sequence of TNV strain D (TNV-D) reported by Coutts et al. (1991) and revised recently (Offei & Coutts, 1996) indicates the presence of five open reading frames ...
Journal of General Virology (1997), 78, 1235–1239. Printed in Great Britain ...............................................................................................................................................................................................................
SHORT COMMUNICATION
Complete nucleotide sequence of tobacco necrosis virus strain DH and genes required for RNA replication and virus movement Attila Molna! r, Zolta! n Havelda, Tama! s Dalmay, Henrietta Szutorisz and Jo! zsef Burgya! n Agricultural Biotechnology Center, Plant Science Institute, PO Box 411, 2101 Go$ do$ llo% , Hungary
The complete genome sequence of tobacco necrosis virus strain D (Hungarian isolate, TNV-DH) was determined. The genome (3762 nt) has an organization identical to that reported for TNV-D. Highly infectious synthetic transcripts from a fulllength TNV-DH cDNA clone were prepared, the first infectious necrovirus transcript reported. This clone was used for reverse genetic studies to map the viral genes required for replication and movement. Protoplast inoculation with ∆22 and ∆82 mutants revealed that both the 22 kDa and 82 kDa gene products are required for RNA replication. Although the products of three small central genes (p71, p7a and p7b) were not essential for RNA replication in protoplasts, mutations in these ORFs prevented infection of plants. In contrast, viral RNA accumulation and cell-to-cell movement were observed in the inoculated, but not the systemically infected, leaves of Nicotiana benthamiana challenged with RNA lacking the intact coat protein (CP) gene. These results strongly suggest that p71, p7a, p7b and CP are involved in TNV-DH cell-to-cell and longdistance movement, respectively.
Tobacco necrosis virus (TNV) is a small icosahedral virus which belongs to the genus Necrovirus (Russo et al., 1994). Particles of TNV contain a single-stranded positive-sense RNA genome approximately 3±8 kb long. The complete nucleotide sequence of TNV strain D (TNV-D) reported by Coutts et al. (1991) and revised recently (Offei & Coutts, 1996) indicates the presence of five open reading frames (ORFs). The genomic Author for correspondence : Jo! zsef Burgya! n. Fax36 28 430 482. e-mail burgyan!abc.hu The nucleotide sequence data reported in this paper will appear in the EMBL, GenBank and DDBJ nucleotide sequence databases under accession number U62546.
0001-4554 # 1997 SGM
RNA of TNV-D probably directs translation of both ORF1 (p22) and ORF2 (p82) from the same initiation codon, and p82 is likely to be synthesized by translational readthrough of the amber stop codon. The readthrough part of p82 contains the GDD motif typical of viral RNA polymerases (Argos, 1988). The two small ORFs located centrally in TNV-D RNA encode two different 7 kDa proteins (p7a and p7b) and the coat protein (CP) is encoded at the 3« end. The two 7 kDa proteins show limited sequence similarity with the corresponding gene products of related TNV strain A (TNV-A) (p8 and p6 ; Meulewaeter et al., 1990) and the carmovirus turnip crinkle virus (TCV) (p8 and p9 ; Carrington et al., 1989). These small proteins of TNV-A and TNV-D are thought to be involved in cell-to-cell movement (Coutts et al., 1991 ; Meulewaeter et al., 1992 ; Offei et al., 1995 ; Drouzas et al., 1996) of the two viruses, similar to that demonstrated for TCV (Hacker et al., 1992). In the present study, we provide evidence for the roles of proteins encoded by the TNV genome using a full-length infectious cDNA clone of a new TNV-D isolate (TNV-DH) found in our greenhouse associated with Cymbidium ringspot tombusvirus (CymRSV). TNV-DH was found in Nicotiana clevelandii plants infected with CymRSV. After purification of the virus through several local lesion passages in N. clevelandii, it was propagated in Nicotiana benthamiana and purified from systemically