isolated from goose in China. SF02 was identified as a member of Newcastle disease virus (NDV) genotype. VII. NDV strains are generally pathogenic only for ...
Virus Genes 30:1, 13–21, 2005 2005 Springer Science+Business Media, Inc. Manufactured in The Netherlands.
Complete Genome Sequence and Biological Characterizations of A Novel Goose Paramyxovirus-SF02 Isolated in China* JIAN ZOU,1 SONGHUA SHAN,2 NENGTAO YAO3 & ZUXUN GONG1,y 1
Key Laboratory of Proteomics, Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China 2 Shanghai Import-&-Export Inspection and Quarantine Bureau, Shanghai, China 3 Fengxian Veterinary Station, Shanghai, China Revised June 21, 2004; Accepted July 8, 2004
Abstract. A Paramyxovirus designated as APMV-1 (NDV) Isolate SF02 (abbre. as SF02) was recently isolated from goose in China. SF02 was identified as a member of Newcastle disease virus (NDV) genotype VII. NDV strains are generally pathogenic only for fowls, including chicken and pigeon, and not for waterfowls such as goose and duck, whereas SF02 is highly pathogenic for both fowls and waterfowls. In the present study the complete genome consisting of 15, 192 nucleotides of SF02 was sequenced. Genomes of SF02 and all known APMV-1, Strains contain 6 ORFs in the order of NP-P-M-F-HN-L, and that of SF02 had an extra 6 nts between NP and P genes. Moreover, an anti-sense ORF consisting of 549 nt at the 1960 to 1412 and deduced 182 amino acids was found in SF02. The SF02 genome shared 83% identity and its 6 ORFs 81.9–86.1% identities with the reference APMV-1 strains. The possible mechanism determining different host range and pathogenicity is discussed based on genetic analyses. Key words: APMV-1 (NDV), biological characterization, genomic sequence, pathogenicity, phylogenetic, SF02
Introduction Newcastle disease is one of the most serious diseases that has caused severe economic losses of poultry. The causative agent is the Newcastle disease virus (NDV), a member of avian paramyxovirus serotype-1 (APMV-1) [1]. The virus is now placed in the genus Avulavirus of subfamily Paramyxovirinae in Paramyxoviridae [2]. All APMV-1 isolates are categorized as three pathotypes depending on the severity of disease caused, i.e., velogenic, mesogenic, and lentogenic [1]. The velogenic strains are highly pathogenic for chicken and other fowls including pigeon. Generally, *The nucleotide sequence data reported in this paper have been submitted to the GenBank nucleotide sequence database and have been assigned the accession number of AF473851. y Author for all correspondence: E-mail: gongzx@sunm. shcnc.ac.cn
APMV-1 strains are infectious to waterfowls, such as geese and ducks, without causing overt clinical symptoms. The waterfowls have shown strong resistance to APMV-1 infections and they act only as carriers of the virus [3,4]. The genomes of several APMV-1 strains and a member of avian paramyxovirus 6 (APMV-6) had been sequenced [5–8]. The APMV-1 genome is a non-segmented negative-stranded RNA consisting of 15,186 nucleotides. The genomic RNA comprises six genes that encode the nucleocapsid protein (NP), the phosphoprotein (P), the matrix protein (M), the fusion protein (F), the haemagglutinin-neuraminidase (HN), and a large polymerase protein (L). The key for APMV-1 pathogenicity is the sequence of the cleavage site of the fusion protein [9–11]. Another factor involved in the pathogenicity of APMV-1 is the length of the HN protein [12]. The HN proteins of all
14
Zhou et al.
virulent APMV-1 strains are expressed directly as active forms containing 577 or 571 amino acids, respectively, for different strains, while a HN protein precursor (HN0) containing 616 amino acids is only expressed in avirulent strains and is activated after its processing. A conserved RNA editing site is found in P gene of all members of the subfamily Paramyxovirinae. Two additional proteins (designated as V and W proteins) are produced by a RNA-editing processing (1 or 2 G template-independent insertion, respectively) in this RNA-editing site during transcription of the P gene [13]. Based on the sequence of the F gene, APMV-1 strains were phylogenetically classified into 8 genotypes, I–VIII [14–17]. The goose paramyxovirus (abbrev. as GPMV) infection outbreaks have occurred frequently since 1997 in China. The disease is featured by its high incidence and mortality rates of the poultry. In 1999, there was an outbreak of the disease in goose farms in Shanghai. The incidence and mortality rate of the disease in adult geese were 50–70% and 10–20%, respectively. The mortality rate in young geese under 15 days of age was 100%. A novel virus isolate designated as SF02 was determined as the causal agent for the disease outbreaks [18]. In this study we have characterized the isolate SF02, and compared it with other APMV-1 strains. We have determined the complete genome sequence of SF02 isolate. The phylogenetic analysis showed that it is a member of APMV-1 genotype VIIa.
