Comparison of transcriptional profiles of flavonoid ...

Phytochemistry 71 (2010) 1839–1847

Contents lists available at ScienceDirect

Phytochemistry journal homepage: www.elsevier.com/locate/phytochem

Comparison of transcriptional profiles of flavonoid genes and anthocyanin contents during fruit development of two botanical forms of Fragaria chiloensis ssp. chiloensis Ariel Salvatierra, Paula Pimentel, Maria Alejandra Moya-Leon, Peter D.S. Caligari, Raul Herrera ⇑ Instituto de Biología Vegetal y Biotecnología, Universidad de Talca, Casilla 747, Talca, Chile

a r t i c l e

i n f o

Article history: Received 14 December 2009 Received in revised form 27 July 2010 Available online 26 August 2010 Keywords: Fragaria chiloensis ssp. chiloensis Rosaceae Fruit color Developmental gene expression Anthocyanins

a b s t r a c t Difference in fruit pigmentation observed between two botanical forms of Fragaria chiloensis ssp. chiloensis (form chiloensis and form patagonica) was studied through transcriptional and chemical approaches. The proportion of different anthocyanins was demonstrated to be characteristic of each botanical form, with pelargonidin 3-glucoside being the most abundant in f. patagonica fruit and cyaniding 3-glucoside as the major one in f. chiloensis fruit. Partial gene sequences of the phenylpropanoid and flavonoid biosynthesis pathways were isolated from the native Chilean strawberry fruits, and used to design gene-specific primers in order to perform transcriptional analyses by qRT-PCR. These genes showed spatial, developmental, and genotypic associated patterns. The red fruit of f. patagonica exhibited higher transcript levels of anthocyanin-related genes and higher levels of anthocyanins compared to the barely pigmented fruit of f. chiloensis. The anthocyanin accumulation in F. chiloensis ssp. chiloensis fruits was concomitant with the particular progress of the transcriptional activity of genes involved in the biosynthesis of flavonoid pigments. The differences in anthocyanin contents, both in terms of type and quantity, between the two botanical forms of F. chiloensis ssp. chiloensis were coincident with the differential transcriptional patterns found in the anthocyanin-related genes. Ó 2010 Elsevier Ltd. All rights reserved.

1. Introduction The native Chilean strawberry (Fragaria chiloensis (L.) Mill. ssp. chiloensis Staudt) is an octoploid species (2n = 8x = 56) of the Rosaceae family. This native strawberry has two botanical forms which are readily recognizable. F. chiloensis ssp. chiloensis f. patagonica is a wild plant with small fruits, red receptacle, and yellow or red achenes. On the other hand, F. chiloensis ssp. chiloensis f. chiloensis is a robust plant cultivated on a small scale that bears larger fruits, which are composed of a pinkish-white receptacle and red achenes when fully ripened. The latter is the maternal progenitor

Abbreviations: ANR, anthocyanidin reductase; ANS, anthocyanidin synthase; CTAB, cetyltrimethylammonium bromide; CHI, chalcone isomerase; CHS, chalcone synthase; C4H, cinnamate 4-hydroxylase; DAA, days after anthesis; DFR, dihydroflavonol reductase; FLS, flavonol synthase; F3H, flavanone 3-hydroxylase; GSP, gene specific primer; HPLC-DAD, high performance liquid chromatography-diode array detector; LAR, leucoanthocyanidin reductase; PA, proanthocyanidin; PAL, phenylalanine ammonia-lyase; qRT-PCR, quantitative reverse transcription-polymerase chain reaction; TF, transcription factor; UFGT, UDP glucose:flavonoid 3-O-glucosyl transferase; 4CL, 4-coumarate:CoA ligase; f. chiloensis, Fragaria chiloensis ssp. chiloensis f. chiloensis; f. patagonica, Fragaria chiloensis ssp. chiloensis f. patagonica. ⇑ Corresponding author. Tel.: +56 71 200277; fax: +56 71 200276. E-mail address: [email protected] (R. Herrera). 0031-9422/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.phytochem.2010.08.005

of the widely cultivated strawberry, Fragaria ananassa Duch. (Hancock et al., 1999). F. chiloensis is characterized as having a high and particular aroma (González et al., 2009a), large fruit size (compared with all other wild species), and remarkable tolerance to infection by Botrytis (González et al., 2009b). These advantages, along with other characteristics, make it an important germplasm source both for its own development as a new exotic fruit crop, as well as for further development of new cultivars of the commercial strawberry (F. ananassa). These thus offer an interesting model to study fruit pigmentation by anthocyanins, considering that the color of the white and red botanical forms reflect the presence of such phytochemicals. Anthocyanins are natural colorants belonging to the flavonoid family of compounds, a secondary class of metabolites that are responsible for the red, violet and blue colors observed in flowers and fruits in a large number of plants. Due to the broad distribution of anthocyanins in the plant kingdom, their chemistry, distribution, biosynthesis and regulation have been extensively studied. This has resulted in the collection of a large amount of information concerning the production of plant pigments (Dooner et al., 1991; Holton and Cornish, 1995; Grotewold, 2006; Ferrer et al., 2008). In the Fragaria genus, fruit color is determined by the accumulation of anthocyanins, the most abundant flavonoids in strawberry

1840

A. Salvatierra et al. / Phytochemistry 71 (2010) 1839–1847

Fig. 1. Chemical structures of anthocyanins measured in Fragaria chiloensis ssp. chiloensis f. chiloensis and f. patagonica fruits. (1), Pelargonidin 3-glucoside; (2), cyanidin 3-glucoside.