infected leaves by the procedure described for tombusviruses (Gallitelli et al., 1985). The RNA was extracted from virus particles (Dalmay et al., 1993 a) and the 3« end was polyadenylated with poly(A) polymerase (Amersham). The polyadenylated RNA was used as template for oligo(dT)primed cDNA synthesis using the cDNA System Plus (Amersham) according to the manufacturer’s protocol. Alternatively, first-strand cDNA synthesis was primed with random hexanucleotide primers using the same kit. Double-stranded DNA was ligated to SmaI-digested dephosphorylated pUC18 and cloned in Escherichia coli strain DH5α. TNV-DH-specific recombinant clones were sequenced by the dideoxy chaintermination method (Sanger et al., 1977) with T7 DNA polymerase (Sequenase, Amersham-US Biochemicals) on both strands of several independent cDNA clones. The sequence of the 5« region of TNV-DH RNA was determined by dideoxy-
BCDF
A. Molna! r and others (a)
(b)
TNV-A p6 TNV-NE p6 OLV-L p6 TNV-D p7 b TNV-DH p7 b LWSV p6 TNV-D p71 TNV-DH p71 TNV-A p7 TNV-D p7a TNV-DH p7a LWSV p11 TNV-A p8 TNV-NE p11 OLV-1 p8 TCV p8
TCV p9 Fig. 1. (a) Comparison of the genome organizations of TNV-D, -DH and -A and TCV. The ORFs for each genome are shown as boxes and the approximate sizes of the predicted proteins are indicated. ORFs encoding proteins with similar putative functions are shown with the same type of shading. rt indicates the amber stop codon of ORF1. (b) Cluster dendrograms generated by the PILEUP, DISTANCES and GROWTREE programs showing the relationship between the predicted small internal ORF products (see a) of TNV-DH (p71, p7a and p7b) and other necroviruses [TNV-D (p71, p7a and p7b ; Offei & Coutts, 1996), TNV-NE (p6 and p11 ; Zhang et al., 1993), TNV-A (p6, p7 and p8 ; Meulewaeter et al., 1990), OLV-1 (p6 and p8 ; Grieco et al., 1996) and LSWV (p6 and p11 ; Lot et al., 1996)] and TCV carmovirus (p8 and p9 ; Carrington et al., 1989).
BCDG
nucleotide-terminated reverse transcription (Zimmern & Kaesberg, 1978) primed with the oligonucleotide 5« GTTTTAGAGATTAGGGGAAGAAGAA 3«, complementary to nt 58–82 in the genomic RNA. The sequence of 3762 nt representing the TNV-DH genome included a 38 nt long 5« leader sequence followed by an initiator AUG for the first two ORFs, which extends to an amber terminator at nt 647, encoding a polypeptide of molecular mass 22 550 Da (p22). Readthrough of this stop codon would extend the frame (ORF2) to a termination codon at nt 2216, resulting in a product of 82 349 Da (p82). ORFs 3 (nt 2213–2401), 4 (nt 2251–2448) and 5 (nt 2448–2648) were predicted to encode proteins of 7162 Da (p7 ), 7501 Da (p7a) " and 7339 Da (p7b), respectively. ORF 6 begins with an AUG codon (nt 2651) and extends to a UAG codon at nt 3457, to encode the 29 015 Da CP. The 3« untranslated region is 305 nt long. The genome organization of TNV-DH is very compact. Only three non-coding nucleotides are present between ORFs 5 and 6. Moreover, ORFs 2 and 3, and ORFs 3 and 4 overlap by 3 and 150 nt, respectively. The last nucleotide of the stop codon of ORF4 is the first nucleotide of ORF5. The overall genome organization of TNV-DH clearly resembles that of necro- and carmoviruses (Fig. 1 a). The viral genome (3762 nt) has an organization similar to that reported for TNV-D (Coutts et al., 1991), except that the DH strain contains a group of three 7 kDa genes (ORFs 3, 4 and 5) instead of two small ORFs (ORFs 3 and 4) located upstream of the CP gene. However, in the recently corrected TNV-D sequence a 7 kDa gene similar to the p7 ORF of TNV-DH can " be identified, though it was not mentioned by the authors (Offei & Coutts, 1996). The complete genomic sequence of TNV-DH also allowed us to compare the amino acid sequences of each viral protein with all available sequences of TNV strains (A, D, DH), the CP sequence of TNV-Nebraska (TNVNE, Zhang et al., 1993) and two newly sequenced necroviruses : olive latent virus 1 (OLV-1 ; Grieco et al., 1996) and leek white stripe virus (LWSV ; Lot et al., 1996) and TCV (Table 1). From these comparisons, it is clear that TNV-DH has a high degree of sequence similarity with the other necroviruses, in particular with TNV-D. Multiple sequence alignments were also done between the centrally located ORFs of different TNV strains (A, D, DH, NE), OLV-1, LWSV and TCV carmovirus. Fig. 1 (b) shows that each of the three internal 7 kDa proteins of TNVDH are clustered with the corresponding proteins of TNV-D. Interestingly, the protein product (p7) of the small ORF located downstream of the TNV-A CP cistron grouped together with p7 proteins of TNV-D and -DH, which may suggest a " function for TNV-A p7 similar to p7 . The overall identity in " genome sequence (83 %) and organization indicate that TNVDH is closely related to the previously sequenced TNV-D (Coutts et al., 1991 ; revised in Offei & Coutts, 1996). The functional integrity of the TNV-DH cDNA clones was evaluated by assembling a full-length cDNA copy of the wildtype parental sequence, which permitted synthesis of full-
TNV-DH nucleotide sequence
Table 1. Percentage amino acid sequence similarity between proteins encoded by TNV-DH and the corresponding ORFs of necroviruses and TCV carmovirus
(a)
Numbers in parentheses show the percentage amino acid sequence identity. Superscript letters indicate proteins which have names other than the corresponding proteins of TNV-DH. a, LWSV p11 ; b, LWSV p6 ; c, TNV-NE p11 ; d, TNV-NE p6 ; e, TNV-A p7 ; f, TNV-A p8 ; g, TNV-A p6 ; h, OLV-1 p8 ; i, OLV-1 p6 ; j, TCV p8 ; k, TCV p9. For references see legend to Fig. 1 (b) TNV-DH proteins Virus TNV-D LWSV TNV-NE TNV-A OLV-1 TCV
p22
p82
p71
p7a
p7b
94 (85) 62 (43) — 50 (24) 48 (24) 42 (19)
95 (89) 76 (64) — 61 (40) 59 (39) 56 (35)
82 (73) — — 48 (20)e — —
95 (91) 63 (46)a 46 (19)c 44 (19)f 50 (25)h 47 (19)j
94 (89) 71 (56)b 48 (21)d 48 (21)g 48 (21)i 51 (33)k
CP 97 (95) 48 (29) 59 (45) 62 (47) 56 (41) 43 (22)
length in vitro transcripts for biological activity tests. This clone was constructed using newly prepared cDNA clones of the 5« half of the TNV-DH RNA and a clone (A67) containing approximately the last 2500 nt and the added poly(A) tail. The 5« half was cloned by priming first-strand synthesis with the oligonucleotide 5« TGATATCAACCCTCAAGGGG 3« complementary to nt 2143–2162 of the genomic RNA sequence. The cDNA was amplified by PCR using the above oligonucleotide and 5« ATCGATAATACGACTCACTATAGGATACCTTACCAGTATCTCAGTG 3«, which contained the first 24 nt of TNV-DH genomic RNA (bold) fused to a 17 nt bacteriophage T7 RNA polymerase promoter consensus sequence and five bases contributing to the formation of a ClaI restriction site (underlined italic). The major PCR product of approximately 2200 bp was cloned as described above. The resulting clones A152 and A67 contained the 5« and 3« halves of the viral genome, and were fused using the EcoRV restriction site at position 2157. The resulting fulllength cDNA clone (A172) contained the complete sequence of TNV-DH and a poly(A) tail at the 3« end. The genomic transcript of TNV-DH was designed to start with two G residues for good T7 promoter activity (Dunn & Studier, 1983). Since the A172 clone contained an A tail at #! the 3« terminus of the viral sequence, linearization was downstream using SalI, which resulted in the addition of 10 non-viral nucleotides 3«of the poly(A) tail. The RNA transcripts had a specific infectivity similar to natural viral RNA in local lesion assays on Chenopodium quinoa. Moreover, there was 100 % infection in N. benthamiana, eliciting necrotic local lesions on inoculated leaves and systemic stunting, withering and severe chlorotic mottling. These symptoms are very similar to those described for OLV-1 (Martelli et al., 1996), but
(b)
Fig. 2. Northern blot analysis of nucleic acids extracted from inoculated leaves of N. benthamiana plants (a) or protoplasts (b) inoculated with RNA transcribed from wild-type (A172) and mutant TNV-DH clones. The positions of wild-type genomic (G) and subgenomic (sg1 and sg2) RNAs are marked.
