the isolates. Lane M was 100 bp DNA marker, where the isolates No. (15, 17, 20, 21, 23, 27 nd 28) showed positive results, while the isolates No. (5, 6, 16, 18, 19, 22, 24, 25 and 26) showed negative results. B) MexB gene amplicones. Lanes from 10 to 32 represent the numbers of the isolates. Lane M was 100 bp DNA marker, where the isolates No. (10, 11, 13, 14, 15, 17, 18, 19 and 20) showed positive results, while the isolates No. (12, 16, 31 and 32) showed negative results. C) OprM gene amplicones. Lanes from 1 to 39 represent the numbers of the isolates. Lane M was 100 bp DNA marker, where the isolates No. (1, 2, 3, 4, 5, 6, 9, 10, 34 and 35) showed positive results, while the isolates No. (7, 8, 33, 36, 37 and 39) showed negative results.

11


bp

380 bp

Fig. (9): Agarose gel electrophoresis of AmpC gene amplicones. Lanes from 34 to 49 represent the numbers of the isolates. Lane M was 100 bp DNA marker, where the isolates No. (36, 37, 39, 40, 42, 43, 44, 45, 46, 47 and 49) showed positive results, while the isolate No. (34) showed negative result.

Fig (10): Distribution of resistance-associated genes between biofilm and non biofilm producing Ps. aeruginosa.

DISCUSSION Because of the widespread use of antibiotics the resistance profile of microorganisms is changing, as evidenced by the increasing occurrence of antibiotic resistance among bacterial populations (Byarugaba, 2004). Ps. aeruginosa is naturally resistant to β- lactams, including broad-spectrum cephalosporins, quinolones, chloramphenicol and tetracyclines, mainly due to the very low permeability of their cell wall, as well as the presence of inducible cephalosporinase, active efflux and poor affinity for the target (DNA gyrase). These latter three

12


mechanisms are known to synergize with poor cell wall permeability (Poole, 2001). Therefore, infections with these organisms are often refractory to treatment with many currently available drugs, including the antipseudomonal antibiotics. This emphasizes the need for the implementation of local surveillance with antibiograms to guide the current use of antibiotics. In this study, the examination of some resistance and virulence factors associated genes for fifty clinical isolates of Ps. aeruginosa from Mansoura hospitals and the relationship between these genes and the biofilm production was carried out. Biofilm bacteria are more resistant to many stresses than their planktonic counterparts (Patel, 2005). In fact, biofilm bacteria can display up to 1,000 fold greater antibiotic resistance than planktonic bacteria (Mah and O'Toole 2001). This increased antibiotic resistance is due to several factors, including reduced antibiotic diffusion through the biofilm exopolysaccharide matrix, reduced growth rates of biofilm bacteria, the development of dormant persister cells, and the production of specific antibiotic resistance factors (Del Pozo and Patel, 2007). All of these factors appear to influence the antibiotic resistant nature of Ps. aeruginosa biofilms. In particular, alginate has been shown to retard the movement of cationic antimicrobial peptides, quaternary ammonium compounds and aminoglycosides (including tobramycin) through Ps. aeruginosa biofilms (Burrows et al., 2006). Additionally, Ps. aeruginosa produces biofilm-specific antimicrobial inhibitors (Mah et al., 2003). Antibiotic treatment of Ps. aeruginosa biofilms also stimulates increased production of resistance factors, such as β-lactamases and antibiotic efflux pumps (Bagge et al., 2004). In the present study the biofilm formation was detected in 64 % of the isolates. The largest numbers of positive samples were from urine samples. This is because the catheterized urinary tract provides ideal conditions for the development of enormous biofilm populations (Nicolle, 2005). This biofilm formation is a crucial factor in the development and persistence of infectious diseases caused by Ps. aeruginosa (Driscoll et al., 2007). After verification, significant increase of Tox A, lasB, ExoS, ExoY, AmpC, MexA, MexB and OprM in biofilm producers were observed than those in the non producers (p < 0.05). This results support the work achieved by (Mittal et al., 2009) who found that with increase in time period of biofilm generation from 1 to 4 day there was increase in elaboration of majority of virulence traits. This study revealed that drug-resistance and virulence of the biofilm-producing Ps. aeruginosa group were more serious than those of the non -producing Ps. aeruginosa group. (Chacón et al., 2003) found that virulence factors may play an important role in pathogenesis, and that the detection of virulence genes is a crucial step in determining the potential pathogenicity. Since clinical laboratories only do drug sensitive test without analysis of bacterial virulence, clinicians could not estimate the toxicity of the isolates. This study revealed that drug-resistance and virulence of biofilm-producing Ps. aeruginosa provides evidence for clinicians.