fruits (Hannum, 2004). Pelargonidin 3-glucoside (1) is the predominant anthocyanin in several varieties of red strawberries, usually followed by pelargonidin 3-rutinoside and cyanidin 3-glucoside (2) (Gil et al., 1997; Kosar et al., 2004; Tulipani et al., 2008). These three compounds represent more than 95% of the total anthocyanins in the cultivated strawberry (Lopes da Silva et al., 2007). F. chiloensis f. patagonica fruit also showed similar levels of pelargonidin 3-glucoside (1) (Simirgiotis et al., 2009) to F. ananassa (Kosar et al., 2004), when fully ripe. However, at the same developmental stage, f. chiloensis had lower levels of anthocyanins, with cyanidin 3-glucoside (2) being the major anthocyanin followed by pelargonidin 3-glucoside (1) (Simirgiotis et al., 2009). This indicates differences in anthocyanin compositions between the two botanical forms of the native Chilean species of F. chiloensis ssp. chiloensis. Flavonoid genes involved in anthocyanin biosynthesis exhibit up-regulation during ripening leading to fruit pigmentation in F. ananassa thereby establishing a positive correlation between transcript levels of flavonoid genes and anthocyanin accumulation (Manning, 1998; Almeida et al., 2007; Carbone et al., 2009). In the present work, cDNA fragments of genes from phenylpropanoid (PAL, C4H and 4CL) and flavonoid biosynthetic pathway (CHS, CHI, F3H, DFR, ANS, UFGT, LAR and ANR) were isolated from the native Chilean strawberry. The differential transcriptional profiles of these genes were analyzed in f. chiloensis and f. patagonica through four different fruit developmental stages and tissues by qRT-PCR. In parallel, the accumulation of the two major anthocyanins, pelargonidin 3-glucoside (1) and cyaniding 3-glucoside (2; Fig. 1), in these native strawberries was quantified by HPLC-DAD. The relationship between transcriptional profiles and anthocyanin contents present in both botanical forms is discussed in terms of the modulation of flavonoid gene expression in the determination of the different pigmentation patterns observed in the white- and red-fruited Chilean native strawberries.

Fig. 2. Developmental and ripening stages of native Chilean strawberry fruit. Four different developmental stages for F. chiloensis ssp. chiloensis fruits: (A) red fruited botanical form patagonica; (B) white–pinkish fruited botanical form chiloensis. Bars are equivalent to 1 cm.

of genes involved in this biosynthetic pathway were isolated. These gene fragments showed a high nucleotide homology with phenylpropanoid and flavonoid genes from other plant species (Supplementary Table 2). Suitable primers for transcriptional analysis by

Table 1 Primer sequences of the phenylpropanoid and flavonoid genes and housekeeping gene (GAPDH) used for qRT-PCR. All primers were designed from partial sequences isolated in this work, except for FLS primer, which was designed directly from a F. ananassa sequence found in public database (GenBank number accession DQ087252). Target gene

Primers (forward/reverse)

Amplicon size (bp)

Efficiency (%)

PAL

50 -CAAGGGCGGCGATGCTAGTAAG-30 50 -CCAAGTCACCCGACGACGAGAT-30 50 CTGTAAGGAGGTGAAGGAGAAGAGG30 50 -CTGTTGAGCGTCCAGGATGTG-30 50 -ACTTGGTCAGGGATATGGGATG-30 50 -GCACCAGTTTCAGGGTCTACG-30 50 -CCGACTACTACTTTCGTATCACCA30 50 -ACTACCACCATGTCTTGTCTTGC-30 50 -TTTTCAATGGCTTTCGCTTCTG-30 50 -GTGACAATGATACTACCGCTGACG30 50 -GTGCGCCACCGTGACTACTC-30 50 -ATGCCTTTGTCAATGCCTCC-30 50 -GGGTGGTGTTTACATCTTCGG-30 50 -CTGCTTGCTCGGCTAGAGTTT-30 50 -ATCGTCATGCACATAGGCGACACC30 50 -CCTTGGGCGGCTCACAGAAAA-30 50 -ATCGTGGCTTGACAAACAGAA-30 50 -TGACCACAAGAATGGAACCCTA-30 50 -CATCCAAGGCGAAGACCAT-30 50 TCATACTTAAACAACTGAGACCACC-30 50 -GGTGATGGCACGGTTAAAGC-30 50 -CTCCCACAGTGAAGCAAGTCC-30 50 -TTATCTTTGGGGTTAGGGCTTGAA30 50 -GAGAATGGTGAGGGCGGACA-30 50 TCCATCACTGCCACCCAGAAGACTG-30 50 -AGCAGGCAGAACCTTTCCGACAG30

153

96.5

139

97.1

150

95.4

190

94.3

119

94.7

157

95.4

156

96.5

130

97.1

133

94.2

167

96.5

156

100.4

162

98.1

132

93.0

C4H

4CL CHS

CHI

F3H

2. Results and discussion 2.1. Transcriptional profiles of genes involved in biosynthesis of phenolic compounds in fruits at different developmental stages

DFR ANS

UFGT

The phenylpropanoid biosynthesis pathway is part of the secondary metabolism of plants, and its branches transform the amino acid, phenylalanine, into a variety of important phytochemicals, including lignins, stilbenes, coumarins, salicylates, sinapate esters and flavonoids. The structural diversity of compounds derived from phenylalanine is due to the action of enzymes and enzyme complexes that bring about regio-specific condensation, cyclization, aromatization, hydroxylation, glycosylation, acylation, prenylation, sulfation and methylation reactions (Noel et al., 2005). In order to study the transcriptional profiles of flavonoid genes in the Chilean native strawberry of red and white fruit, fragments

ANR

LAR FLS

GAPDH


qRT-PCR were thus then designed from the isolated sequences (Table 1). Along the fruit development process, PAL, the first gene involved in this metabolic pathway, showed similar expression level in both botanical forms with a continuous increment in transcripts

1841

during development (Fig. 3A). This step represents the connection between primary and secondary metabolism since the enzyme encoded by this gene is responsible for catalyzing the trans-elimination of ammonia from phenylalanine and the generation of transcinnamic acid, the substrate for the next step mediated by C4H.

Fig. 3. Transcriptional analysis of genes involved in flavonoid biosynthesis during development of F. chiloensis ssp. chiloensis f. chiloensis (white circles) and f. patagonica (black circles) fruits by qRT-PCR. The fruits were classified into four developmental and ripening stages as described in Section 4: S1 corresponding to C1 and P1; S2 to C2 and P2; S3 to C3 and P3 and S4 to C4 and P4 of F. chiloensis ssp. chiloensis f. patagonica and f. chiloensis, respectively. Relative gene expression levels were normalized against GAPDH transcript values. Values represent the average ± SD of three biological replicates with two technical replicates of each developmental stage.

