Eur J Pediatr (2013) 172:1467–1473 DOI 10.1007/s00431-013-2071-y
ORIGINAL ARTICLE
Confirmation of genetic homogeneity of syndactyly type IV and triphalangeal thumb–polysyndactyly syndrome in a Chinese family and review of the literature Limeng Dai & Hong Guo & Hui Meng & Kun Zhang & Hua Hu & Hong Yao & Yun Bai
Received: 21 March 2013 / Accepted: 9 June 2013 / Published online: 22 June 2013 # Springer-Verlag Berlin Heidelberg 2013
Abstract Syndactyly type IV (SD4) is inherited in an autosomal dominant fashion and characterized by complete cutaneous syndactyly of all fingers accompanied with polydactyly. Triphalangeal thumb–polysyndactyly syndrome (TPTPS) consists of a triphalangeal thumb, polydactyly, and syndactyly and is transmitted in an autosomal dominant manner with variable expression. Genomic duplications of the long-range limb-specific cis-regulator (ZRS) cause SD4 and TPTPS. Here, we report two individuals from a Chinese family with syndactyly. One individual had overlapping clinical symptoms of TPTPS and SD4, while the other had a typical SD4 with postaxial polydactyly of the toe. Results of quantitative PCR suggested that the duplication of ZRS involved all affected individuals, and array comparative genomic hybridization detected its size as 115.3 kb. Conclusion: This work confirms the genetic homogeneity of SD4 and TPTPS. Our result expands the spectrum of ZRS duplications. TPTPS and SD4 should be considered as a continuum of phenotypes. Keywords Syndactyly type IV . Triphalangeal thumb–polysyndactyly syndrome . ZRS
L. Dai and H. Guo contributed equally to this work. L. Dai : H. Guo : H. Meng : K. Zhang : Y. Bai (*) Department of Medical Genetics, College of Basic Medical Science, Third Military Medical University, Chongqing 400038, China e-mail:
[email protected] H. Hu : H. Yao Center for Prenatal Diagnosis, Department of Obstetrics and Gynecology, Southwest Hospital, Third Military Medical University, Chongqing 400038, China
Introduction Syndactyly type IV (SD4; OMIM 186200), also known as Haas polysyndactyly, is inherited as an autosomal dominant trait and characterized by complete cutaneous syndactyly of all fingers, often accompanied by polydactyly. Hands of patients had a cup-shaped appearance due to flexion of fingers. SD4 is extremely rare and has been rarely reported since the first description by Haas in 1940 [8, 16, 18, 21]. Initially, the location of SD4 was mapped to 7q36, but the study failed to identify any pathogenic mutations when analyzing corresponding candidate genes [18]. Triphalangeal thumb–polysyndactyly syndrome (TPTPS; OMIM 174500) is transmitted in an autosomal dominant manner with variable expression and consisted of triphalangeal thumb, polydactyly, and syndactyly. Linkage analysis placed the TPTPS locus in the 7q36 region [22]. Subsequent studies demonstrated that genomic duplications containing the zone of polarizing activity regulatory sequence (ZRS) were responsible for human SD4 and TPTPS in Chinese families [21, 26]. The ZRS is a long-range limb-specific sonic hedgehog (SHH) enhancer on chromosome 7q36.3, which lies within intron 5 of the LMBR1 gene, approximately 1 Mb from the target gene SHH [13, 14]. SHH is a major determinant of the identity and numbers of digits in early limb development, which is produced and secreted by the ZPA [10]. The growing evidence suggested that isolated malformations can be caused by changes to gene regulatory sequences that affect the expression of important developmental genes [24]. There are at least six phenotypes associated with ZRS at present. These include various forms of preaxial polydactyly (PPD), triphalangeal thumb with or without additional supernumerary digits, complex polysyndactyly like TPTPS and SD4, and those that include more proximal limb malformations
1468
such as tibial hypoplasia and Werner mesomelic syndrome (WMS) [12, 24]. Here, we report a Chinese family with clinical signs of TPTPS and SD4. Array comparative genomic hybridization (CGH) suggested a duplication of ∼115.3 kb in the ZRS. Our study adds new information on the clinical aspects and confirms the genetic homogeneity of TPTPS and SD4.