Materials and Methods Biological Characterizations of SF02 Virus was isolated from a diseased goose by inoculating with the tissue homogenates into 10-day-old embryonated specific-pathogen-free (SPF) hens’ eggs [19]. The mean death time in chicken embryonated hens’ eggs (MDT) of virus was determined as described [19]. The 50% embryo-infectious dose (EID50) of virus was conducted according to the Reed–Muench method. The pathogenicity of virus in chicken was performed as following: the stock virus preparation was diluted in 1:100. One hundred microliters of each dilution was inoculated into chickens.
Number of infected chickens were calculated. Haemagglutination-inhibition (HI) tests of SF02 were carried out as described [3]. Cell Culture and Virus Infection Chicken embryo fibroblasts (CEFs) were prepared and maintained as described [20]. Goose embryo fibroblasts (GEFs) were prepared under the same condition using 17-day-old goose embryos. Cells were distributed in 24-well cell culture plates at 5 · 105 per well, and cultured for 24 h, and then infected with SF02 as described [3]. Four to six days after infection the culture medium containing dead cells and virus was discarded. The number of survival cells attached to the dishes was checked by methylthiazolydiphenyl-tetrazolium bromide (MTT) assay following manufacturer’s instructions (SIGMA). A total of 3 wells for each sample were checked and the MTT values were recorded. Virus Propagation, Purification and RNA Isolation Virus was propagated in 9- to 11-day-old embryonated SPF hens’ eggs. A total of 40 ml infected allantoic fluid was centrifuged at 3000 · g for 30 min at 4C. The supernatant was collected and centrifuged at 40,000 · g for 120 min at 4C. The pellet was resuspended in 100 ll of TNE buffer (100 mM Tris, pH 7.2, 100 mM NaCl, 1 mM EDTA). Viral RNA was extracted by Trizol reagent (Life Technologies) following manufacturer’s instructions, kept in 50 ll DEPC–H2O containing 1 ll RNase inhibitor (20 U/ll, TaKaRa) and stored at)20C until use. RT-PCR Primers and Generations of RT-PCR Fragments Thirty-one primers were designed and synthesized based on the consensus sequences of the genomes of NDV strains (La Sota, B1, and clone 30, with GenBank accession numbers AF077761, NC002617, and NDVY 18898, respectively) (Table 1). Reverse transcription (RT) was carried out at 42C for 60 min in 50 ll reaction mixture containing 10 ll of 5· AMV reverse transcriptase buffer, 2 ll dNTPs (25 mM each of four dNTPs), 1 ll AMV reverse transcriptase (10 U/ll, TaKaRa), 1 ll RNase inhibitor (20 U/ll), 5 ll of
Genome Sequence of an APMV-1 Isolate
15
Table 1. List of RT-PCR primers Name
Primer sequence (50 –30 )
Genomic site
P1A P1B P2A P2B P3A P3B P4A P4B P5A P5B P6A P6B P7A P7B P8A P8B P9A P9B P10A P10B P11A P11B P12A P12B P13A P13B P14A P14B P14C AP AAP
CGATAAAAGGCGAAGGAGCA ACTGATGCCATACCCATGGC ATGCGTTTGTATCGGATGA TTTCCGTGCTTCTCCCATGC ATTCAGAGACCAGGGCAAGT AATGATCGCACAACTGCAAC CGTCACACGGAATCCCTCGG CAGACTCTTCTACCCGTGTT TGCTTATAGTTAGTTCACCTGTC CACATAGGCTGTTGTTGGG ATCAGATGAGAGCCACTACA TAGACTGGGAACCATACGCG GGGTTTGACGGCCAATACCA TCTGCCCTTTCAGGACCGGA ATCAGCCAGTGCTCATGCGA ACATCTCAGCTGCTTGATTC TCAGGTACATTTGCAGGAGA AACATCGTAGTGTCCATCAG TCGCTCATGCCATCAATCAG TTGCTTTCTCCTACCTACAG GCAGAAGAGAAGGCATTGGC TAGCTAAGTCAAGTCTCGC TGTTGCGGTTCCTTTCGAGC GTCCCTATCCCTCTGAACAA CCAGCAAGGTATGACGCATT CCAAACAAAGATTTGGTGAATGAC CTGCGCTTTAGGTATGTCCT AGGACATACCTAAAGCGCAG CACTGTTAGCAAAGCCATCG GCTCTGATGAATGTCTTGCCACGATGCT GGCAAGACATTCATCAGAGC