1842


The following genes in the phenylpropanoid biosynthesis pathway, C4H and 4CL, displayed at the first developmental stage high transcript levels which dropped in the following stages to basal levels in both botanical forms (Fig. 3B and C). Similar transcript patterns were observed in both fruits, although higher transcript levels were recorded for F. chiloensis ssp. chiloensis f. patagonica at stage 1. Since this biosynthetic pathway is general for a large variety of plant compounds, it does not seem to have a determining role in the differences of fruit pigmentation recorded between the patagonica and chiloensis forms. The first committed step of the flavonoid biosynthesis pathway is mediated by CHS. All flavonoids are derived from the chalcone scaffold synthesized by this first enzyme, which catalyzes the iterative condensation and subsequent intramolecular cyclization of three acetate units onto the p-coumaroyl-CoA end product of the general phenylpropanoid pathway. At the initial developmental stages, CHS transcripts exhibit a basal levels and only at the last stage there was a significant transcript increment in F. chiloensis ssp. chiloensis f. chiloensis fruit (Fig. 3D). On the other hand, in F. chiloensis ssp. chiloensis f. patagonica fruit, a particularly distinct transcriptional profile was observed. In this case, maximum transcript levels were reached at the turning fruit stage (S3) when the receptacle begins its gradual pigmentation. Then, a slight decrease in CHS messenger is observable at S4. Similar transcription patterns have been reported for CHS genes in other developmental studies carried out in several F. ananassa genotypes (Manning, 1998; Almeida et al., 2007; Carbone et al., 2009; Saud et al., 2009). CHI stereospecifically directs and greatly accelerates the spontaneous additional cyclization of chalcones to form the flavonoid core. Since the activity of this enzyme is tightly related to CHS activity, it was not surprising to observe the same trend in their messenger profiles (Fig. 3E). F3H, ANS and UFGT transcript levels share a similar pattern with CHS and CHI, but a drop in S4 stage in F. chiloensis ssp. chiloensis f. patagonica fruit was not noted. In the particular case of UFGT, no increment is observed in F. chiloensis ssp. chiloensis f. chiloensis fruit at S4 stage, which is unique behavior compared with that of CHS, CHI, F3H, DFR and ANS transcript profiles (Fig. 3F, H and I). UFGTs catalyze transfer of glucose from UDP-activated sugar donor molecule to the hydroxyl group at C3 of flavonols and anthocyanidins. Glycosylation increases the water solubility of polar flavonoid compounds and improves their stability. This is an essential final step required to stabilize anthocyanidins so that they can accumulate as water soluble pigments in the vacuoles, a subcellular compartment with an acidic environment where anthocyanins exist in their colored form. Thus UFGT is regarded as indispensable in anthocyanin biosynthesis rather than simply a modifying enzyme. In Vitis vinifera cv. Shiraz, the molecular analyses of structural genes involved in anthocyanin synthesis showed that all structural genes tested, except UFGT, were expressed in most berry tissues, whereas expression of UFGT was only detected in the berry skin and was always associated with anthocyanin accumulation (Boss et al., 1996a; Kobayashi et al., 2001). This step was identified as a key point in the control of berry color, although no differences were observed in either coding or promoter sequences of this gene between colored and white cultivars (Kobayashi et al., 2002). In strawberry, RNAi down-regulation of FaGT1, a UFGT gene phylogenetically related to VvGT1, showed significant reduced levels of the strawberry pigments pelargonidin 3-glucoside malonate and pelargonidin 3-glucoside (1) compared to control fruit (Griesser et al., 2008). In the light of all of above, the dramatic difference observed in UFGT mRNA levels seems to be playing a pivotal role in the difference of pigmentation between both botanical forms of native Chilean strawberry. DFR catalyzes the stereo-specific reduction of dihydroflavonols to leucoanthocyanidins, using NADPH as a cofactor (Kristiansen and Rohde, 1991). Leucoanthocyanidins are intermediate precur-

sors for synthesis of anthocyanins and proanthocyanidins (PAs). As in the previously discussed flavonoid genes, DFR transcripts had an increasing trend through berry development (Fig. 3G). In ripe fruits, F. chiloensis ssp. chiloensis f. chiloensis showed low levels of anthocyanins compared to F. chiloensis ssp. chiloensis f. patagonica and F. ananassa cv. Chandler, but catechin and higher levels of ellagic acid were detected in EtOAc soluble fractions (Simirgiotis et al., 2009). Despite the scarcity of colored anthocyanins in F. chiloensis ssp. chiloensis f. chiloensis fruit, the presence of tannin compounds in ripe fruit could explain the pattern depicted by DFR which showed equivalent levels in S4 stage in both botanical forms. Ultimately, the anthocyanin-related genes of the native Chilean strawberry, as reported in developmental studies in other fruits such as grapevine (Boss et al., 1996b), apple (Kondo et al., 2002), bilberry (Jaakola et al., 2002), strawberry (Almeida et al., 2007; Carbone et al., 2009) and mangosteen (Palapol et al., 2009), showed transcriptional profiles that correlate positively with anthocyanin accumulation throughout fruit development. In addition, comparative transcriptional analysis carried out between fruits of both botanical forms of F. chiloensis established higher transcript levels of flavonoid genes leading to anthocyanins (except by DFR) in the red-fruited F. chiloensis ssp. chiloensis f. patagonica than in the white-fruited F. chiloensis ssp. chiloensis f. chiloensis at ripe stage, agreeing with similar comparative studies in species with fruits contrasting in pigmentation, such as grapevine (Boss et al., 1996a,c), apple (Honda et al., 2002) and bilberry (Jaakola et al., 2002). Flavonols, synthesized by FLS, and PAs, synthesized by LAR and ANR, are competitive branches for anthocyanin biosynthesis in the flavonoid pathway. FLS, LAR and ANR showed a decreasing transcriptional profile as fruit ripening proceeds (Fig. 3J–L). Transgenic anti-sense FLS flowers of Petunia and Nicotiana accumulate increased levels of anthocyanins (Holton et al., 1993; Nielsen et al., 2002), which supports the existence of a substrate competition among DFR (for anthocyanin production) and FLS (for flavonol production). In fruits of both native strawberries, FLS transcripts are present at high levels in the S1 stage and then they decay steadily to very low levels in S4 stage (Fig. 3J), showing an opposite trend to what was observed with the anthocyanin-related genes, confirming the competition between these two pathways in this fruit. High levels of flavan 3-ol accumulated at early stages, which could protect immature berries both from feeding by animals and pest insects, and from pathogen attack (Gould and Lister, 2006). During ripening of commercial strawberry fruit, the concentration of flavan 3-ols, constituents of PAs, decreased continuously while anthocyanin content increased, giving the fruit an attractive appearance. Thus, there is an obvious redirection of flavonoid biosynthesis from flavan 3-ol to anthocyanin formation during the complex developmental process of fruit ripening (Halbwirth et al., 2006). In PA biosynthesis, LAR catalyzes the synthesis of catechin/afzelechin and ANR the synthesis of epicatechin/epiafzelechin, depending on the degree of hydroxylation of their respective substrates. In the native Chilean strawberry, LAR and ANR transcriptional profiles decrease from S1 to S4 stages as in commercial strawberry, but a notable point is that F. chiloensis ssp. chiloensis f. chiloensis showed higher levels than F. chiloensis ssp. chiloensis f. patagonica of ANR transcripts (Fig. 3K and L). Since quantification of these metabolites has not been reported for native Chilean strawberry, the real impact of this particular behavior of ANR is still unclear. The temporal transcriptional analysis performed in this study evidenced a coordinated up-regulation of genes associated to anthocyanin biosynthesis, but at different scale, in fruits from both botanical forms. These results suggest that the expression of struc-