Material and methods Patients A two-generation Chinese family in which two individuals were affected by different limb malformations was investigated (Fig. 1). All of the patients examined were mentally normal. Venous blood samples were collected from all individuals in this family with their informed consent and approval from the Third Military Medical University Ethics Committee (Chongqing, China). Another 50 healthy individuals were used as controls. Extraction of DNA from whole blood Extraction of genomic DNA was performed using Wizard Genomic DNA Purification Kit (Promega, USA) according to the protocol. The quantity and quality of DNA were determined by using NanoDrop 1000 (Thermo, USA). Real-time quantitative PCR The quantitative PCR (qPCR) was performed to confirm ZRS duplication based on the ΔΔCT method. Two amplicons in ZRS were designed (amplicon-1 F: AAGGTTTTGCC TGGACATCTTG, R: AAGTTTTCCCAGGCTTCCTA ATG; amplicon-2 F: GCGGATGCAGAGCTTGAATT, R: TGCCACGGTAAGAAGAGAGAAG). The qPCR was performed in a total volume of 20 μl in each tube containing 10 μl of SYBR premix Ex Tap (TaKaRa), 1 μl of genomic DNA, 1 μl of primers, and 8 μl ddH2O with five replicates per sample. Reactions were run in Bio-Rad IQ5. For real-time PCR, the reaction was initiated at 95 °C for 3 min for initial template denaturation, followed by a cycling
Fig. 1 Pedigree of the family with limb malformation. The proband was indicated by the arrow
Eur J Pediatr (2013) 172:1467–1473
protocol (95 °C for 15 s, 61 °C for 15 s, and 72 °C for 20 s) for 30 cycles and a final elongation (72 °C for 1 min). After the final cycle, melt curve analysis was performed to confirm amplification specificity. Array CGH Array CGH was carried out using the Roche NimbleGen Genome-Wide array CGH 3*720 K containing over 720,000 copy number probes. Genomic DNA samples were genotyped at the CapitalBio Corporation (Beijing, China) with the CGH array in accordance with the manufacturer’s protocols. Genotype calling, genotyping quality control, and copy number variation (CNV) identification were performed with the Roche NimbleGen SignalMap software.
Results Clinical report The proband (I-2) was a 29-year-old female. Bilateral triphalangeal thumb, hexadactyly, and syndactyly were observed in her hands. The syndactyly of the left hand was between 2/3 and 4/5/6 fingers. The right hand also had six fingers, but the second finger had been removed by surgical treatment. Syndactyly of the right hand was between 2/3/4/5 fingers. In addition, this individual had a triphalangeal extra preaxial toe on the right foot (Fig. 2a). Another affected individual (II-1) had bilateral complete syndactyly with flexion of fingers, cup-shaped hands, and polydactyly. The patient had received surgical treatment. The sixth toe on the right foot was observed, but the excess toe is postaxial, which is different from his mother (I-2). In addition, we did not find any abnormalities of the hands and feet in individuals I-1 and II-2. Finally, II-1 was diagnosed with SD4, while the hexadactyly of I-2 with severe syndactyly was an intermediate phenotype between TPTPS and SD4 (Fig. 2b). Variant detection The detection of the relative copy number (RCN) of the ZRS was based on the ΔΔCT method. We examined all family members and detected an RCN of 1.5 in affected individuals, indicating that the ZRS was duplicated, while the duplication was not detected in unaffected family members and unrelated Han Chinese controls, confirming cosegregation of the aberration and suggesting full penetrance of the disorder in the described family (Fig. 3). For precisely detecting the breakpoints in the case, we performed CNV and loss of heterozygosity analyses on two
Eur J Pediatr (2013) 172:1467–1473
1469
Fig. 2 Photographs and radiographs of proband I-2 and her son (II-1). a Bilateral triphalangeal thumb, syndactyly of the hand, and preaxial polydactyly of the hands and right foot were observed in I-2. b Cup-
shaped hands were observed according to the photograph after surgery and the radiograph before surgery. A postaxial toe also was observed in the right foot
samples of I-2 and II-2 (unaffected) using the Roche NimbleGen Genome-Wide array CGH. A duplication covering ∼115.3 kb segment from chr7:156,505,616 to 156,620,919 and involving LMBR1 (Fig. 4b) was found in patient I-2, while no copy number variant in this region was detected in II-2.