25—44 1140–1121 1013–1031 2059–2040 1827–1846 3229–3210 3119–3138 4520–4501 4463–4485 6254–6236 6183–6202 7367–7348 7243—7262 8415—8396 8269—8288 9446—9427 9288—9306 10,431–10,412 10,350–10,369 11,536–11,517 11,432–11,451 12,549–12,567 12,446–12,465 13,626–13,607 13,521–13,540 15,185–15,163 14,785–14,804 14,826–14,845 433–452 – –
These were designed on the basis of the consensus sequences of genes or genomes of several APMV-1 strains (La Sota, B1, and clone 30, GenBank accession number is AF077761, NC002617, NDVY18898, respectively). AP is the anchor primer and AAP is the anti-anchor primer.
RT-primer (10 pmol/ll), 2 ll of viral RNA template and 29 ll of DEPC–H2O. PCRs were performed in 50 ll reaction mixture containing 5 ll of 10· Pyrobest DNA polymerase buffer, 4 ll dNTPs (2.5 mM each of four dNTPs), 1 ll Pyrobest DNA polymerase (5 U/ll, TaKaRa), 1 ll of each PCR primer (10 pmol/ll), 3 ll of RT products and 35 ll of ddH2O. Amplification of Genomic Termini by Ligation-anchored PCR (LA-PCR) LA-PCR protocol was performed as described with slight modifications [21]. To determine the sequence of the genomic 50 terminal end primer 14A was used to generate single-strand cDNA
with AMV reverse transcriptase as described above. Residual RNA was removed after cDNA synthesis by 5 min boiling in 12.5 ll of 150 mM NaOH and 1 ll of 0.5 M EDTA, and then neutralizing with 12.5 ll of 1 M HCl. The cDNA was purified by PCR purification kit (QIAGEN) and restored in 20 ll DEPC–H2O. Anchored-primers (AP) was phosphorylated at 50 end with T4 polynuclectide; kinase (TaKaRa) and blocked by ddCTP at 30 end using terminal deoxynucleotidyl transferase (TaKaRa) as described [22]. Ten microliters of single-stranded cDNA was ligated to 100 pmol, phosphorylated and blocked AP with T4 RNA ligase (TaKaRa) for 24 h at 15C. The ligation product was purified by PCR purification kit and used as the template of PCR. One
16
Zhou et al.
Table 2. Pathogenicity tests of SF02 isolate in poultry
Animals
No. of virus-treated
Age of animals (in days)
No. of infected animals
No. of death
Infectivity rate (%)
Mortality rate (%)
Goose Pigeon Partridge Pheasant Fraucolin Chicken Duck Keet
6 6 6 5 5 5 5 5
14 30 17 22 22 27 30 30
6 6 6 5 5 5 5 3
6 6 3 5 5 3 5 1
100 100 100 100 100 100 100 60
100 100 50 100 100 60 100 20
microliter of template and 1 ll of primer 14B (10 pmol/ll) as well as 1 ll of anti-anchored primer (AAP) (10 pmol/ll) were used in the PCR amplification with Pyrobest DNA polymerase. To determine the sequence of the genomic 30 terminal end the phosphorylated and blocked AP were ligated to the 30 end of genomic RNA of SF02 under the same condition. The ligation products were purified and used as the template of RT-PCR using primers AAP and 14C.
program in the same package. Phylogenetic tree was constructed by the software package DNASTAR with the CLUSTER V method. All the rest of data on nucleotide sequences of APMV-1 strains used in phylogenetic analysis were obtained from GenBank, with their accession numbers [15–17, 23].