are different from necrotic infection (necrotic local lesions) elicited by TNV-D in N. benthamiana (Martelli et al., 1996). Northern blot analysis of RNA extracted from TNV-DHinfected N. benthamiana revealed the presence of genomic and subgenomic RNAs (Fig. 2 a). In order to identify more precisely the functions of the viral genome, mutants of full-length cDNA clone A172 were used to map viral genes required for movement and replication. Deletion mutants of TNV-DH were prepared from plasmid A172 by digestion with appropriate restriction enzymes. The ends were made blunt-ended with T4 DNA polymerase or Klenow enzyme and religated. The following deletion mutants were constructed (restriction sites, with their positions in parentheses) : ∆82 (XhoI, 1331}Bgl II, 1829) and ∆CP (AvaI, 2853}EcoRV, 3395). Mutant ∆22 and mutants in each initiation codon of the three small 7 kDa protein genes located internally were prepared by site-directed mutagenesis, as described by Kunkel et al. (1987) using the appropriate oligonucleotides : ∆22, in which the amber stop codon (TAG, position 647) of the 22 kDa protein was replaced with a tyrosine codon (TAC, underlined) using the oligonucleotide 5« TGGGAGAAATACGGAGGCCTAT 3« ; ∆7 , in which the initiation codon " BCDH
A. Molna! r and others
was mutated to ATA (position 2213) using the oligonucleotide 5« CTCTGGGGCATAAAAACTCACC 3« ; ∆7a, in which the initiation codon was mutated to GTG (position 2251) using the oligonucleotide 5« TCGAGTCTAGGTGGAAAATTC 3« ; ∆7b, in which the initiation codon was mutated to CTG (position 2448) using the oligonucleotide 5« TTCATTTCTGCTGAAATACAT 3«. Finally, all three oligonucleotides were used simultaneously to prepare the triple mutant ∆7 ab. " In vitro RNA transcripts of A172 mutants were prepared from Sal I-linearized template DNA, and were used to inoculate N. benthamiana plants as described previously (Dalmay et al., 1993 b). Samples of inoculated leaves were taken 2–3 days post-infection regardless of whether lesions had appeared, and 7–10 days later from upper uninoculated leaves. Inoculated plants which did not develop symptoms were kept for up to 6 weeks, and leaf samples were collected and examined periodically. Protoplasts were isolated from N. benthamiana plants and transfected with in vitro-synthesized transcripts from A172 or its mutants using the polyethylene glycol (PEG) method (Dalmay et al., 1993 b). Total RNA was extracted from 50 mg leaf tissue or 0±5¬10'®1¬10' protoplasts according to White & Kaper (1989), as modified by Dalmay et al. (1993 b). The presence of virus-related RNA was assessed by Northern blot analysis with a $#P-labelled probe prepared by nicktranslation or random priming (Sambrook et al., 1989) of a clone representing the 3«-terminal 600 nt of the TNV-DH genome. Plants inoculated with in vitro transcripts of clone ∆82 lacking a large central portion of the readthrough region of the 82 kDa ORF remained symptomless for several weeks after inoculation in four independent experiments. Furthermore, Northern blot analysis of total RNA extracted from inoculated plants (Fig. 2 a) or protoplasts (Fig. 2 b), failed to show the presence of viral RNA. However, expression of p82 alone may not be sufficient for genomic RNA replication since a mutant in which the 22 kDa amber stop codon was replaced with a tyrosine codon (∆22) also failed to replicate in both plants and protoplasts (Fig. 2 a, b). These results strongly suggest that both the 22 and 82 kDa readthrough product of ORFs 1 and 2 are essential for replication of TNV-DH RNA. Plants inoculated with in vitro-transcribed RNA from the initiation codon mutants of the three 7 kDa genes mutated singly (∆7 , 7a and ∆7b) or simultaneously (∆7 ab) failed to " " show symptoms for several weeks and total RNA extracts from inoculated leaves did not contain any detectable virusspecific RNA. In contrast, Northern blot analysis of RNA samples from protoplasts transfected with the same inoculum showed that each of the initiation codon mutants was able to replicate (Fig. 2 b). The presence of subgenomic RNAs in infected protoplasts indicated that the mutations did not interfere with viral RNA replication. It is likely, therefore, that these three small proteins are involved in cell-to-cell translocation in plants and that the virus cannot spread beyond the initial infection site when any one of them is not produced.