limb bud of mice with a deleted ZRS displays a severe truncation of all distal skeletal elements [17]. The role of the ZRS in limb development has been interpreted as a positive regulator driving Shh expression in the posterior limb bud as well as a repressor that silences the anterior expression [21]. The variants of ZRS involved various phenotypes, and the primary genotype–phenotype correlation according to type of ZRS mutation was observed by reviewing previous research as follows: Point mutations and a small insertion within the ZRS predominantly cause PPD2, specific point mutations of position 404 are found in WMS, and duplications lead to SD4 or TPTPS [1, 12, 24, 25]. More complete information about the ZRS mutations and the outcome are shown in Tables 1 and 2 on the basis of the reviews by Ahituv et al. and Wieczorek et al. [24, 25]. Previous studies have provided genetic evidence that these limb malformations represent a phenotypic continuum. TPTPS and PPD are reflected not only by the triphalangeal thumb; syndactyly of 4/5 fingers had been also described in two affected individuals of a large Dutch family with PPD2/PPD3 [27]. SD4 and TPTPS showed more severe phenotypes and phenotypic overlap between or within families. For example, there was an affected individual exhibiting an apparent SD4 phenotype in a family with TPTPS described by Balci et al. [4], and a similar phenomenon was reported by Sun et al. [21]. Interestingly, I-2 exhibited an intermediate phenotype between TPTPS and SD4, while her son (II-1) showed a typical SD4 phenotype in our cases. These examples suggest that genetic homogeneity is also responsible for TPTPS and SD4. Duplications containing the ZRS region result in a spectrum ranging from TPTPS to SD4. Moreover, it is worth noting that the varied appearance of toe malformations could be observed in the family carrying the ZRS duplication. As we know, the individual carrying the ZRS point mutation showed preaxial
Discussion SHH plays a key role in determining the number of digits in early limb development. It is produced and secreted by the ZPA, which is located on the posterior side of a limb bud in an embryo. Changes of SHH expression could lead to a spectrum of severity of embryonic events from a biphalangeal thumb (minor anterior SHH expression), the opposable triphalangeal thumb, thumb polydactyly with a triphalangeal component, thumb triplication, and thumb polydactyly with syndactyly (moderate increase in SHH enhancement) to radius hypoplasia (significant increase in SHH ectopic expression) [1]. Loss of SHH expression in the
Fig. 3 The qPCR assay confirming ZRS duplication in all family members and unrelated healthy controls. The duplication was seen as a 0.5-fold normalized RCN in affected individuals (I-2 and II-1)
1470
Eur J Pediatr (2013) 172:1467–1473
Fig. 4 a Genomic position of SHH and ZRS corresponding to hg19 reference sequence (chr7: 155,501,950–156,859,019). The ZRS is a longrange limb-specific SHH enhancer which lies within intron 5 of the LMBR1 gene, approximately 1 Mb from the target gene SHH. Image generated using the UCSC genome browser. Annotated ZRS duplications
were shown by black rectangles. Arabic numerals indicated the number of the family in Table 1. b Plots of the copy number for individual SNP loci corresponding to the position of A, showing a 115,304-bp duplication involving chr7:156,505,616–156,620,919 at 7q36.3 in the affected member, I-2
polydactyly, and we did not observe postaxial polydactyly in them. However, the unconventional phenotype appeared when the ZRS duplication was present. Postaxial polydactyly