13

In conclusion, the results of this study confirm that drug resistance and virulence associated genes in biofilm-producing Ps. aeruginosa were more serious than in nonbiofilm-producers. Therefore, attention should be paid to the biofilm -producing Ps. aeruginosa strains in order to prevent the outbreak of nosocomial Ps. aeruginosa infection in related departments. In addition, studies with more strains of Ps. aeruginosa are thus warranted to prove potential relationship between biofilm formation and expression of different resistance and virulence genes.

REFERENCES Abdi-Ali, A.; Rahmani-Badi, A.; Falsafi, T. and Nikname, V. (2007): Study of Antibiotic Resistance by Efflux in Clinical Isolates of Pseudomonas aeruginosa. Pakistan Journal of Biological Science; 10(6): 924-927. Anke, N.; Amy, T.Y.; Thibaut, R., Beatrix, T.; Nikola, S.; Martina, R.; Olivier, L. and Joerg, O. (2013): Typ A is involved in virulence, antimicrobial resistance and biofilm formation in Pseudomonas aeruginosa. BMC Microbiol; 13: 13-77. Bagge, N.; Schuster, M.; Hentzer, M.; Ciofu, O.; Givskov, M.; Greenberg, E.P. and Hoiby, N. (2004): Pseudomonas aeruginosa biofilms exposed to imipenem exhibit changes in global gene expression and beta-lactamase and alginate production. Antimicrob Agents Chemother; 48(4): 1175-1187. Boles, B.R.; Thoendel, M. and Singh, P.K. (2004): Self-generated diversity produces "insurance effects" in biofilm communities. Proc Natl Acad Sci USA; 101: 16630-16635. Burrowes, E.; Baysse, C.; Adams, C. and O'Gara, F. (2006): Influence of the regulatory protein RsmA on cellular functions in Pseudomonas aeruginosa PAO1, as revealed by transcriptome analysis. Microbiol; 152(Pt 2): 405-218. Byarugaba, D.K. (2004): Antimicrobial resistance in developing countries and responsible risk factors. Internat J Antimicrob Agents; 24: 105-110. Chacón, M.R.; Figueras, M.J.; Castro-Escarpulli, G.; Soler, L. and Guarro, J. (2003): Distribution of virulence genes in clinical and environmental isolates of Aeromonas spp. Antonie van Leeuwenhoek; 84: 269-278. Colvin, K.M.; Gordon, V.D.; Murakami, K.; Borlee, B.R.; Wozniak, D.J.; Wong, G.C.L. and Parsek, M.R. (2011): The Pel polysaccharide can serve a structural and protective role in the biofilm matrix of Pseudomonas aeruginosa. PLoS Pathog.7:e1001264. Del Pozo, J.L. and Patel, R. (2007): The challenge of treating biofilm-associated bacterial infections. Clin Pharmacol Ther; 82(2): 204-209. Deplano, A.; Denis, O.; Poirel, L.; Hocquet, D.; Nonhoff, C. and Byl, B. et al. (2005): Molecular characterization of an epidemic clone of panantibiotic resistant Pseudomonas aeruginosa. J Clin Microbiol.; 43: 1198-204.

14


Driscoll, J.A.; Brody, S.L. and Kollef, M.H. (2007): The epidemiology, pathogenesis and treatment of Pseudomonas aeruginosa infections. Drug, 67: 351-358. Friedman, L. and Kolter, R. (2004): Genes involved in matrix formation in Pseudomonas aeruginosa PA14 biofilms. Mol. Microbiol. ; 51:675-690. Galloway, D.R. (1991): Pseudomonas aeruginosa elastase and elastolysis recent developments. Molecular Microbiology; 5: 2315-21.

revisited:

Ghafoor, A.; Hay, I.D. and Rehm, B.H.A. (2011): Role of exopolysaccharides in Pseudomonas aeruginosa biofilm formation and architecture. Appl. and Environm. Microbiol.; 77: 5238-5246. Girard, G. and Bloemberg, G.V. (2008): Central role of quorum sensing in regulating the production of pathogenicity factors in Pseudomonas aeruginosa. Future Microbiol.; 3: 97-106. Govan, J.R.W. (1996): Pseudomonas aeruginosa, Stronotrophomonas, Burkholderia. Mackie and McCartney practical Medical Microbiology. 14th ed., vol. I Churchill- Livingstone, New York, P: 413- 424. Kipnis, E.; Sawa, T. and Wiener-Kronish, J. (2006): Targeting mechanisms of Pseudomonas aeruginosa pathogenesis. Médecine et maladies infectieuses; 36: 78–91 Kumar, V.; Sen, M.R.; Nigam, C.; Gahlot, R. and Kumari, S. (2012): Burden of different beta-lactamase classes among clinical isolates of AmpC producing Pseudomonas aeruginosa in burn patients: A prospective study. Indian J Crit Care Med; 16: 136–140. Lister, P.D.; Wolter, D.J. and Hanson, N.D. (2009): Antibacterial resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin. Microbiol. Rev., 22: 582- 610. Lomholt, J.A.; Poulsen, K. and Kilian, M. (2001): Epidemic population structure of Pseudomonas aeruginosa: Evidence for a clone that is pathogenic to the eye and that has a distinct combination of virulence factors. Infect Immun.; 69: 6284-95. Ma, L.; Conover, M.; Lu, H.; Parsek, M.R.; Bayles, K. and Wozniak, D.J. (2009): Assembly and development of the Pseudomonas aeruginosa biofilm matrix. PLoS Pathog. 5:e1000354. Mah, T.F. and O'Toole G.A. (2001): Mechanisms of biofilm resistance to antimicrobial agents. Trends Microbiol; 9(1): 34-39. Mah, T.F.; Pitts, B.; Pellock, B.; Walker, G.C.; Stewart, P.S. and O'Toole, G.A. (2003): A genetic basis for Pseudomonas aeruginosa biofilm antibiotic resistance. Nature; 426(6964): 306-310.


15

Mathur, T.; Singhal, S.; Khan, S.; Upadhyay, D.J.; Fatma, T. and Rattan, A. (2006): Detection of biofilm formation among the clinical isolates of staphylococci: an evaluation of three different screening methods. Ind. J of Med. Microbiol., 24 (1): 25-29. Meyer, J.M.; Stintzi, A.; De Vos, D.; Cornelis, P.; Tappe, R. and Taraz, K. et al. (1997): Use of siderophores to type pseudomonads: the three Pseudomonas aeruginosa pyoverdine systems. Microbiology; 143: 35-43. Mikkelsen, H.; Sivaneson, M. and Filloux, A. (2011): Key two-component regulatory systems that control biofilm formation in Pseudomonas aeruginosa. Environ. Microbiol.; 13: 1666-1681. Mittal, R.; Sharma, S.; Chhibber, S. and Harjai, K. (2009): A time course study of production of virulence factors by biofilms of Pseudomonas aeruginosa. Am. J. Biomed. Sci., 1(3): 178-187. Morlon-Guyot, J.; Méré, J.; Bonhoure., A. and Beaumelle., B. (2009): Processing of Pseudomonas aeruginosa exotoxin A is dispensable for cell intoxication. Infect. Immun.; 77, 7: 3090-3099. Nicolle, L.E. (2005): Catheter-related urinary tract infection. Drugs Aging; 22, 627639. National Committee for Clinical Laboratory Standards (NCCLS), (2003): Performance standards for antimicrobial disk susceptibility tests, 8th ed. Approved standard M2-A8. National Committee for Clinical Laboratory Standards, Wayne, Pa. Patel, R. (2005): Biofilms and antimicrobial resistance. Clin Orthop Relat Res; 437: 41-47. Poole, K. (2001): Multidrug efflux pumps and antimicrobial resistance in Pseudomonas aeruginosa and related organisms. J Mol Microbiol Biotechnol; 3: 255-264. Strateva, T. and Yordanov, D. (2009): Pseudomonas aeruginosa - a phenomenon of bacterial resistance. J Med. Microbiol. 58:1133-1148. Wagner., V.E.; Filiatrault, M.J.; Picardo, K.F. and Iglewski, B.H. (2008): Pseudomonas aeruginosa: Virulence and pathogenesis issues. In: Cornelis P. Pseudomonas: genomics and molecular biology. Caister Academic Press, Norfolk, UK; 129–58.