tural genes was synchronously regulated in a form-specific manner. Similar patterns have been reported in other species and the regulation of structural genes by transcription factors has been widely discussed (Palapol et al., 2009; Yuan et al., 2009). In redfleshed apple, the transcript levels of anthocyanin-related genes were higher throughout development than those found in whitefleshed apple and strongly correlated to MdMYB10 expression (Espley et al., 2007). In berry skin of V. vinifera cv Shiraz, qRT-PCR analyses of a number of transcription factors have reported

1843

transcriptional profiles associated to developmental stages, where MYB proteins controlling the expression of PA related genes (e.g., VvMYBPA1, VvMYB5a and VvMYB5b) were up-regulated in unripe stages and those controlling the anthocyanin-related genes (e.g., VvMYB5b, VvMYBA1 and VvMYBA2) showed higher transcript levels at ripe stages (Deluc et al., 2008). This fact makes evident the need of a complex network of regulatory genes in order to modulate the flavonoid structural genes through fruit ripening. Currently, the regulation of expression of structural genes on

Fig. 4. Spatial transcriptional analysis of genes involved in flavonoid biosynthesis by qRT-PCR. The gene expression in flower, leaf, runner and root from F. chiloensis ssp. chiloensis f. chiloensis (white bars) and f. patagonica (black bars) was assessed in comparison with that of F. chiloensis ssp. chiloensis f. chiloensis fruit on stage 1 (C1). Relative gene expression levels were normalized against GAPDH transcript values. Values represent the average ± SD of three biological replicates with two technical replicates of each tissue.

1844


Table 2 Changes in main anthocyanin content (lg g1 fresh weight) during development and ripening of both botanical forms of F. chiloensis ssp. chiloensis. F. chiloensis ssp. chiloensis

Developmental stage

Pelargonidin 3-glucoside (1)

f. chiloensis

S1 S2 S3 S4

nd nd nd 3.95 ± 0.13a

f. patagonica

S1 S2 S3 S4

nd nd 6.42 ± 0.73 12.47 ± 1.15b

Cyanidin 3-glucoside (2) 3.03 ± 0.08a 4.98 ± 0.50a 7.80 ± 0.17a 5.86 ± 1.18a 4.66 ± 0.66b 6.55 ± 0.64b 11.84 ± 2.20b 6.63 ± 0.57a

Values represent the average ± SD of three biological replicates. For each anthocyanin, different letters at the same developmental stage indicate significant differences between botanical forms at p < 0.05. S1: developmental stage 1 (C1/P1); S2: developmental stage 2 (C2/P2); S3: developmental stage 3 (C3/P3); S4: developmental stage 4 (C4/P4); nd: compound not detected.

flavonoid pathway by transcription factors is a matter of analysis in our ongoing work. 2.2. Transcriptional profiles of genes involved in biosynthesis of phenolic compounds in tissues The spatial transcriptional analysis detected expression of genes involved in phenylpropanoid and flavonoid biosynthesis pathways in all tissues assessed. A greater difference in transcript levels for all genes from the phenylpropanoid biosynthesis pathway was observed (Fig. 4). For PAL, the higher differences in transcript level was observed for flower, leaf and roots (Fig. 4A). Roots and runners exhibited higher mRNA levels of C4H and 4CL than the other tissues, since their developmental dynamics involve continuous growth of these woody structures and the concomitant synthesis of lignin monomers (Fig. 4B and C). Runners of F. chiloensis ssp. chiloensis f. patagonica present a red pigmentation. In this case, flavonoid biosynthesis pathway genes leading to anthocyanins are up-regulated, except by ANS, compared to what happens in green runners of F. chiloensis ssp. chiloensis f. chiloensis. The low level of ANS transcripts found in the red runners of F. chiloensis ssp. chiloensis f. patagonica could be a result of the incapacity to detect a putative tissue-specific ANS paralogous gene. The most prominent difference was noted at the level of the UFGT messengers, where quantities of mRNAs of this gene were three times higher in red runners relative to green ones. Again, in these contrasting colored tissues, UFGT seems to be the determining factor in the anthocyanin-related pigmentation of plant structures in the native Chilean strawberries (Fig. 4D–I). Roots of F. chiloensis ssp. chiloensis f. chiloensis have a reddish hue and the situation described above occurs in an opposite way, since F. chiloensis ssp. chiloensis f. patagonica roots are green, but on a minor scale (Fig. 4D–I). In addition, DFR, LAR and ANR transcripts showed higher levels in F. chiloensis ssp. chiloensis f. chiloensis which could suggest a redirection in the flavonoid pathway to the synthesis of PAs in this tissue (Fig. 4K and L). Flowers of both botanical forms gave highest expression of FLS among the native Chilean strawberry tissues analyzed (Fig. 4J). This behavior has already been reported for the commercial strawberry (Almeida et al., 2007) and correlates very well with the physiological role of flavonols in planta since their biosynthesis is proposed as key point for biological events that happen in the flower organ, such as pollinator attraction (Tanaka et al., 2008) and pollen germination (van der Meer et al., 1992; Napoli et al., 1999). Leaves of F. chiloensis ssp. chiloensis f. chiloensis exhibited high transcript levels of PA genes (Fig. 4K and L); this fact could explain the enhanced tolerance to Botrytis infection (González et al., 2009b) as reported for other plant species (Ardi et al., 1998; Miranda et al., 2007).