of feet was observed in the family described by Balci et al., and the individual in our case carried the ZRS duplication. The interesting phenotype is hard to explain
Table 1 Overview of all annotated ZRS duplication in patients Number Family name
Location (hg19)
Size of duplication
Phenotype
Authors and reference
1
Family, Klopocki
∼589 kb
TPTPS
Klopocki et al. [11]
2
Family 6, Sun
∼459 kb
TPTPS,SD4
Sun et al. [21]
3
Family 2, Sun
∼437 kb
TPTPS,SD4
Sun et al. [21]
4
Family 5, Sun
∼378 kb
TPTPS,SD4
Sun et al. [21]
5
Family 4, Sun
∼334 kb
TPTPS
Sun et al. [21]
6
Family 3, Sun
∼265 kb
TPTPS,SD4
Sun et al. [21]
7
∼293 kb
SD4, tibial hypoplasia
8
Family 3, Wieczorek Family, Dai
∼115 kb
Family 1,Sun
∼160 kb
TPTPS,SD4, PAP of toe TPTPS
Wieczorek et al. [25], Gillessen-Kaesbach et al. [8] Present study
9
Sun et al. [21]
10
Family, Wu
∼97 kb
SD4, tibial hypoplasia
Wu et al. [26], Sato et al. [18]
11
Family 4, Wieczorek
∼chr7:156,143,386– 156,732,204 ∼chr7:156,241,020– 156,699,998 ∼chr7:156,241,020– 156,677,759 ∼chr7:156,241,020– 156,619,399 ∼chr7:156,354,085– 156,687,613 ∼chr7:156,354,085– 156,619,399 ∼chr7:156,368,541– 156,661,877 ∼chr7:156,505,616– 156,620,919 ∼chr7:156,539,605– 156,699,998 ∼chr7:156,547,469– 156,644,074 ∼chr7:156,572,751– 156,661,877
∼89 kb
TPTPS,SD4, PAP of toe
Wieczorek et al. [25], Balci et al. [4]
PAP postaxial polydactyly
Eur J Pediatr (2013) 172:1467–1473
1471
Table 2 SHH ZRS enhancer (∼chr7:156,583,562-156,584,711) mutations (point mutation, insertion, and translocation) known in human patients Number
Mutation
Mutation type
Location (hg19)
Phenotype
Authors and reference
1 2 3
ZRS739 A>G ZRS621 C>G ZRS619 C>T
Point mutation Point mutation Point mutation
chr7:156,583,831 chr7:156,583,949 chr7:156,583,947
Gurnett et al. [9] Gurnett et al. [9] Al-Qattan et al. [2]
4
ZRS603ins TAAGGAAGTGATT ZRS463 T>G ZRS404 G>C ZRS404 G>A ZRS404 G>A ZRS404 G>A ZRS396 C>T ZRS334 T>G ZRS329 T>C ZRS305 A>T ZRS297 G>A ZRS295 T>C ZRS287 C>A ZRS105 C>G t(5; 7)(q11; q36)
Insertion
NG_009240.1: g. 106934_106935 chr7:156,584,107 chr7:156,584,166 chr7:156,584,166 chr7:156,584,166 chr7:156,584,166 chr7:156,584,174 chr7:156,584,236 chr7:156,584,241 chr7:156,584,266 chr7:156,584,273 chr7:156,584,275 chr7:156,584,283 chr7:156,584,465 chr5 and Chr7
PPD, TPT PPD, TPT PPD, TPT, absent thumb and radius PPD, TPT
Laurell et al. [12]
PPD, TPT WMS WMS PPD WMS PPD, TPT, SD PPD PPD PPD PPD TPT TPT, PPD, PAP PPD PPD, TPT
Farooq et al. [6] Wieczorek et al. [25] Wieczorek et al. [25] Lettice et al. [13] Cho et al. [5] Semerci et al. [19] Albuisson et al. [3] Lettice et al. [13] Lettice et al. [13] Albuisson et al. [3] Furniss et al. [7] VanderMeer et al. [23] Lettice et al. [13] Lettice et al. [14]
5 6 7 8 9 10 11 12 13 14 15 16 17 18
Point mutation Point mutation Point mutation Point mutation Point mutation Point mutation Point mutation Point mutation Point mutation Point mutation Point mutation Point mutation Point mutation translocation
TPT triphalangeal thumb
according to current genotype–phenotype data and also indicates the complexity of ZRS-associated human limb malformations. ZRS (∼chr7:156,583,562–156,584,711), an enhancer of SHH, is generally thought to function through the recruitment of transcription factors and subsequent physical interactions with the gene promoter [15, 24]. Experiments in mice and chickens with PPD due to ZRS mutations have shown that these mutations can alter regulatory functions, causing ectopic anterior expression of SHH and increased posterior messenger RNA expression levels. A complete deletion of the ZRS region caused acheiropodia, a limb