Arch Microbiol (2003) 180 : 498–502 DOI 10.1007/s00203-003-0621-9
S H O RT C O M M U N I C AT I O N
Suvit Loprasert · Ratiboot Sallabhan · Wirongrong Whangsuk · Skorn Mongkolsuk
Compensatory increase in ahpC gene expression and its role in protecting Burkholderia pseudomallei against reactive nitrogen intermediates Received: 20 June 2003 / Revised: 15 October 2003 / Accepted: 16 October 2003 / Published online: 12 November 2003 © Springer-Verlag 2003
Abstract In the human pathogen Burkholderia pseudomallei, katG encodes the antioxidant defense enzyme catalaseperoxidase. Interestingly, a B. pseudomallei mutant, disrupted in katG, is hyperresistant to organic hydroperoxide. This hyperresistance is due to the compensatory expression of the alkyl hydroperoxide reductase gene (ahpC) and depends on a global regulator OxyR. The KatG-deficient mutant is also highly resistant to reactive nitrogen intermediates (RNI). When overproduced, the B. pseudomallei AhpC protein, protected cells against killing by RNI. The levels of resistance to both organic peroxide and RNI returned to those of the wild-type when the katG mutant was complemented with katG. These studies establish the partially overlapping defensive activities of KatG and AhpC. Keywords Melioidosis · Alkyl hydroperoxide reductase · Catalase-peroxidase
Introduction Burkholderia pseudomallei is a human pathogen that can cause an acute, often fatal, septicemic melioidosis or it can remain dormant in the body for many years while retaining its ability to cause an acute septicemia at any time (Jones et al. 1996). The disease varies greatly in its clinical presentation, ranging from an asymptomatic state or a benign pneumonitis, to an acute or chronic pneumonia, or to a suppurative process and rapidly fatal illness. Currently, there is no effective vaccine for melioidosis and treatment is prolonged due to the natural resistance of the pathogen
S. Loprasert (✉) · R. Sallabhan · W. Whangsuk · S. Mongkolsuk Laboratory of Biotechnology, Chulabhorn Research Institute, Lak Si, Bangkok 10210, Thailand Tel.: +662-5740623, Fax: +662-5742027, e-mail:
[email protected] S. Mongkolsuk Department of Biotechnology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand
to many of the commonly used antibiotics. The ability of B. pseudomallei to cause a long-term latent infection suggests that it is capable of surviving in an intracellular environment. It was reported that B. pseudomallei has the capacity to invade cultured cell lines and survive inside phagocytic cells where it was found to be localized inside vacuoles in human monocyte-like U937 cells, a histiocytic lymphoma cell line with phagocytic properties (Jones et al. 1996). The two major microbicidal mechanisms for phagocyte cells are the production of reactive nitrogen intermediates (RNI), such as nitric oxide, and reactive oxygen intermediates (ROI), consisting of hydrogen peroxide, hydroxyl radical, superoxide anion, and singlet oxygen (Klebanoff and Shepard 1984; Hibbs et al. 1987). The contributions of both RNI and ROI to macrophage bactericidal activity against B. pseudomallei was examined and it was found that γ-interferon-induced microbicidal activity is mediated to a large extent by the RNI killing mechnism (Miyagi et al. 1997). Although there are many studies on oxidative stress response genes in bacteria, little is known about the role these genes play in oxidant defense in a life-threatening pathogen like B. pseudomallei. Previous studies in our laboratory indicate that OxyR, the peroxide stress global regulator, and KatG, catalase-peroxidase, play important roles in protecting B. pseudomallei against ROI toxicity (Loprasert et al. 2002, 2003). To date, the gene(s) that confer resistance to RNI in B. pseudomallei have not been identified. We compared the levels of resistance of katG and oxyR knockout strains to compounds that produce RNI. In this communication, we report that a katG knockout mutant compensates for the loss of catalaseperoxidase activity by up-regulation of alkyl hydroperoxide reductase (AhpC), which protects B. pseudomallei against killing by RNI.