‫‪16‬‬

‫‪N. Egypt. J. Microbiol. Vol. 37, January, 2014.‬‬

‫مقارنة بين بعض الجينات المقترنة بعوامل الضراوة ومقاومة المضادات الميكروبية فى‬ ‫السودوموناس ارويجينو از المنتجة وغير المنتجة لمطبقة الحيوية‬ ‫لمسادة الدكاترة‬ ‫رمضان حسن ‪ -‬رشا بروه‬

‫‪-‬‬

‫هبة عادل‬

‫*‬

‫مـــــــن‬ ‫قسم الميكروبيولوجي ‪ -‬كمية الصيدلة – جامعة المنصورة‪.‬‬ ‫*مستشفى طمخا المركزى‪ -‬المنصورة‪ -‬مصر‬

‫تتناول هذه الدراسة تحديد االختالفات في بعض جينات عوامل الضراوة والجينات المقاومة لممضادات‬ ‫الميكروبية فى السودوموناس ارويجينو از المنتجة و غير المنتجة لمطبقة الحيوية والمعزولة‬

‫المنصورة‪.‬‬

‫من مستشفيات‬

‫في هذه الدراسة‪ ،‬تم عزل ‪ ٥۰‬عترة من السودوموناس ارويجينو از من ‪۱٥۰‬عينة سريرية تم جمعها من‬ ‫مستشفيات المنصورة‪.‬و لقد أثبتت نتائج التحديد الظاهرى لتكوين الطبقة الحيوية أن‪ ۳۲‬عزلة (‪ )٪٦٤‬من العزالت‬ ‫أظهرت نتائج إيجابية و كانت منتجة لمطبقة الحيوية ‪ .‬وكان أكبرعدد من العينات اإليجابية معزول من عينات‬ ‫البول ‪ .‬وباستخدام تفاعل البممرة المتسمسل لوحظ وجود‬ ‫المنتجة لمطبقة الحيوية‪.‬‬

‫جين ‪ pelA‬فى الدانا الكروموسومى لجميع العزالت‬

‫وتم تقييم االرتباط بين إنتاج الطبقة الحيوية و بعض الجينات المقترنة بعوامل الضراوة بما فى ذلك جين‬ ‫)‪ (toxA‬المسئول عن انتاج البروتين الخارجى‬

‫‪ A‬وجين )‪ ) lasB‬المسئول عن انتاج انزيم االلستيز جين‬

‫(‪ )exoS‬المسئول عن انتاج (‪ )exoenzyme S‬و جين (و‪ )exoY‬المسئول عن انتاج (‪ )exoenzyme Y‬وقد‬

‫أوضح الكشف عن هذه الجينات أن ‪ ٪٦٩.7 ،٦٩.23٪ ، ٪٨١.25‬و ‪ ٪٩١.6‬من العزالت التى تحمل جينات‬

‫‪ exoS ،lasB ،toxA‬و‪ exoY‬عمى التوالي كانت منتجة لمطبقة الحيوية ‪ .‬وفيما يتعمق بالجينات المرتبطة‬ ‫بالمقاومة ‪ ،‬وجد أن ‪ ٪٦٧.44‬من العزالت الحاممة لجين‬

‫‪ AmpC‬وهو أحد الجينات المسئولة عن المقاومة‬

‫لمبيتاالكتام كانت منتجة لمطبقة الحيوية ‪ .‬في حين أن جينات المضخة الثالثية ‪ MexAB-OprM‬وجدت فقط‬ ‫فى ثمانى عزالت وكانت جميعها منتجة لمطبقة الحيوية‪.‬‬

‫وأكدت هذه الدراسة أن الجينات المرتبطة بمقاومة المضادات الميكروبية والجينات المرتبطة بعوامل الضراوة‬ ‫تعتبر أكثر أهمية لمعزالت المنتجة لمطبقة الحيوية‪.‬‬