Lipids (2014) 49:15–24 DOI 10.1007/s11745-013-3869-0
ORIGINAL ARTICLE
Conjugated Linoleic Acid (t-10, c-12) Reduces Fatty Acid Synthesis de Novo, but not Expression of Genes for Lipid Metabolism in Bovine Adipose Tissue ex Vivo Seong Ho Choi • David T. Silvey • Bradley J. Johnson • Matthew E. Doumit • Ki Yong Chung • Jason E. Sawyer Gwang Woong Go • Stephen B. Smith
•
Received: 21 May 2013 / Accepted: 18 November 2013 / Published online: 30 November 2013 Ó AOCS 2013
Abstract We hypothesized that exogenous fatty acids, and especially or 18:2 trans-10, cis-12 conjugated linoleic acid (CLA), would decrease adipogenic and lipogenic gene expression and de novo fatty acid biosynthesis in intramuscular (i.m.) and subcutaneous (s.c.) adipose tissues. Fresh i.m. and s.c. adipose tissues were collected from the longissimus thoracis muscle of Angus steers at 12, 14, and 16 months of age (n = 4 per time point). Adipose tissue explants were incubated in duplicate for 48 h with 40 lM a-linolenic (ALA), oleic, stearic, trans-vaccenic, or CLA. Adipocyte size, acetate and glucose incorporation into fatty acids in vitro and mRNA levels for C/EBPb, CPT1b, GPR43, PPARc, PRKAA1 (AMPKa) and SCD1 were measured following the incubations. PRKAA1 and SCD1gene expression were greater (P \ 0.001) in s.c. adipose tissue than in i.m. adipose tissue and acetate incorporation into lipids and C/EBPb, PPARc, and SCD1gene expression were greater at 16 months of age than at 12 months of age in i.m. adipose (P \ 0.01). C/EBPb gene expression increased by 16 months of age and PRKAA1 gene expression decreased by S. H. Choi and D. T. Silvey are co-first authors. S. H. Choi Department of Animal Science, Chungbuk National University, Chungbuk 361-763, Korea D. T. Silvey J. E. Sawyer G. W. Go S. B. Smith (&) Department of Animal Science, Texas A&M University, College Station, TX 77843-2471, USA e-mail:
[email protected]
16 months of age in s.c. adipose tissue. All fatty acids increased s.c. adipocyte volumes whereas CLA decreased acetate incorporation into lipids in s.c. adipose tissue (P \ 0.05), but none of the fatty acids affected gene expression in i.m. or s.c. adipose tissue (P [ 0.10). Thus, CLA depressed de novo fatty acid biosynthesis from acetate but neither CLA nor other fatty acids significantly affected adipogenic or lipogenic gene expression. Keywords Lipid analysis Analytical techniques Fatty acid analysis Lipid chemistry General area Lipogenesis Metabolism Adipogenesis Physiology Abbreviations ALA a-Linolenic acid C/EBPb CCAAT/enhancer-binding protein beta CLA Conjugated linoleic acid CPT1b Carnitine palmitoyltransferase-1 beta FAME Fatty acid methyl esters FASN Fatty acid synthase GPR43 G-coupled protein receptor 43 PPARc Peroxisome proliferator-activated receptor gamma PRKAA1 AMP-activated protein kinase alpha-1 RPS9 40S ribosomal protein S9 SCD1 Stearoyl CoA desaturase-1 TVA trans-vaccenic acid
B. J. Johnson K. Y. Chung Department of Animal and Food Science, Texas Tech University, Lubbock, TX 79409, USA
Introduction
M. E. Doumit Department of Animal and Veterinary Science, University of Idaho, Moscow, ID 83844, USA
Beef cattle fed pasture or hay-based diets accumulate carcass fat slowly compared to cattle fed grain-based
123
16
rations. We recently demonstrated that steers fed native pasture from 8 to 12 months of age accumulated little subcutaneous (s.c.) adipose tissue and there was not a significant increase in intramuscular (i.m.) adipose tissue over this time period [1]. Correspondingly, stearoyl-CoA desaturase-1 (SCD1) gene expression was not detectable until the yearling steers were fed a corn-based diet [2]. The depression in SCD1 gene expression may reflect inhibition by dietary polyunsaturated fatty acids, especially a-linolenic acid (18:3n-3, ALA) [3]. Oleic acid (18:1n-9) also may inhibit SCD1 gene expression [4], whereas stearic acid (18:0) and trans-vaccenic acid (18:1trans-11, TVA) may promote SCD1 gene expression, as they both serve as substrates for the D9 desaturase encoded by SCD1. We hypothesized that ALA would decrease gene expression and lipid synthesis in vitro in bovine i.m. and s.c. adipose tissues. We also tested the effects of oleic acid, stearic acid, TVA, and trans-10, cis-12 conjugated linoleic acid (CLA). D9 Desaturase activity is higher in adipose tissue than liver or muscle in cattle [5, 6], and SCD1 gene expression is of particular importance in beef cattle production because oleic acid, the primary product of the D9 desaturase, contributes to the palatability [7, 8] and healthfulness of beef [9, 10]. SCD1 gene expression increases with age in bovine adipose tissue [11, 12], and correspondingly oleic acid increases with age in adipose tissues of cattle fed corn-based diets [2, 13]. Stearic acid is the most abundant fatty acid to pass from the rumen to the small intestine in cattle [14, 15] and TVA, produced by isomerization and hydrogenation of polyunsaturated fatty acids in the rumen, is one of most abundant trans-fatty acids to be absorbed from the small intestine in cattle [15]. We previously demonstrated that the trans-10, cis-12 CLA, produced solely in the rumen, profoundly depresses SCD1 gene expression in bovine