Materials and methods Bacterial strains and growth conditions The clinical isolate B. psedomallei P844 and its derivatives were grown in Luria-Bertani (LB) medium. The construction of
499 B. pseudomallei knockout mutants in oxyR (strain R957), katG (strain G221) and oxyR katG (strain RG27) and their corresponding complemented strains R957TnR, G221TnG, and RG27TnRG, has been described in previous studies (Loprasert et al. 2002, 2003). Escherichia coli TA4315 is an AhpC-deficient strain (Storz et al. 1989). All cultures were grown at 37 °C. Tetracycline (60 µg/ml), chloramphenicol (40 µg/ml), spectinomycin (100 µg/ml), and erythromycin (100 µg per ml) were used, when required. Organic hydroperoxide and hydrogen peroxide sensitivity assays In order to test the susceptibility of B. pseudomallei strains to tertbutyl hydroperoxide (t-BOOH) and H2O2, disk inhibition assays were carried out as previously described (Loprasert et al. 2002, 2003). Briefly, bacterial cells from an exponential-phase culture (108 cells) were added to 3 ml warm LB top agar. The mixture was poured onto LB agar and allowed to set. Paper discs (6 mm) containing 6 µl of either 250 mM t-BOOH or 1.0 M. H2O2 were placed on the surface of the plate. Zones of growth inhibition were measured after 24 h incubation at 37 °C. Overexpression of katG in wild-type A 3-kb SmaI–HindIII DNA fragment, containing katG, was ligated into HincII–HindIII-digested pBBR-Cm vector (the broad-hostrange cloning vector pBBR1MCS) (Kovach et al. 1995) to generate pG. This was then conjugated into B. pseudomallei creating strain P844G (Loprasert et al. 2003). RNA extraction and Northern blot hybridization Extraction of total RNA, using the modified hot acid phenol method, and Northern blot analysis of mRNA were carried out as previously described (Loprasert et al. 2002). Mid-exponentialphase B. pseudomallei cultures of wild-type and katG mutants were harvested for total RNA isolation. Cloning of the ahpC promoter region The oligonucleotide primers C1 and C2, bracketing the promoter region of ahpC, were synthesized according to the genome sequence of B. pseudomallei (accessible from the Sanger Institute website: http://www.sanger.ac.uk). The C1 and C2 sequences are 5′ CTGCAGCCGAACTACAGCAGCGC 3′ and 5′ TGCACGAAGTCGCCGTTGTGG 3′, respectively. These primers were used to PCR amplify a 374-bp fragment, spanning the promoter region of ahpC, from the chromosome of B. pseudomallei P844 and its katG mutant (G221) using Pfu polymerase (Promega). The nucleotide sequences were subsequently determined.
Western blot analyses Cell lysates were prepared from fresh cell pellets using bacterial protein extraction reagent (Pierce). Protein concentration was measured by the dye binding method (Bradford 1976). AhpC was detected by Western blotting as follows: 15 µg protein was separated on SDS-PAGE gels and electrotransferred to nitrocellulose membrane. The membrane was blocked with 5% nonfat milk and reacted with anti-E. coli AhpC antibody as previously described (Mongkolsuk et al. 1997). The relative amount of AhpC in each lane was determined using a Bio-Rad GS-700 densitometer. Sensitivity to RNI The susceptibility of B. pseudomallei strains to RNI was tested as previously described (Chen et al. 1998). Overnight cultures in LB medium were used to inoculate acidified M9 minimal medium (Difco), adjusted to pH 5.0 with 1 M. HCl and supplemented with 0.5% casamino acids, to an OD600 of 0.1. Sodium nitrite was added to a final concentration of 0.5 mM and the OD600 was measured after incubation for 7 h at 37 °C with shaking. The percentage survival was calculated by comparing the absorbance of treated cultures with comparable untreated cultures.
Results Compensatory expression of ahpC Surprisingly, the katG-deficient mutant (strain G221) displayed a smaller zone of inhibition (i.e. higher level of resistance) in the presence of the organic hydroperoxide t-BOOH than that of the wild-type parental strain P844 (Fig. 1). This resistant phenotype was lost when a copy of katG was transposed into the chromosome of strain G221, yielding strain G221TnG. B. pseudomallei wild-type harboring the katG plasmid (strain P844G) did not show any altered inhibition zone relative to strain P844. Only strain G221 exhibited increased resistance to t-BOOH killing. This observation, combined with the fact that the katG oxyR double mutant (RG27) showed an unaltered resistance relative to the parental strain P844, suggested that
Cloning of the ahpC structural gene The oligonucleotide primers C3 and C4, corresponding to the N and C-terminus of ahpC, were used to PCR amplify a 560-bp fragment from the B. pseudomallei P844 chromosome that contains an NcoI site overlapping the ahpC start codon. The fragment was then sequenced to confirm the presence of the introduced restriction site as well as to check for mutations in ahpC. The C3 and C4 sequences are 5′ GTGACCATGGCGATCATC 3′ and 5′ TCAGATCTTGCCGATCAGGTC 3′, respectively. The PCR product was digested with NcoI and ligated into NcoI–EcoRV-digested pET2 (Novagen) resulting in pCET. An XbaI–SmaI ahpC fragment from pCET was ligated into XbaI–EcoICRI-digested pBBR-Cm creating plasmid pC that was then conjugated to B. pseudomallei.