The existence of a spatial regulation of the flavonoid gene expression is evident which would lead to the biosynthesis of diverse phenolic compounds. These metabolites have multiple biological functions in each tissue as a means for sustaining successful adaptability, growth and reproduction of the plant. 2.3. Accumulation of anthocyanins during fruit development Accumulation of anthocyanins during ripening has been reported for several fruits such as grape (Boss et al., 1996c; Ryan and Revilla, 2003; Vian et al., 2006), mangosteen (Palapol et al., 2009), bilberry (Jaakola et al., 2002), apple (Kondo et al., 2002) and strawberry (Kosar et al., 2004; Halbwirth et al., 2006; Carbone et al., 2009; Saud et al., 2009). The most commonly occurring anthocyanins in strawberry are cyanidin and pelargonidin derivatives. The main pigment in cultivated strawberries has been identified as pelargonidin 3-glucoside (1) (Gil et al., 1997; MäättääRiihinen et al., 2004) and the presence of cyanidin 3-glucoside (2) is widely documented (Nyman and Kumpulainen, 2001; Wang et al., 2003; Kosar et al., 2004; Tulipani et al., 2008). The composition and contents of anthocyanins were determined in all developmental and ripening stages described for F. chiloensis ssp. chiloensis f. chiloensis and f. patagonica fruits. Cyanidin 3-glucoside (2) was present at all developmental stages in fruits of both botanical forms, with a maximum level at S3 stage; nevertheless, a higher concentration of this pigment was observed in fruits from F. chiloensis ssp. chiloensis f. patagonica. The presence of cyanidin 3-glucoside (2) in the unripe stages could be explained by the early pigmentation of achenes seen in fruits of both botanical forms. Pelargonidin 3-glucoside (1), the typical receptacle anthocyanin, was detected in F. chiloensis ssp. chiloensis f. patagonica at S3 stage, with a maximum level at S4 (12.5 lg g1), while this anthocyanin was only detected at a low level in the S4 stage in F. chiloensis ssp. chiloensis f. chiloensis (4.0 lg g1), representing only one third of pelargonidin 3-glucoside (1) found in ripe fruits of f. patagonica (Table 2). Cyanidin derived anthocyanins have been reported in commercial strawberries as being present mainly in achenes (Aaby et al., 2005). Cyanidin-3-O-b-D-glucopyranoside was the main anthocyanin in F. chiloensis ssp. chiloensis f. chiloensis fruits and was found only in achenes (Cheel et al., 2005). The unusual quantity of cyanidin derived pigment detected in F. chiloensis ssp. chiloensis f. chiloensis fruits is given by the achene anthocyanin input, due to the fact that achenes are the most colored tissues in the whole fruit of this form. In addition, a different anthocyanin ratio is evident between the ripe fruits of this native strawberry, since F. chiloensis ssp. chiloensis f. patagonica showed a pelargonidin 3-glucoside (1) content 1.88 times higher than cyanidin 3-glucoside (2) and in F. chiloensis ssp. chiloensis f. chiloensis, cyanidin 3-glucoside (2) content was

1845


1.48 times higher than pelargonidin 3-glucoside (1) according to our extraction procedures and HPLC-DAD measurements. This particular trait could be useful for distinguishing the botanical forms by mean of a chemotaxonomic approach.

sured in a Technologies).

3. Conclusions

Primers for amplifying partial sequences of genes involved in the phenylpropanoid (PAL, C4H and 4CL) and flavonoid biosynthesis pathway (CHS, CHI, F3H, DFR, ANS, UFGT, LAR and ANR) (Supplementary Table 1) were designed from conserved nucleotide regions identified by multiple alignments of sequences from species phylogenetically related to Fragaria genus found in public databases (Supplementary Fig. 1). First-strand cDNAs from each developmental stage and plant tissue were synthesized from total RNA (1 lg) using the ThermoScript RT-PCR System kit (Invitrogen), according to manufacturer’s instructions. Gene fragments were amplified from a fruit cDNA pool including all developmental stages. Amplicons ranging from 200 to 500 bp were cloned, sequenced and deduced amino acid sequences were analyzed by BLASTp (Altschul et al., 1997) in order to assess their homologies. The amino acid sequences were deduced by means of Expasy Translate Tool available in Expasy website.

The current work establishes for the first time a clear relationship between fruit pigmentation, transcriptional patterns of phenylpropanoid and flavonoid biosynthesis pathways and accumulation of representative anthocyanins of both botanical forms of F. chiloensis ssp. chiloensis during their fruit developmental process. The results indicate the existence of differential transcriptional patterns in the anthocyanin-related genes during fruit ripening among F. chiloensis ssp. chiloensis f. chiloensis and f. patagonica with a clear down-regulation of these genes in F. chiloensis ssp. chiloensis f. chiloensis fruits, which could explain the scarce pigmentation in the white strawberry where UFGT transcript levels seem to be critical for fruit anthocyanin accumulation. Moreover, the differences are not a reduction in the quantity of anthocyanin but also in the quality of them. Further studies are required for elucidating the role of transcription factors in the spatial and developmental regulation of structural genes responsible for phenolic compounds production in order to explain the differences in their gene patterns observed among the two native Chilean strawberries.