BCDI
The ∆CP mutant had most of the coat protein deleted (i.e. the sequence between the AvaI and EcoRV sites, nt 2853– 3395). If the truncated CP gene was expressed, a defective coat protein of approximately 7 kDa would be synthesized. N. benthamiana plants infected with in vitro transcripts of ∆CP showed large dark necrotic lesions on the inoculated leaves which were similar, if not identical, to those produced in plants inoculated with A172 RNA. The necrotic lesions produced by the ∆CP mutant grew continuously until the inoculated leaf became completely necrotized. However, the upper noninoculated leaves remained symptomless. Northern blots of RNA samples extracted from the inoculated leaves showed the presence of three virus-specific RNAs, which had the sizes expected for mutant genomic and subgenomic RNAs (Fig. 2 a). The quality of total RNA extracts from ∆CP- as well as A172infected plants was usually poor due to the very rapid (2 days post-infection) appearence of necrotic lesions on inoculated leaves. The accumulation of the ∆CP mutant in transfected protoplasts was similar to wild-type virus (Fig. 2 b), indicating that replication of the viral genome was not affected. An unusual accumulation of a small viral RNA (approximately 600 nt) was frequently observed in ∆CP-infected plants and protoplasts. At first, it was believed that this was a defective interfering RNA ; however, this RNA hybridized strongly with the 3«-specific probe (Fig. 2 a, b), but not with a nick-translated probe of a clone containing the 5« half of the viral genome (results not shown). Furthermore, repeated attempts to amplify this RNA with RT–PCR using two oligonucleotides containing the first 20 nt and a sequence complementary to the last 17 nt of the viral RNA, respectively, were unsuccessful. Based on these results this RNA was identified as the smaller subgenomic RNA of the ∆CP mutant. Sequence data revealed that p82 contained the GDD motif common to RNA-dependent RNA polymerases (Argos, 1988), suggesting that p82 is the viral replicase. However, it could not be predicted from sequence information alone whether or not other TNV-DH proteins might be required for replication. Elimination of the amber termination codon of the p22 kDa gene (∆22) prevented RNA replication. When expression of the 82 kDa protein, but not the 22 kDa protein, was prevented (∆82), replication of RNA was also blocked. This result strongly suggests that expression of both p22 and p82 is required for RNA replication, in agreement with data obtained with TCV and TNV-A (Hacker et al., 1992 ; White et al., 1995 ; Andriessen et al., 1995). By analogy with the p8 and p9 proteins of TCV (Hacker et al., 1992), it was suggested that the proteins expressed from the small centrally located ORFs of necroviruses (TNV-A and -D) may be involved in cell-to-cell movement (Coutts et al., 1991 ; Meulewaeter et al., 1992 ; Offei et al., 1995 ; Drouzas et al., 1996). This proposal has been verified by experiments in this paper in which each of the three p7 proteins of TNV-DH were shown to be required for efficient spread of the virus in inoculated plants. Nevertheless, the amino acid sequences of
TNV-DH nucleotide sequence
these small proteins do not contain the conserved motifs of movement proteins (Mushegian & Koonin, 1993). The ability of the ∆CP mutant to infect leaves indicates that CP is not essential for cell-to-cell spread. However, the ∆CP mutant was not able to infect N. benthamiana plants systemically. This behaviour indicates that TNV-DH requires its coat protein (or perhaps intact particles) for efficient longdistance movement, in a similar way to the related TCV (Hacker et al., 1992) and CymRSV (Dalmay et al., 1992 ; 1993 b). However, the CP of TCV is also required for intercellular movement in inoculated leaves of N. benthamiana (Hacker et al., 1992). We are grateful to Drs F. Grieco and M. Russo for providing their results prior to publication and Endre Barta for assistance with sequence analyses. This research was supported by a grant from the Hungarian OTKA (T17745).
References Andriessen, M., Meulewaeter, F. & Cornelissen, M. (1995). Expression of tobacco necrosis virus open reading frame 1 and 2 is sufficient for the replication of satellite tobacco necrosis virus. Virology 212, 222–224. Argos, P. (1988). A sequence motif in many polymerases. Nucleic Acids Research 16, 9909–9916. Carrington, J. C., Heaton, L. A., Zuidema, D., Hillman, B. I. & Morris, T. J. (1989). The genome structure of turnip crinkle virus. Virology 170,
219–226. Coutts, R. H. A., Rigden, J. E., Slabas, A. R., Lomonossoff, G. P. & Wise, P. J. (1991). The complete nucleotide sequence of tobacco necrosis virus
strain D. Journal of General Virology 72, 1521–1529. Dalmay, T., Rubino, L., Burgya! n, J. & Russo, M. (1992). Replication and
movement of a coat protein mutant of cymbidium ringspot tombusvirus. Molecular Plant–Microbe Interactions 5, 379–383. Dalmay, T., Russo, M. & Burgya! n, J. (1993 a). Repair in vivo of altered 3« terminus of cymbidium ringspot tombusvirus RNA. Virology 192, 551–555. Dalmay, T., Rubino, L., Burgya! n, J., Kolla! r, A. & Russo, M. (1993 b).