Results Biological Characterizations of SF02
Cloning and Sequencing of RT-PCR Products RT-PCR products were cloned into pUC19 vector. Recombinant plasmids containing the RT-PCR products were purified and sequenced in both directions with primers flanking the inserts using an ABI 373 automatic sequencer (Perkin–Elmer). Sequencing of each genomic nucleotide of SF02 was performed no less than 3 times. Phylogenetic Analysis of Genomic Sequence The open reading frames (ORFs) were predicted using the TRANSLATION program in the software package GCG (Accelrys, SeqWeb version 2). The identity analyses of nucleotide and protein sequences were accomplished using the GAP
The virions of SF02 were spherical in shape with the size about 260 nm in diameter under the electron microscope. MDT of the virus was 48 h and EID50 was 109.6/ml. HI titers of diseased goose sera against SF02, NDV antigen (La Sota), and avian influenza (subtypes H5, H7, and H9) were 211, 26, and no reaction, respectively. Pathogenicity tests in birds had shown that SF02 was a highly pathogenic strain both for fowls and waterfowls. (Table 2). Infections of Cells SF02 infection of both CEFs and GEFs resulted in heavy cell death within 5 days (Table 3), as shown with the control, F48E9, the standard velogenic
Table 3. Survival rates of the GEFs and CEFs 5 days after infected with different APMV-1 strains as determined by MTT assays Virus strains Cells
F48E9
SF02
Komarov
La Sota
V4/66
control
CEFs GEFs
0.01 0.01
0.13 0.27
0.23 0.72
0.42 1.15
0.69 1.31
0.67 1.34
A total of 3 wells for each sample were analyzed and the average MTT calculated. Control cells were not inoculated with the virus. Differences in controls between CEFs and GEFs were due to different growth behaviors under identical cultural conditions.
Genome Sequence of an APMV-1 Isolate
APMV-1 strain in China, which also caused complete death of both cells after infection. The mesogenic strain, Komarov, induced only a partial cell death of CEFs and GEFs, and the lentogenic strain, La Sota, showed only a low mortality rate. The avirulent strain, V4/66, did not cause cell death at all. Since the virus grew much better in the GEFs than CEFs, hence the MTT value for CEFs is much lower than that of GEFs. Cloning and Sequencing of NDV SF02 Genome A total of 15 overlapping cDNA clones covering the entire genome of GPMV SF02 was obtained by RT-PCR and LA-PCR. Sequences compiled from these clones showed that SF02 genome contained 15, 192 nt (GenBank accession number AF473851), whereas the genomes of all other APMV-1 strains known were 15, 186 nt in length [5,7]. The extra 6 nts ‘‘ACACTC’’ of SF02 genome were at position 1, 652-1, 657 in the untranslational region (UTR) between NP and P genes. The genome organization of SF02 was the same as those of other APMV-1 strains [24], consisting of 6 ORFs in the order of NP-P-M-F-HN-L. The start and end positions of NP gene were consensus with other APMV-1 strains, whereas the remained five genes had their starts and ends 6 nts downstream. An anti-sense ORF containing 549 nt at genomic position 1, 960-1, 412, including the extra 6 nt fragment was found in the genome of SF02 in contrast with a very short anti-sense ORF for other APMV-1 strains (Figs 1 and 2). The flanking sequences of the AUG codon of this anti-sense ORF accorded with the Kozak sequence [25]. The cleavage site of the F protein of SF02 possessed the amino acid sequence of 112R-R-Q-K-R-F117 characteristic for the velogenic strain. The deduced amino acid sequence of the HN protein of SF02
Fig. 1. Schematic diagram of the SF02 genome with six ORFs, NP-P-M-F-HN-L- and a possible anti-sense ORF (A). An extra 6 nt fragment (B), ACACTC, is shown at the position 1, 652-1, 657 in UTR between NP and P genes. The anti-sense ORF containing the extra 6 nt fragment is located at the position 1, 960-1, 412.