truncation phenotype in mice, which was reported by Sagai et al.; however, the resulting phenotype has not yet been reported in humans [17]. A 17-bp insertion could create new binding sites according to computational transcription factor-binding site prediction software, and a mouse enhancer assay demonstrated that the insertion causes ectopic gene expression [12]. The duplication of the ZRS results in more binding sites and thus more bound protein, possibly leading to an augmented and/or erroneous SHH expression in the limb bud. The newly recruited proteins may either activate or repress binding to the ZRS, thus modulating the regulation. However, the mechanisms by which ZRS variants result in limb malformations have not been fully elucidated. Some interesting phenotypes also need further interpretation, such as the fact that not all cases of familial PPD are caused by ZRS mutations, and hence, there might be another limb-
specific regulatory element of the SHH gene [1]. The human ZRS duplication phenotype is very different from the Sasquatch mouse (also named ssq mouse) phenotype, which also has a duplicated ZRS, but shows only polydactyly with no fusion of the digits [20]. Also, there is inconsistency surrounding the pre- or postaxial polydactyly of feet between some individuals carrying the ZRS duplication. To date, there have been at least 11 duplications identified in the ZRS, including the case reported here [24]. Reported duplications of the ZRS are of different sizes without recurrent breakpoints (Fig. 4); an approximate overlap was chr7:156,572,751–156,619,399. There is no obvious genotype–phenotype correlation concerning the size of the duplications. The various phenotypes in humans and distinguishing phenotypes in the ssq mouse further indicated the complexity of duplications of ZRS. However, the conditions of overlapping SD4 and TPTPS with family members indicated that it may share an identical molecular cause. The precise molecular mechanism as to how a duplicated ZRS region, single nucleotide alteration, or a small insertion within the ZRS lead to SHH misexpression is unresolved. The simple mechanism could not explain the fact that some families with ZRS variation have variable phenotypes among affected individuals, such as reduced penetrance, and phenotype heterogeneity. Normal limb development requires the coordinated determination of complex development-related molecules. Some development-related genes may interfere with the changes of protein network as a result of the ZRS duplication,
1472
thus leading to some unconventional phenotypes such as postaxial polydactyly of the toes. The heterogeneity may also partly be associated with complex environmental factors and other genetic factors such as polymorphisms and epigenetic regulation. Therefore, it is necessary to compare the expression profiles of SHH in patients with different point mutations or small insertions versus duplications in the future. In conclusion, we report two individuals from a Chinese family with syndactyly; one individual has overlapping clinical signs of TPTPS and SD4, and the other is a typical SD4 case. A duplication of the ZRS (∼115.3 kb) was identified in affected individuals; therefore, our work expands the spectrum of ZRS variants. TPTPS and SD4 should be considered as a continuum of phenotypes. Acknowledgments We thank the families for their cooperation and participation in this study. This work was supported by the National Natural Science Foundation of China Fund (81171678) and Natural Science Foundation of Chongqing (CSTC2011jjA10080). Conflict of interest None.