Fig.1 Determination of the levels of resistance to tert-butyl hydroperoxide killing displayed by the Burkholderia pseudomallei parent strain P844 (lane 1), katG mutant G221(lane 2), katG oxyR mutant RG27 (lane 4), and their complemented strains G221TnG (lane 3) and RG27TnRG (lane 5). P844G (lane 6) is the parental strain harboring katG plasmid. Resistance levels were determined by disk inhibition assay as described in Materials and methods. Each value shown is the mean of three separate experiments
500
Fig. 3 Effect of increased expression of ahpC on the sensitivity of B. pseudomallei to tert-butyl hydroperoxide (t-BOOH) and H2O2. The resistance levels displayed by the B. pseudomallei parent strain P844, strain P844 with plasmid vector pBBR-Cm (strain P844/ vector), and strain P844 with ahpC plasmid pC (strain P844/pC) were determined by disk inhibition assay. Each value shown is the mean of values obtained in three separate experiments. Error bars Standard error of the mean Fig. 2A–C Northern and Western blot analyses of ahpC mRNA and AhpC protein from B. pseudomallei P844, katG mutant G221, and an Escherichia coli mutant deficient in AhpC. A, B Total RNA samples were extracted from uninduced cell cultures. Each lane contained 20 µg RNA. A Ethidium-bromide-stained gel. B Hybridization signals obtained when the Northern blot of the gel in A was hybridized to a radioactively labeled ahpC probe. Arrowhead mRNA transcript. C Protein lysates (15 µg each) from B. pseudomallei P844, katG mutant G221, the E. coli AhpC deficient mutant TA4315 (TA), and TA4315 harboring pC (TA/pC) were separated by SDS-PAGE, blotted, and reacted with anti-E. coli AhpC antibody as described in Material and methods. Arrow AhpC protein band
the increased resistance to organic hydroperoxide in strain G221 might be mediated by the transcription factor OxyR. Moreover, it was reasoned that altered expression of ahpC was a likely cause of the increased organic hydroperoxide resistance in strain G221 since E. coli ahpC protects cells from organic hydroperoxide and its expression is regulated by OxyR (Tartaglia et al. 1989). Therefore, it was of interest to examine whether the disruption of katG induces a compensatory increase in the expression of ahpC. Northern blotting experiments demonstrated that the katGdeficient mutant strain G221 indeed had an increased level of ahpC mRNA, compared to the expression level in the parent strain P844 (Fig. 2B). The level of AhpC in G221 was two-fold higher than in the parent strain as assayed by Western blot analysis (Fig. 2C). In Mycobacterium tuberculosis, an isoniazid-resistant katG mutant was found to compensate for the loss of KatG by the acquisition of a promoter mutation upstream of ahpC that resulted in hyperexpression of ahpC (Sherman et al. 1996). In order to check for a promoter mutation, the 5′ region of ahpC was sequenced in both the katG mutant and the parent B. pseudomallei strains. No base alterations were found (data not shown).
Protection against organic hydroperoxide by AhpC In order to test our hypothesis that increased resistance to organic hydroperoxide is due to increased ahpC expression, ahpC was amplified from the B. pseudomallei chromosome and cloned into plasmid pBBR-Cm creating plasmid pC. ahpC was then cloned into plasmid vector pBBR-Cm such that transcription of ahpC was driven by the Cm resistance cassette promoter. To verify that plasmid pC actually overproduces AhpC, Western blot analysis was carried out on an AhpC-deficient strain (E. coli TA4315) carrying pC. This was done to eliminate the endogenous AhpC band in B. pseudomallei. Plasmid pC was transformed into E. coli TA4315 and the level of AhpC expression was examined. AhpC protein was indeed overproduced as shown in Fig. 2C, lane TA/pC, whereas no AhpC band was detected in the host strain TA4315 (lane TA). The B. pseudomallei wild-type strain harboring pC (strain P844/pC), and the wild-type strain carrying the plasmid vector pBBR-Cm with no insert (strain P844/vector) were tested for their sensitivity to ROI using disk inhibition assays. Strain P844/pC showed increased resistance to t-BOOH killing compared to both the wild-type strain and strain P844/vector (Fig. 3). It is also worth noting that overproduction of AhpC in B. pseudomallei P844/ pC did not confer resistance to H2O2 (Fig. 3). This result is similar to that observed in Xanthomonas campestris, in which overproduction of AhpC did not alter the sensitivity to H2O2 (Loprasert et al. 1997). Protection against RNI by AhpC It was of interest to know whether the up-regulation of ahpC in the B. pseudomallei katG mutant enhances its
501
Discussion