17
consisted of 571 amino acids. A putative RNA editing site was found at position 2, 286-2, 293. The sequence of the editing site of SF02, UUUUUCCC, was well conformed to the conserved sequence of UU(U/C)UCCC found in all members of subfamily Paramyxovirinae [13]. The genome shared 83.1% identity with the NDV vaccine strain-La Sota. The identities of each gene shared by SF02 and La Sota were 85.2%, 82.8%, 84.7%, 84.3 %, 81.9%, and 86. 1%, respectively (Table 4). The lengths of both termini of SF02 isolate were the same as in other APMV-1 viruses. The 30 leader and 50 trailer were 55 nt and 114 nt in length, respectively (Fig. 3A and B). The leader sequence of SF02 shared high identity with other APMV-1 viruses (85.5%), but for the trailer only 69.3%. The 30 leader and 50 trailer of paramyxovirus were partially complementary and could have some roles in genomic and anti-genomic replications of the virus [8]. The complementarity was found between 30 and 50 ends of SF02 (Fig. 3C). Seventeen out of 20 terminal nucleotides were complementary to each other. Phylogenetic Analysis APMV-1 has been classified into 8 genotypes (I–VIII), based on sequence of the complete or partial F gene [14,15–17,23]. The epidemic APMV1 genotypes VI–VIII reported recently were analyzed and a phylogenetic tree was constructed. It was shown that SF02 should be ascribed to APMV-1 genotype VIIa (Fig. 4).
Discussion It has been generally acknowledged that the waterfowls such as the geese act only as APMV-1 carriers in the wild [3,26]. Takakuwa et al. [4] had isolated several APMV-1 strains containing the virulent type F cleavage site sequence from migratory waterfowls, but these are avirulent for original hosts and chickens. Bolte et al. [27] had investigated the response of domestic geese to lentogenic and velogenic NDV strains and found out that geese do not readily excrete NDVs in detectable amounts and do not contain detectable amounts of virus in their tissues 14 days after virus
18
Zhou et al.
Fig. 2. Nucleotide and deduced amino acid sequences of the anti-sense ORF in SF02 compared with the nucleotide sequence of La Sota strain. The flanking nucleotide in accordance with the Kozak sequence was underlined. Start and end codons are shown in boldface.
challenge. In contrast, SF02 was isolated from diseased geese with overt ND symptoms and pathogenicity tests had suggested that SF02 is a velogenic strain. The isolate is highly infectious to both fowls and waterfowls including geese, ducks, chickens, and pigeons, and the mortality rate is high and lethal for young birds. This is important not only for its academic interests but also for its practical implications relevant to poultry. The complete sequence of SF02 genome is composed of 15,192 nt. This number conforms to
the ‘‘rule of six’’ which had been suggested recently to play an important role in paramyxovirus replication [28,29]. The SF02 genome shares high identity with the genome of other APMV-1 viruses and other features, such as the genome organization, the cleavage site of F gene, and editing site of P gene. Therefore, we suggest that SF02 from a goose in China is one of APMV-1 strains. However, we have also noted some unique features of its genome that shows clearly some differences with other APMV-1 viruses. First, there is an extra
Genome Sequence of an APMV-1 Isolate
19
Table 4. The nucleotide identities (%) between SF02 isolate and other APMV-1 strains
SF02
NP gene (%)
P gene (%)
M gene (%)
F gene (%)
HN gene (%)
L gene (%)
Ulster2C-67 V4/66 La Sota Texas GB BeaudetteC-45 Herts-33 Taiwan95 F48E9
87.8 – 85.2 85.7 85.6 – – –
– 84.7 82.8 82.2 83.4 85.9 – 85.3
86.9 85.4 84.7 84.8 85.4 87.9 – 86.6
86.7 86.4 84.3 84.4 84.4 88.7 94.2 86.6
84.4 84.5 81.9 82.5 82.7 – 94.3 82.7
– – 86.1 – 86.4 – – 87.9
The values were calculated using GAP program in the software package GCG (Accelrys, SeqWeb version 2). Dash lines indicate that no data are available in GenBank.
6 nt fragment, ACACTC, in UTR between the NP and P genes Second, an additional anti-sense ORF containing the same extra 6 nt fragment is present. Third, 30 leader of SF02 genome shares high identity with APMV-6 and other APMV-1 viruses, whereas its 50 trailer is more variable. We have noted also that the difference in the host range between SF02 and other APMV-1
strains is somewhat related to differences in their host pathogenicities. The pathogenicity of APMV-1 is dependent on many factors, such as the cleavability of the F protein and the interactions between host and virus. Since our results of cell infections showed that there was no apparent difference in the pathogenicity in the cellular level for chicken and goose with SF02 and APMV-1, it
Fig. 3. Alignment of the 30 leader and the 50 trailer of SF02 isolate with several APMV-1 strains and APMV-6. All sequences are shown in genomic RNA-sense. (A) Alignment of the 30 leader of SF02 and APMV-1 strains. (B) Alignment of the 50 trailer of SF02 and several APMV-1 strains. (C) Paired nucleotides at 30 and 50 ends of SF02 genome are underlined.