4. Experimental 4.1. Plant material Fruit and plant tissues (flower, leaf, runner and root) of F. chiloensis ssp. chiloensis f. chiloensis were obtained from a commercial plantation in Contulmo, Bio-Bio Region, Chile (latitude 38° 040 8.600 S; longitude 73° 140 2.9600 W). Fruits were harvested in 2006 and 2007. Fruit and plant tissues of F. chiloensis ssp. chiloensis f. patagonica were obtained from collections in its native habitat in Termas de Chillán, Bío-Bío Region, Chile (S 36° 540 58.3500 , W 71° 250 18.1900 ). Fruits were harvested during the 2006 and 2007 seasons (December–January). Fruits of f. chiloensis were classified into four development and ripening stages, according to Figueroa et al. (2008), based on weight and color of the receptacle and achene (Fig. 2): C1, small fruit with green receptacle and green achenes (7 days after anthesis, daa); C2, large fruit with green receptacle and red achenes (14 daa); C3, turning stage, white receptacle and red achenes (21 daa); and C4, ripe fruit with pink receptacle and red achenes (28 daa). Similarly, fruits of f. patagonica were classified for the first time into four development and ripening stages: P1, green receptacle and green achenes (7 daa); P2, green receptacle and red achenes (14 daa); P3, turning stage, pink receptacle and red achenes (21 daa); and P4, ripe fruit with red receptacle and red achenes (28 daa). After classification, samples were immediately frozen with liquid N2 and stored at 80 °C until needed. 4.2. RNA extraction Three independent total RNA samples were isolated from pools of fruits prepared for each developmental stage, and also from flower, leaf, runner and root tissue using the CTAB method with minor modifications (Chang et al., 1993). A DNAse treatment (Invitrogen) was carried out with the aim to remove contaminant genomic DNA. Integrity of isolated RNAs was checked on agarose gels stained with ethydium bromide and their concentration mea-

ND-1000

UV

spectrophotometer

(Nanodrop

4.3. Cloning of partial sequences of flavonoid genes

4.4. Transcriptional analysis For quantitative Real-Time reverse transcription PCR (qRT-PCR) assays, first-strand cDNA synthesis was performed using an AffinityScript QPCR cDNA Synthesis kit (Stratagene, Agilent Technologies). For cDNA synthesis, total RNAs isolated from each biological replicate were used as a template in a 20 lL reaction mixture. Each reaction mixture contained template RNA (2 lg), 2 cDNA Synthesis Master Mix (10 lL), Oligo (dT) Primer (3 lL) and AffinitySript RT/TNasa Block Enzyme Mixture (1 lL). cDNA was diluted 1:4, and 2 lL of the dilution was used in a SYBR Green RT-PCR. cDNA (50 ng) was used for qRT-PCR assays, carried out with gene-specific primers (GSP) (Table 1) designed with Primer Premier software 5.0 (Premier Biosoft International), using a DNA Engine Opticon2 thermocycler (MJ Research) and Brilliant II SYBR Green QPCR master mix kit (Stratagene) following the manufacturer’s instructions. Biological replicates were analyzed in duplicate. Specificity of amplification products was confirmed by the registration of a single peak in melting curves of the PCR products and the visualization of a single band on agarose gels. Seven 10-fold dilutions of each gene fragment were used to calculate PCR efficiency (E) for each gene specific primer and housekeeping gene using the slope of a linear regression model:

E ¼ 10½1=slope

ð1Þ

A GAPDH gene with constant expression levels through all fruit developmental stages and tissues (Supplementary Fig. 2) was used to normalize raw data and to calculate relative expression levels. S1 from f. chiloensis fruit (C1) was taken as the calibrator sample in this study. Normalized Ct values were used for determining gene expression variations in the samples analyzed according to the following model (Pfaffl, 2001):

Relative expression ratio ðRÞ ¼

ðEtarget ÞDCttarget ðEhousekeeping Þ

ðcalibrator-sampleÞ

DCt housekeeping

ðcalibrator-sampleÞ

ð2Þ Etarget was the PCR efficiency for a target gene; Ehousekeeping was the PCR efficiency for housekeeping gene GAPDH; DCttarget and DCthousekeeping corresponded to the subtraction of the calibrator Ct value by the sample Ct value for each gene of interest and for the normalizer gene, respectively.

1846


4.5. Quantification of anthocyanins content For anthocyanin extraction, frozen samples were powdered with N2 in a mortar. Each biological replicate consisted of frozen tissue (2.5 g), and three replicates were assessed separately. Each sample was extracted with MeOH (12.5 mL) containing glacial HOAc (99:1, v/v) and homogenized by sonication during 10 min. Samples were then centrifuged at 16,000g for 20 min and the supernatants were filtered through a 0.22 lm cellulose acetate filter disc. The filtrate was concentrated five times in a Sep-Pak Vac C18 cartridge. Concentrated extracts were stored until use at 80 °C. The analysis of anthocyanins was carried out using an Agilent 1100 series HPLC system provided by a photodiode array detector (DAD) equipped with a manual injector (20 lL injection volume) and interfaced to a PC running ChemStation chromatography manager software (Hewlett–Packard). Separations were performed on a reverse phase C18 analytical column (Kromasil 100, 25 cm 4.6 mm 5 lm), equipped with a C18 precolumn (Kromasil) operated at 35 °C with a flow rate of 700 lL/min. Quantifications of anthocyanins were carried out between the wavelengths of 280 and 600 nm, monitoring them at 520 nm. Elution was performed using a gradient of solvents: 4% HCO2H in H2O (solvent A) and MeOH/H2O (95:5) (solvent B). The gradient used was 0–10 min, 20% B; 10–15 min, 30% B; 15–20 min, 40% B; and 20–25 min, 100% B. Components were identified by comparison of their retention times to those of authentic standards under the same analysis conditions. Calibration curves were prepared for pelargonidin 3-glucoside (1) and cyanidin 3-glucoside (2), and standards were purchased from Sigma–Aldrich and Extrasynthèse, respectively. MeOH, glacial HOAc and HCO2H were purchased from J.T. Baker, Merck and Scharlau, respectively. Means from two technical replicates of three independent quantifications were subjected to one-way ANOVA and LSD pairwise comparisons using Statistica 4.0 software (Statsoft Inc.). Acknowledgments This work has been funded by grant Proyecto PBCT Anillo Ciencia y Tecnología (ACT-41) and the University of Talca project Frutilla Chilena Integral. As thanks University of Talca, MeceSup and Anillo ACT-41 for Ph.D. fellowships. P.P. thanks Conicyt for a Ph.D. fellowship. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.phytochem.2010.08.005. References Aaby, K., Skrede, G., Wrolstad, R.E., 2005. Phenolic composition and antioxidant activities in flesh and achenes of strawberries (Fragaria ananassa). J. Agric. Food Chem. 53, 4032–4040. Almeida, J.R.M., D’Amico, E., Preuss, A., Carbone, F., de Vos, C.H.R., Deiml, B., Mourgues, F., Perrotta, G., Fischer, T.C., Bovy, A.G., Martens, S., Rosati, C., 2007. Characterization of major enzymes and genes involved in flavonoid and proanthocyanidin biosynthesis during fruit development in strawberry (Fragaria ananassa). Arch. Biochem. Biophys. 465, 61–71. Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Ardi, R., Kobiler, I., Jacoby, B., Keen, N.T., Prusky, D., 1998. Involvement of epicatechin biosynthesis in the activation of the mechanism of resistance of avocado fruits to Colletotrichum gloeosporioides. Physiol. Mol. Plant Pathol. 53, 269–285. Boss, P.K., Davies, C., Robinson, S.P., 1996a. Expression of anthocyanin biosynthesis pathway genes in red and white grapes. Plant Mol. Biol. 32, 565–569. Boss, P.K., Davies, C., Robinson, S.P., 1996b. Analysis of the expression of anthocyanin pathway genes in developing Vitis vinifera L. cv Shiraz grape