References 1. Al-Qattan MM (2013) Preaxial polydactyly of the upper limb viewed as a spectrum of severity of embryonic events. Ann Plast Surg. doi:10.1097/SAP.0b013e318248b67f 2. Al-Qattan MM, Al Abdulkareem I, Al Haidan Y, Al Balwi M (2012) A novel mutation in the SHH long-range regulator (ZRS) is associated with preaxial polydactyly, triphalangeal thumb, and severe radial ray deficiency. Am J Med Genet A 158A(10):2610– 2615. doi:10.1002/ajmg.a.35584 3. Albuisson J, Isidor B, Giraud M, Pichon O, Marsaud T, David A, Le Caignec C, Bezieau S (2011) Identification of two novel mutations in Shh long-range regulator associated with familial pre-axial polydactyly. Clin Genet 79(4):371–377. doi:10.1111/j.1399-0004.2010.01465.x 4. Balci S, Demirtas M, Civelek B, Piskin M, Sensoz O, Akarsu AN (1999) Phenotypic variability of triphalangeal thumb-polysyndactyly syndrome linked to chromosome 7q36. Am J Med Genet 87(5):399–406. doi:10.1002/(SICI)1096-8628(19991222)87:5 3.0.CO;2-A 5. Cho TJ, Baek GH, Lee HR, Moon HJ, Yoo WJ, Choi IH (2013) Tibial hemimelia-polydactyly-five-fingered hand syndrome associated with a 404 G>A mutation in a distant sonic hedgehog cisregulator (ZRS): a case report. J Pediatr Orthop B 22(3):219–221. doi:10.1097/BPB.0b013e32835106b2 6. Farooq M, Troelsen JT, Boyd M, Eiberg H, Hansen L, Hussain MS, Rehman S, Azhar A, Ali A, Bakhtiar SM, Tommerup N, Baig SM, Kjaer KW (2010) Preaxial polydactyly/triphalangeal thumb is associated with changed transcription factor-binding affinity in a family with a novel point mutation in the long-range cis-regulatory element ZRS. Eur J Hum Genet 18(6):733–736. doi:10.1038/ejhg.2009.225 7. Furniss D, Lettice LA, Taylor IB, Critchley PS, Giele H, Hill RE, Wilkie AO (2008) A variant in the sonic hedgehog regulatory sequence (ZRS) is associated with triphalangeal thumb and deregulates expression in the developing limb. Hum Mol Genet 17(16):2417–2423. doi:10.1093/hmg/ddn141
Eur J Pediatr (2013) 172:1467–1473 8. Gillessen-Kaesbach G, Majewski F (1991) Bilateral complete polysyndactyly (type IV Haas). Am J Med Genet 38(1):29–31. doi:10.1002/ajmg.1320380108 9. Gurnett CA, Bowcock AM, Dietz FR, Morcuende JA, Murray JC, Dobbs MB (2007) Two novel point mutations in the long-range SHH enhancer in three families with triphalangeal thumb and preaxial polydactyly. Am J Med Genet A 143(1):27–32. doi:10.1002/ajmg.a.31563 10. Hill RE (2007) How to make a zone of polarizing activity: insights into limb development via the abnormality preaxial polydactyly. Dev Growth Differ 49(6):439–448. doi:10.1111/j.1440-169X.2007.00943.x 11. Klopocki E, Ott CE, Benatar N, Ullmann R, Mundlos S, Lehmann K (2008) A microduplication of the long range SHH limb regulator (ZRS) is associated with triphalangeal thumb-polysyndactyly syndrome. J Med Genet 45(6):370–375. doi:10.1136/jmg.2007.055699 12. Laurell T, Vandermeer JE, Wenger AM, Grigelioniene G, Nordenskjold A, Arner M, Ekblom AG, Bejerano G, Ahituv N, Nordgren A (2012) A novel 13 base pair insertion in the sonic hedgehog ZRS limb enhancer (ZRS/LMBR1) causes preaxial polydactyly with triphalangeal thumb. Hum Mutat 33(7):1063–1066. doi:10.1002/humu.22097 13. Lettice LA, Heaney SJ, Purdie LA, Li L, de Beer P, Oostra BA, Goode D, Elgar G, Hill RE, de Graaff E (2003) A long-range Shh enhancer regulates expression in the developing limb and fin and is associated with preaxial polydactyly. Hum Mol Genet 12(14):1725– 1735 14. Lettice LA, Horikoshi T, Heaney SJ, van Baren MJ, van der Linde HC, Breedveld GJ, Joosse M, Akarsu N, Oostra BA, Endo N, Shibata M, Suzuki M, Takahashi E, Shinka T, Nakahori Y, Ayusawa