Functional analysis of cymbidium ringspot virus genome. Virology 194, 697–704. Drouzas, A. D., Offei, S. K. & Coutts, R. H. A. (1996). Subcellular location and expression of tobacco necrosis Necrovirus p7a protein. Journal of Phytopathology 144, 297–299. Dunn, J. J. & Studier, F. W. (1983). Complete nucleotide sequence of bacteriophage T7 DNA and the locations of T7 genetic elements. Journal of Molecular Biology 166, 477–485. Gallitelli, D., Hull, R. & Koenig, R. (1985). Relationship among viruses in the tombusvirus group : nucleic acid hybridization studies. Journal of General Virology 66, 1523–1531. Grieco, F., Savino, V. & Martelli, G. P. (1996). Nucleotide sequence of the genome of a citrus isolate of olive latent virus. Archives of Virology 141, 825–838.
Hacker, D. L., Petty, I. T. D., Wei, N. & Morris, T. J. (1992). Turnip
crinkle virus genes required for RNA replication and virus movement. Virology 186, 1–8. Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Proceedings of the National Academy of Sciences, USA 82, 488–492. Lot, H., Rubino, L., Delecolle, B., Jacquemond, M., Turturo, C. & Russo, M. (1996). Characterization, nucleotide sequence and genome
organization of leek white stripe virus, a putative new species of the genus Necrovirus. Archives of Virology 141, 2375–2386. Martelli, G. P., Yilmaz, M. A., Savino, V., Baloglu, S., Grieco, F., Gu$ ldu$ r, M. E., Greco, N. & Lafortezza, R. (1996). Properties of a citrus isolate of
olive latent virus 1, a new Necrovirus. European Journal of Plant Pathology 102, 527–536. Meulewaeter, F., Seurinck, J. & Van Emmelo, J. (1990). Genome structure of tobacco necrosis virus strain A. Virology 177, 699–709. Meulewaeter, F., Cornelissen, M. & Van Emmelo, J. (1992). Subgenomic RNAs mediated expression of cistrons located internally on the genomic RNA of tobacco necrosis virus strain A. Journal of Virology 66, 6419–6428. Mushegian, A. R. & Koonin, E. V. (1993). Cell-to-cell movement of plant viruses. Insights from amino acid sequence comparison of movement proteins and from analogies with cellular transport system. Archives of Virology 133, 239–257. Offei, S. K. & Coutts, R. H. A. (1996). Location of the 5« termini of tobacco necrosis virus strain D subgenomic mRNAs. Journal of Phytopathology 144, 13–17. Offei, S. K., Coffin, R. S. & Coutts, R. H. A. (1995). The tobacco necrosis virus p7a protein is a nucleic acid-binding protein. Journal of General Virology 76, 1493–1496. Russo, M., Burgya! n, J. & Martelli, G. P. (1994). The molecular biology of Tombusviridae. Advances in Virus Research 44, 321–428. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning : A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY : Cold Spring Harbor Laboratory. Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, USA 74, 5463–5467. White, J. L. & Kaper, J. M. (1989). A simple method for detection of viral satellite RNAs in small tissue samples. Journal of Virological Methods 23, 83–94. White, K. A., Skuzeski, J. M., Li, W., Wei, N. & Morris, T. J. (1995).
Immunodetection, expression strategy and complementation of turnip crinkle virus p28 and replication components. Virology 211, 525–534. Zhang, L., French, R. & Langenberg, W. G. (1993). Molecular cloning and sequencing of the coat protein gene of Nebraska isolate of tobacco necrosis virus : the deduced coat protein sequence has only moderate homology with those of strain A and strain D. Archives of Virology 132, 291–305. Zimmern, D. & Kaesberg, P. (1978). 5«-Terminal nucleotide sequence of encephalomyocarditis virus RNA determined by reverse transcription and chain-terminating inhibitors. Proceedings of the National Academy of Sciences, USA 75, 4257–4261. Received 21 November 1996 ; Accepted 27 January 1997
BCDJ