berries and the implications for pathway regulation. Plant Physiol. 111, 1059– 1066. Boss, P.K., Davies, C., Robinson, S.P., 1996c. Anthocyanin composition and anthocyanin pathway gene expression in grapevine sports differing in berry skin colour. Aust. J. Grape Wine Res. 2, 163–170. Carbone, F., Preuss, A., Vos, R.C.H.D., D’Amico, E., Perrotta, G., Bovy, A.G., Martens, S., Rosati, C., 2009. Developmental, genetic and environmental factors affect the expression of flavonoid genes, enzymes and metabolites in strawberry fruits. Plant Cell Environ. 32, 1117–1131. Chang, S., Puryear, J., Cairney, J., 1993. A simple and efficient method for isolating RNA from pine trees. Plant Mol. Biol. Rep. 11, 113–116. Cheel, J., Theoduloz, C., Rodriguez, J., Saud, G., Caligari, P.D.S., SchmedaHirschmann, G., 2005. E-Cinnamic acid derivatives and phenolics from Chilean strawberry fruits, Fragaria chiloensis ssp. chiloensis. J. Agric. Food Chem. 53, 8512–8518. Deluc, L., Bogs, J., Walker, A.R., Ferrier, T., Decendit, A., Merillon, J.-M., Robinson, S.P., Barrieu, F., 2008. The transcription factor VvMYB5b contributes to the regulation of anthocyanin and proanthocyanidin biosynthesis in developing grape berries. Plant Physiol. 147, 2041–2053. Dooner, H.K., Robbins, T.P., Jorgensen, R.A., 1991. Genetic and developmental control of anthocyanin biosynthesis. Annu. Rev. Genet. 25, 173–199. Espley, R.V., Hellens, R.P., Putterill, J., Stevenson, D.E., Kutty-Amma, S., Allan, A.C., 2007. Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. Plant J. 49, 414–427. Ferrer, J.-L., Austin, M.B., Stewart Jr., C., Noel, J.P., 2008. Structure and function of enzymes involved in the biosynthesis of phenylpropanoids. Plant Physiol. Biochem. 46, 356–370. Figueroa, C., Pimentel, P., Gaete-Eastman, C., Moya, M., Herrera, R., Caligari, P.D., Moya-Leon, M.A., 2008. Softening rate of the Chilean strawberry (Fragaria chiloensis) reflects the expression of polygalacturonase and pectate lyase genes. Postharvest Biol. Technol. 49, 210–220. Gil, M.I., Holcroft, D.M., Kader, A.A., 1997. Changes in strawberry anthocyanins and other polyphenols in response to carbon dioxide treatments. J. Agric. Food Chem. 45, 1662–1667. González, G., Moya, M., Sandoval, C., Herrera, R., 2009a. Genetic diversity in Chilean strawberry (Fragaria chiloensis): differential response to Botrytis cinerea infection. Span. J. Agric. Res. 7, 886–895. González, M., Gaete-Eastman, C., Valdenegro, M., Figueroa, C., Fuentes, L., Herrera, R., Moya-León, M.A., 2009b. Aroma development during ripening of Fragaria chiloensis fruit and participation of an alcohol acyltransferase (FcAAT1) gene. J. Agric. Food Chem. 57, 9123–9132. Gould, K.S., Lister, C., 2006. Flavonoid functions in plants. In: Andersen, Ø.M., Markham, K.R. (Eds.), Flavonoids, Chemistry, Biochemistry and Applications. CRC Press, Boca Raton, FL, USA, pp. 397–441. Griesser, M., Hoffmann, T., Bellido, M.L., Rosati, C., Fink, B., Kurtzer, R., Aharoni, A., Munoz-Blanco, J., Schwab, W., 2008. Redirection of flavonoid biosynthesis through the down-regulation of an anthocyanidin glucosyltransferase in ripening strawberry fruit. Plant Physiol. 146, 1528– 1539. Grotewold, E., 2006. The genetics and biochemistry of floral pigments. Annu. Rev. Plant Biol. 57, 761–780. Halbwirth, H., Puhl, I., Haas, U., Jezik, K., Treutter, D., Stich, K., 2006. Two-phase flavonoid formation in developing strawberry (Fragaria ananassa) fruit. J. Agric. Food Chem. 54, 1479–1485. Hancock, J.F., Lavín, A., Retamales, J.B., 1999. Our southern strawberry heritage: Fragaria chiloensis of Chile. HortScience 5, 814–816. Hannum, S.M., 2004. Potential impact of strawberries on human health: a review of the science. Crit. Rev. Food Sci. 44, 1–17. Holton, T.A., Brugliera, F., Tanaka, Y., 1993. Cloning and expression of flavonol synthase from Petunia hybrida. Plant J. 4, 1003–1010. Holton, T.A., Cornish, E.C., 1995. Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 7, 1071–1083. Honda, C., Kotoda, N., Wada, M., Kondo, S., Kobayashi, S., Soejima, J., Zhang, Z., Tsuda, T., Moriguchi, T., 2002. Anthocyanin biosynthetic genes are coordinately expressed during red coloration in apple skin. Plant Physiol. Biochem. 40, 955– 962. Jaakola, L., Maatta, K., Pirttila, A.M., Torronen, R., Karenlampi, S., Hohtola, A., 2002. Expression of genes involved in anthocyanin biosynthesis in relation to anthocyanin, proanthocyanidin, and flavonol levels during bilberry fruit development. Plant Physiol. 130, 729–739. Kobayashi, S., Ishimaru, M., Ding, C.K., Yakushiji, H., Goto, N., 2001. Comparison of UDP-glucose:flavonoid 3-O-glucosyltransferase (UFGT) gene sequences between white grapes (Vitis vinifera) and their sports with red skin. Plant Sci. 160, 543–550. Kobayashi, S., Ishimaru, M., Hiraoka, K., Honda, C., 2002. Myb-related genes of the Kyoho grape (Vitis labruscana) regulate anthocyanin biosynthesis. Planta 215, 924–933. Kondo, S., Hiraoka, K., Kobayashi, S., Honda, C., Terahara, N., 2002. Changes in the expression of anthocyanin biosynthetic genes during apple development. J. Am. Soc. Hort. Sci. 127, 971–976. Kosar, M., Kafkas, E., Paydas, S., Baser, K.H.C., 2004. Phenolic composition of strawberry genotypes at different maturation stages. J. Agric. Food Chem. 52, 1586–1589. Kristiansen, K.N., Rohde, W., 1991. Structure of the Hordeum vulgare gene encoding dihydroflavonol-4-reductase and molecular analysis of ANT18 mutants blocked in flavonoid synthesis. Mol. Gen. Genet. 230, 49–59.