D, Nakabayashi K, Scherer SW, Heutink P, Hill RE, Noji S (2002) Disruption of a long-range cis-acting regulator for Shh causes preaxial polydactyly. Proc Natl Acad Sci U S A 99(11):7548–7553. doi:10.1073/pnas.112212199 15. Levine M (2010) Transcriptional enhancers in animal development and evolution. Curr Biol 20(17):R754–R763. doi:10.1016/j.cub. 2010.06.070 16. Rambaud-Cousson A, Dudin AA, Zuaiter AS, Thalji A (1991) Syndactyly type IV/hexadactyly of feet associated with unilateral absence of the tibia. Am J Med Genet 40(2):144–145. doi:10.1002/ ajmg.1320400204 17. Sagai T, Hosoya M, Mizushina Y, Tamura M, Shiroishi T (2005) Elimination of a long-range cis-regulatory module causes complete loss of limb-specific Shh expression and truncation of the mouse limb. Development 132(4):797–803. doi:10.1242/dev.01613 18. Sato D, Liang D, Wu L, Pan Q, Xia K, Dai H, Wang H, Nishimura G, Yoshiura K, Xia J, Niikawa N (2007) A syndactyly type IV locus maps to 7q36. J Hum Genet 52(6):561–564. doi:10.1007/s10038007-0150-5 19. Semerci CN, Demirkan F, Ozdemir M, Biskin E, Akin B, Bagci H, Akarsu NA (2009) Homozygous feature of isolated triphalangeal thumb-preaxial polydactyly linked to 7q36: no phenotypic difference between homozygotes and heterozygotes. Clin Genet 76(1):85–90. doi:10.1111/j.1399-0004.2009.01192.x 20. Sharpe J, Lettice L, Hecksher-Sorensen J, Fox M, Hill R, Krumlauf R (1999) Identification of sonic hedgehog as a candidate gene responsible for the polydactylous mouse mutant Sasquatch. Curr Biol 9(2):97–100 21. Sun M, Ma F, Zeng X, Liu Q, Zhao XL, Wu FX, Wu GP, Zhang ZF, Gu B, Zhao YF, Tian SH, Lin B, Kong XY, Zhang XL, Yang W, Lo WH, Zhang X (2008) Triphalangeal thumb-polysyndactyly syndrome and syndactyly type IV are caused by genomic duplications involving the long range, limb-specific SHH enhancer. J Med Genet 45(9):589–595. doi:10.1136/jmg.2008.057646 22. Tsukurov O, Boehmer A, Flynn J, Nicolai JP, Hamel BC, Traill S, Zaleske D, Mankin HJ, Yeon H, Ho C et al (1994) A complex bilateral polysyndactyly disease locus maps to chromosome 7q36. Nat Genet 6(3):282–286. doi:10.1038/ng0394-282
Eur J Pediatr (2013) 172:1467–1473 23. VanderMeer JE, Afzal M, Alyas S, Haque S, Ahituv N, Malik S (2012) A novel ZRS mutation in a Balochi tribal family with triphalangeal thumb, pre-axial polydactyly, post-axial polydactyly, and syndactyly. Am J Med Genet A 158A(8):2031–2035. doi:10.1002/ajmg.a.35473 24. VanderMeer JE, Ahituv N (2011) cis-Regulatory mutations are a genetic cause of human limb malformations. Dev Dyn 240(5):920– 930. doi:10.1002/dvdy.22535 25. Wieczorek D, Pawlik B, Li Y, Akarsu NA, Caliebe A, May KJ, Schweiger B, Vargas FR, Balci S, Gillessen-Kaesbach G, Wollnik B (2010) A specific mutation in the distant sonic hedgehog (SHH) cis-regulator (ZRS) causes Werner mesomelic syndrome (WMS) while complete ZRS duplications underlie Haas type polysyndactyly and preaxial polydactyly (PPD)
1473 with or without triphalangeal thumb. Hum Mutat 31(1):81– 89. doi:10.1002/humu.21142 26. Wu L, Liang D, Niikawa N, Ma F, Sun M, Pan Q, Long Z, Zhou Z, Yoshiura K, Wang H, Sato D, Nishimura G, Dai H, Zhang X, Xia J (2009) A ZRS duplication causes syndactyly type IV with tibial hypoplasia. Am J Med Genet A 149A(4):816–818. doi:10.1002/ ajmg.a.32740 27. Zguricas J, Heus H, Morales-Peralta E, Breedveld G, Kuyt B, Mumcu EF, Bakker W, Akarsu N, Kay SP, Hovius SE, HerederoBaute L, Oostra BA, Heutink P (1999) Clinical and genetic studies on 12 preaxial polydactyly families and refinement of the localisation of the gene responsible to a 1.9 cM region on chromosome 7q36. J Med Genet 36(1):32–40