20
Zhou et al.
Fig. 4. Phylogenic tree of SF02 isolate and recent epidemic APMV-1 based on nucleotide sequences between positions 1 and 374 of F gene. SF02 is subtyped into genotype VIIa (see text). Phylogenetic tree was constructed by the software package DNASTAR with the CLUSTER V method. Accession numbers of F genes of NDV isolates are given in references [15–17,23].
might be assumed that the difference of the host pathogenicities between APMV-1 and SF02 for the fowls and waterfowls could be traced to the regulations on the higher level than in the cellular one. More recently it had been shown that an RNA-editing process that occurs during transcription of P gene produces a V protein [13]. V protein has multiple functions, involved in virus replication and also serves probably as a virulence factor by inhibiting the activation of host interferon [30–34]. The expression of V protein is determined by the editing efficiency of P gene. Recombinant APMV-1 with low expression of V protein is avirulent for 9–11 day of age or older chicken embryos, but it is lethal for 8-day of age or younger chicken embryos. It seems therefore that the activation of interferon is age-dependent for chicken embryos [35]. Therefore, the low level of V protein is unable to inhibit the activation of interferon of older animals [34]. The present data shows that the extra 6 nt fragment of SF02 is
located between NP and P genes and at upstream of 153 nt of mRNA start site of P gene (1810), and that both NDV and SF02 could cause cells death of CEFs and GEFs. These results suggested that the difference between the sequences in the intragenic regions of HN and P genes of NDV and SF02 might cause the differences of RNA editing efficiency of P gene and of the expression of V protein and therefore, it might be one of the causes leading to differences in viral pathogenicities for fowls and waterfowls. Indeed, more studies are needed before this could be substantiated. Interestingly, an anti-sense ORF containing extra 6 nt fragment has been found in SF02 genome. It is absent in genomes of any other APMV-1 strains. The Kozak sequence flanking the AUG initiator codon of this anti-sense ORF indicated that the AUG codon could be recognized by eukaryotic ribosomes and the anti-sense ORF could be translated during the viral life cycle. Our preliminary results of Northern blot analysis with random primers on this anti-sense ORF sequence template showed that there is indeed a transcript with about 1200 bp size in CEFs infected with SF02 (data not shown). It is a firmly established fact that there are many VI–VIII genotypes among NDV isolates known that cause epidemics in chickens and pigeons all over the world [15–17,23,36–38]. Now we have SF02 of even higher calibre adding to the list and that is our commitments to work harder to find a better solution. Acknowledgments This work was supported by a grant from Shanghai Agricultural Key Promoted by Science and Technology. We are indebted to Miss JianHua Wu for her excellent assistance and to Professor Demin Su for his English revision. References 1. Alexander D.J., in Calnek B.W. (ed), Diseases of Poultry. Iowa State University Press, Ames, 1997, pp. 541–569. 2. Mayo M.A., Arch Virol 147, 1655–1656, 2002. 3. Yin Z. and Liu J.H., Animal Virology 2nd edn. Scientific Publishers, Beijing, 1997, pp. 323–435. 4. Takakuwa H., Ito T., Takada A., Okazaki K., and Kida H., Jpn J Vet Res 45, 207–215, 1998.