A. Salvatierra et al. / Phytochemistry 71 (2010) 1839–1847 Lopes da Silva, F., Escribano-Bailón, M.T., Pérez Alonso, J.J., Rivas-Gonzalo, J.C., Santos-Buelga, C., 2007. Anthocyanin pigments in strawberry. LWT Food Sci Technol. 40, 374–382. Määttää-Riihinen, K.R., Kamal-Eldin, A., Torronen, A.R., 2004. Identification and quantification of phenolic compounds in berries of Fragaria and Rubus species (Family Rosaceae). J. Agric. Food Chem. 52, 6178–6187. Manning, K., 1998. Isolation of a set of ripening-related genes from strawberry: their identification and possible relationship to fruit quality traits. Planta 205, 622–631. Miranda, M., Ralph, S.G., Mellway, R., White, R., Heath, M.C., Bohlmann, J.r., Constabel, C.P., 2007. The transcriptional response of hybrid poplar (Populus trichocarpa P. deltoides) to infection by Melampsora medusae leaf rust involves induction of flavonoid pathway genes leading to the accumulation of proanthocyanidins. Mol. Plant Microbe Interact. 20, 816–831. Napoli, C.A., Fahy, D., Wang, H.-Y., Taylor, L.P., 1999. White anther: a petunia mutant that abolishes pollen flavonol accumulation, induces male sterility, and is complemented by a chalcone synthase transgene. Plant Physiol. 120, 615–622. Nielsen, K., Deroles, S.C., Markham, K.R., Bradley, M.J., Podivinsky, E., Manson, D., 2002. Antisense flavonol synthase alters copigmentation and flower color in lisianthus. Mol. Breed. 9, 217–229. Noel, J.P., Austin, M.B., Bomati, E.K., 2005. Structure–function relationships in plant phenylpropanoid biosynthesis. Curr. Opin. Plant Biol. 8, 249–253. Nyman, N.A., Kumpulainen, J.T., 2001. Determination of anthocyanidins in berries and red wine by high-performance liquid chromatography. J. Agric. Food Chem. 49, 4183–4187. Palapol, Y., Ketsa, S., Lin-Wang, K., Ferguson, I., Allan, A., 2009. A MYB transcription factor regulates anthocyanin biosynthesis in mangosteen (Garcinia mangostana L.) fruit during ripening. Planta 229, 1323–1334. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime RT-PCR. Nucl. Acids Res. 29, 45.

1847

Ryan, J.-M., Revilla, E., 2003. Anthocyanin composition of cabernet sauvignon and tempranillo grapes at different stages of ripening. J. Agric. Food Chem. 51, 3372–3378. Saud, G., Carbone, F., Perrota, G., Figueroa, C.R., Moya, M., Herrera, R., Retamales, J.B., Carrasco, B., Cheel, J., Schmeda-Hirschmann, G., Caligari, P.D.S., 2009. Transcript profiling suggests transcriptional repression of the flavonoid pathway in the white-fruited Chilean strawberry, Fragaria chiloensis (L.) Mill. Genet. Res. Crop Evol. 56, 895–903. Simirgiotis, M.J., Theoduloz, C., Caligari, P.D.S., Schmeda-Hirschmann, G., 2009. Comparison of phenolic composition and antioxidant properties of two native Chilean and one domestic strawberry genotypes. Food Chem. 113, 377–385. Tanaka, Y., Sasaki, N., Ohmiya, A., 2008. Biosynthesis of plant pigments: anthocyanins, betalains and carotenoids. Plant J. 54, 733–749. Tulipani, S., Mezzetti, B., Capocasa, F., Bompadre, S., Beekwilder, J., de Vos, C.H.R., Capanoglu, E., Bovy, A., Battino, M., 2008. Antioxidants, phenolic compounds, and nutritional quality of different strawberry genotypes. J. Agric. Food Chem. 56, 696–704. van der Meer, I.M., Stam, M.E., van Tunen, A.J., Mol, J., Stuitje, A.R., 1992. Antisense inhibition of flavonoid biosynthesis in petunia anthers results in male sterility. Plant Cell. 4, 253–262. Vian, M.A., Tomao, V., Coulomb, P.O., Lacombe, J.M., Dangles, O., 2006. Comparison of the anthocyanin composition during ripening of Syrah grapes grown using organic or conventional agricultural practices. J. Agric. Food Chem. 54, 5230– 5235. Wang, S.Y., Bunce, J.A., Maas, J.L., 2003. Elevated carbon dioxide increases contents of antioxidant compounds in field-grown strawberries. J. Agric. Food Chem. 51, 4315–4320. Yuan, Y., Chiu, L.-W., Li, L., 2009. Transcriptional regulation of anthocyanin biosynthesis in red cabbage. Planta 230, 1141–1153.