Fig. 4 Survival of B. pseudomallei wild-type and derivatives exposed to reactive nitrogen intermediates (RNI). B. pseudomallei parent strain P844 (lane 1), strain P844 incubated with nitrite, pH 7.0 (lane 2), oxyR mutant R957 (lane 3), complemented oxyR mutant R957TnR (lane 4), katG mutant G221 (lane 5), complemented katG mutant G221TnG (lane 6), oxyR katG double mutant RG27 (lane 7), complemented oxyR katG mutant RG27TnRG (lane 8), wild-type ahpC overexpressing strain P844/pC (lane 9), vector control strain P844/pBBR-Cm (lane 10). Conditions used in lanes 1–10 (except in lane 2) were acidified nitrite, pH 5.0, as described in Material and methods. The results shown represent the average values of at least three independent experiments. Error bars Standard error of the mean
survival in a hostile environment similar to that within a macrophage. The katG mutant G221, together with oxyR mutant R957 and katG oxyR double mutant RG27, were tested for their sensitivity to RNI. In this experiment, mildly acidified nitrite (pH 5.0), which is similar to the environment encountered in phagolysosomes (Ehrt et al. 1997), was used. Under this condition, a small portion of nitrite is protonated to generate HNO2, which can then undergo dismutation to nitric oxide (NO), dinitrogen trioxide (N2O3), and dinitrogen tetraoxide (N2O4) (Ehrt et al. 1997). When the B. pseudomallei wild-type and mutant strains were exposed to acidified sodium nitrite (0.5 mM, pH 5.0) for 7 h, the oxyR and oxyR katG double mutants were found to be more sensitive than the wild-type strain to RNI. Surprisingly, the katG knockout mutant G221 showed increased resistance to RNI relative to wild-type (70% survival versus 51%, respectively, Fig. 4, lanes 5 and 1). This increased resistance was not observed in the katG oxyR mutant RG27, suggesting that OxyR is required in the induction process. The higher resistance to RNI in G221 was confirmed to be due to the lack of KatG since the percent survival fell below the wild-type level in the complemented strain G221TnG (39% survival for strain G221TnG, Fig. 4, lane 6). The fact that katG mutant G221 is more resistant to RNI and overexpresses ahpC mRNA led us to hypothesize that AhpC protects B. pseudomallei against RNI killing. Strain P844/pC is highly resistant to RNI, with 83% survival, indicating that AhpC directly protects B. pseudomallei from RNI toxicity (strain P844/pC, Fig. 4, lane 9). As a control, B. pseudomallei was exposed to sodium nitrite at pH 7.0 and exhibited 100% survival (Fig. 4, lane 2).
Reactive nitrogen intermediates together with ROI play various physiological roles in living cells, e.g. the activation/inactivation of transcription factors, enzymes, and ion channels; they are also able to mutate DNA and to induce apoptosis (Stamler 1995; Keefer and Wink 1996). Infected hosts use both RNI and ROI to counter infection. For these reasons, it seems likely that an intracellular pathogen like B. pseudomallei expresses genes that confer resistance not just to ROI, but also to RNI. The results presented here are direct evidence that B. pseudomallei katG mutants compensate for the loss of KatG by an oxyR-dependent increase in the expression of ahpC and that this process protects B. pseudomallei against RNI. While the mechanism of ahpC induction is unknown, the up-regulation of ahpC could be due to the absence of an antioxidant catalase-peroxidase that results in a more oxidized cellular state, which in turn activates OxyR. No mutations were found in the promoter region of ahpC that would explain the compensatory increase in ahpC expression as was observed in a katG mutant of M. tuberculosis (Sherman et al. 1996). This is reasonable since M. tuberculosis has no OxyR due to frameshifts and deletions within oxyR (Sherman et al. 1995). In order to survive during infection, Mycobacterium has acquired promoter mutations that result in hyperexpression of ahpC (Sherman et al. 1996). The protective affect of AhpC against RNI may be due to an intrinsic peroxynitritase activity. AhpC from Salmonella typhimurium has been suggested to have peroxynitritase activity (Bryk et al. 2000). Additionally, a strain of M. tuberculosis deficient in AhpC was found to be sensitive to peroxynitrite (Master et al. 2002), and AhpC from M. tuberculosis has been indirectly implicated in RNI resistance when expressed in heterologous systems such as Salmonella (Chen et al. 1998). This is the first report describing compensatory ahpC expression in a B. pseudomallei katG mutant and the role of AhpC in resistance to RNI. This finding is clinically important for developing drugs against an intracellular pathogen that has to encounter and combat a nitrosative stress environment. Acknowledgements We thank J. Dubbs for a critical review of the manuscript, G. Storz for anti-AhpC antibody, P. Munpiyamit and A. Phagakhayai for the figure preparation, and S. Korbsrisate and M. Vanaporn for technical assistance. This research was supported by grants from the Chulabhorn Research Institute and the senior research scholar RTA 4580010 grant from the Thailand Research Fund to SM.
References Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254 Bryk R, Griffin P, Nathan C (2000) Peroxynitrite reductase activity of bacterial peroxiredoxins. Nature 407:211–215 Chen L, Xie QW, Nathan C (1998) Alkyl hydroperoxide reductase subunit C (AhpC) protects bacterial and human cells against reactive nitrogen intermediates. Mol Cell 1:795–805
502 Ehrt S, Shiloh MU, Ruan J, Choi M, Gunzburg S, Nathan C, Xie Q, Riley LW (1997) A novel antioxidant gene from Mycobacterium tuberculosis. J Exp Med 186:1885–1896 Hibbs JB Jr, Taintor RR, Vavrin Z (1987) Macrophage cytotoxicity: role for L-arginine deiminase and imino nitrogen oxidation to nitrite. Science 235:473–476 Jones AL, Beveridge TJ, Woods DE (1996) Intracellular survival of Burkholderia pseudomallei. Infect Immun 64:782–790 Keefer LK, Wink DA (1996) DNA damage and nitric oxide. Adv Exp Med Biol 387:177–185 Klebanoff SJ, Shepard CC (1984) Toxic effect of the peroxidasehydrogen peroxide-halide antimicrobial system on Mycobacterium leprae. Infect Immun 44:534–536 Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM 2nd, Peterson KM (1995) Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175–176 Loprasert S, Atichartpongkun S, Whangsuk W, Mongkolsuk S (1997) Isolation and analysis of the Xanthomonas alkyl hydroperoxide reductase gene and the peroxide sensor regulator genes ahpC and ahpF-oxyR-orfX. J Bacteriol 179:3944–3949 Loprasert S, Sallabhan R, Whangsuk W, Mongkolsuk S (2002) The Burkholderia pseudomallei oxyR gene: expression analysis and mutant characterization. Gene 296:161–169 Loprasert S, Whangsuk W, Sallabhan R, Mongkolsuk S (2003) Regulation of the katG-dpsA operon and the importance of KatG in survival of Burkholderia pseudomallei exposed to oxidative stress. FEBS Letters 542:17–21 Master SS, Springer B, Sander P, Boettger EC, Deretic V, Timmins GS (2002) Oxidative stress response genes in Mycobacterium tuberculosis: role of ahpC in resistance to peroxynitrite and stage-specific survival in macrophages. Microbiology 148: 3139–3144
Miyagi K, Kawakami K, Saito A (1997) Role of reactive nitrogen and oxygen intermediates in gamma interferon- stimulated murine macrophage bactericidal activity against Burkholderia pseudomallei. Infect Immun 65:4108–4113 Mongkolsuk S, Loprasert S, Whangsuk W, Fuangthong M, Atichartpongkun S (1997) Characterization of transcription organization and analysis of unique expression patterns of an alkyl hydroperoxide reductase C gene (ahpC) and the peroxide regulator operon ahpF-oxyR-orfX from Xanthomonas campestris pv. phaseoli. J Bacteriol 179:3950–3955 Sherman DR, Sabo, PJ, Hickey MJ, Arain TM, Mahairas GG, Yuan Y, Barry CE 3rd, Stover CK (1995) Disparate responses to oxidative stress in saprophytic and pathogenic mycobacteria. Proc Natl Acad Sci USA 92:6625–6629 Sherman DR, Mdluli K, Hickey MJ, Arain TM, Morris SL, Barry CE 3rd, Stover CK (1996) Compensatory ahpC gene expression in isoniazid-resistant Mycobacterium tuberculosis. Science 272: 1641–1643 Stamler JS (1995) S-nitrosothiols and the bioregulatory actions of nitrogen oxides through reactions with thiol groups. Curr Top Microbiol Immunol 196:19–36 Storz G, Jacobson FS, Tartaglia LA, Morgan RW, Silveira LA, Ames BN (1989) An alkyl hydroperoxide reductase induced by oxidative stress in Salmonella typhimurium and Escherichia coli: genetic characterization and cloning of ahp. J Bacteriol 171:2049–2055 Tartaglia LA, Storz G, Ames BN (1989) Identification and molecular analysis of oxyR-regulated promoters important for the bacterial adaptation to oxidative stress. J Mol Biol 210:709– 719