Genome Sequence of an APMV-1 Isolate 5. Krishnamurthy S. and Samal S.K., J Gen Virol 79, 2419– 2424, 1998. 6. Phillips R.J., Samson A.C.R., and Emmerson P.T., Arch Virol 143, 1993–2002, 1998. 7. de Leeuw O. and Peeters B.J., J GenVirol 80, 131–136, 1999. 8. Chang P.C., Hsieh M.L., Shien J.H., Graham D.A., Lee M.S., and Shien H.K., J Gen Virol 82, 2157–2168, 2001. 9. Collins M.S., Bashiruddin J.B., and Alexander D.J., Arch Virol 128, 363–370, 1993. 10. Peeters B.P.H., de Leeuw O.S., Koch G., and Giekens A.L.J., J Virol 73, 5001–5009, 1999. 11 Yu S.Q., Kishida N., Ito H., Kida H., Otsuki K., Kawaoka Y., and Ito T., Virology 301, 206–211, 2002. 12. Toyoda T., Sakaguchi T., Hirota H., Gotoh B., Kuma K., Miyata T., and Magai Y., Virology 169, 273–282, 1989. 13. Steward M., Vipond I.B., Millar N.S., and Emmerson P.T., J Gen Virol 76, 2519–2527, 1993. 14. Lomniczi B., Wehmann E., Herczeg J., Ballagi-Pordany A., Kaleta E.F., Werner O., Meulemans G., Jorgensen P.H., Mante A.P., Gielkens A.L.J., Capua I., and Damoser J., Arch Virol 143, 49–64, 1998. 15. Herczeg J., Wehmann E., Bragg R.R., Travassos D.P.M., Hadjiev G, Werner O., and Lomniczi B., Arch Virol 144, 2087–2099, 1999. 16. Yu L., Wang Z.L., Jiang Y.H., Chang L., and Kwang, J., J Clin Microbiol 39, 3512–3519; 2001. 17. Liang R., Cao D.J., Li J.Q., Chen J., Guo X., Zhuang F.F., and Duan M.X., Vet Microbiol 87, 193–203, 2002. 18. Zou J., Shan S.H., Yao N.T., and Gong Z.X., Acta Bioch Bioph Sin 34, 439–444, 2002. 19. Alexander D.J., in Purchase H.G., Arp L.H., Hitchner S.H., Domermuth C.H., and Pearson J.E., (eds), Newcastle Disease. American Association of Avian Pathologists, Texas, 1989, pp. 110–112. 20. Ferreira A., in Spector D.L., Goldman R.D., and Leinwand L.A., (eds), A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York, 1998, pp.
21
21. Schaefer B.C., Anal Biochem 227, 255–273, 1995. 22. Tessier D.C., Brousseau R., and Vernet T., Anal Biochem 158, 171–178, 1986. 23. Ke G.M., Liu H.J., Lin M.Y., Chen J.H., Tsai S.S., and Chang P.C., J Virol Methods 97, 1–11,2001. 24. Millar N.S. and Emmerson P.T., in Alexander D.J. (ed), Molecular Cloning and Nucleotide Sequencing of Newcastle Disease Virus. Kluwer Academic Publishers, Boston, 1988, pp. 79–97. 25. Kozak M., Nucleic Acids Res 9, 5233–5262, 1981. 26. Muller T., Hlinak A., Muhle R.U., Kramer M., Liebherr H., Ziedler K., and Pfeiffer D.U., Avian Dis 43, 315–319, 1999. 27. Bolte A.L., Voss M., Vielitz E., and Kaleta E.F., Deut Tierarztl Woch 108, 155–159, 2001. 28. Peeters B.P.H., Gruijthuijsen Y.K., de Leeuw O.S., and Gielkens A.L.J., Arch Virol 145, 1829–1845, 2000. 29. Kolakofsky D., Pelet T., Garcin D., Hausmann S., Curran J., and Roux L., J Virol 72, 891–899, 1998. 30. Kato A., Kiyotani K., Sakai Y., Yoshida T., Shioda T., and Nagai Y., J Virol 71, 7266–7272, 1997. 31. Didcock L., Young D.F., Goodbourn S., and Randall R.E., J Virol 73, 3125–3133, 1999. 32. Didcock L., Young D.F., Goodbourn S., and Randall R.E., J Virol 73, 9928–9933, 1999. 33. Patterson J.B., Thomas D., Lewicki H., Billeter M.A., and Oldstone M.B., Virology 267, 80–89, 2000. 34. Mebatsion T., Verstegen S., de Vaan L.T.C., RomerOberdorfer A., and Schrier C., J Virol 75, 420–428, 2001. 35. Morahan P.S. and Grossberg S.E., J Infect Dis 121, 615– 623, 1970. 36. Gould A.R., Kattenbelt J.A., Selleck P., Hansson E., DellaPorta A., and Westbury H.A., Virus Res 77, 51–60, 2001. 37. Seal B.S., King D.J., and Meinersmann R.J., Virus Res 66, 1–11, 2000. 38. Seal B.S., Crawford J.M., Sellers H.S., Locke D.P., and King D.J., Virus Res 83, 119–129, 2002.