preadipocytes [16], so its effects on lipid synthesis and gene expression also were measured. Oleic acid is absorbed from the gastrointestinal tract of cattle [14] and also is produced endogenously, especially in adipose tissue [5, 6]. We also hypothesized that the less differentiated adipose tissues from steers at 12 months of age would be more responsive to fatty acids than adipose tissues from physiologically mature steers (16 months of age), especially for those genes associated with adipocyte differentiation. To accomplish these objectives, we documented the effects of exposure to fatty acids during culture on glucose and acetate incorporation into lipids, adipocyte volume, and the expression of genes associated with adipocyte differentiation [CCAAT/enhancer-binding protein beta (C/EBPb) and peroxisome proliferator-activated receptor gamma (PPARc)], lipid metabolism [carnitine palmitoyltransferase-1 beta (CPT1b) and SCD1), and the regulation
123
Lipids (2014) 49:15–24
of triacylglycerol turnover (G protein-coupled protein receptor 43 (GPR43) and AMP-activated protein kinase alpha-1 (PRKAA1), formerly AMPKa]. PPARc expression is promoted strongly by C/EBPb, which initiates preadipocyte differentiation [17, 18]. Recent studies demonstrated that inhibition of SCD1 catalytic activity reduced the activities of genes associated with de novo fatty acid synthesis such as fatty acid synthase (FASN) while increasing expression of genes associated with fatty acid oxidation, such as CPT1b [19, 20]. Treating adipocytes with acetate and propionate, which bind to the GPR43 receptor, leads to a reduction in lipolysis [21], which may be mediated by AMPK [22]. Our overarching hypothesis was that fatty acids common in pastures or produced ruminally would regulate adipogenesis and/or lipogenesis.
Materials and Methods The experimental procedures were approved by the Texas A&M University Animal Care and Use Committee, Office of Research Compliance, Animal Use Protocol 2006-221. Chemicals Stearic acid, oleic acid, ALA, TVA, and trans-10, cis-12 CLA were purchased from Matreya, Inc. (Pleasant Gap, PA). Other chemicals were purchased from Sigma–Aldrich (St. Louis, MO), Invitrogen (Carlsbad, CA), Calbiocem (La Jolla, CA), Gibco (Grand Island, NY) or Applied Biosystems (Foster City, CA). Radioisotopes were purchased from Amersham (Arlington Heights, IL), and Econo-Safe scintillation fluid was purchased from Research Products International Corp. (Mount Prospect, IL). Preliminary Study To establish the optimal concentration of fatty acids for use in explant cultures, i.m. and s.c. adipose tissues were collected at slaughter from four Angus crossbred steers at *16 months of age. At slaughter, immediately following hide removal, the 5th–8th longissimus thoracis rib section was removed from the carcass and transported to the laboratory in 37 °C, oxygenated Krebs–Henseleit solution containing 5 mM glucose. The muscle sections arrived in the laboratory *15 min after exsanguination. Explants of i.m. and s.c. adipose tissue were excised from the muscle sections and incubated for 48 h in medium with 0, 40, or 100 lM stearic acid, oleic acid, ALA, TVA, or CLA. Following the explant incubations, glucose incorporation into lipids was measured in vitro.
Lipids (2014) 49:15–24
Animals and Diets Complete details of the production of the cattle were described recently [12]. Briefly, 12 Angus steers (*8 months of age; 234 ± 4 kg) were fed Coastal bermudagrass hay (9.5 % crude protein) free choice for 8 days before being adapted to a corn-based finishing diet over a 14-day period. Steers were fed at the Texas A&M University McGregor Research Center and were transported *170 km to Texas A&M University for processing. Cattle were processed at 12, 14, and 16 months of age (n = 4 at each time point); the steers sampled at 12, 14, and 16 months were fed the full finishing diet for *3, 5, and 7 months, respectively. Adipose Tissue Explant Culture Upon arrival at the laboratory, the longissimus thoracis muscle was separated from the other muscles of the 5th– 8th rib section. Slices (*1 cm) were cut from the muscle and i.m. adipose tissue was dissected immediately and then placed in 37 °C, oxygenated Krebs–Henseleit solution containing 5 mM glucose. The s.c. adipose tissue immediately overlying the longissimus thoracis muscle was removed and also placed in 37 °C, oxygenated Krebs– Henseleit solution with 5 mM glucose. The adipose tissue samples were considered viable if they remained at 37 °C during the dissection process, and if the muscle maintained the ability to twitch during dissection. Some of the i.m. and s.c. adipose tissue samples were used immediately for explant culture, whereas others were stored at -80 °C for subsequent analysis of adipocyte cell volume and fatty acid composition. Adipose tissue explant culture was conducted as described [23, 24], with modifications. Adipose explant pieces were (25–50 mg) were transferred to 35-mm well culture dishes containing 3 mL of 37 °C differentiation medium. The differentiation medium consisted of DMEM medium (Invitrogen 31600-034), containing antibiotic/ antimycotic (100 units of penicillin, 0.1 mg streptomycin, and 0.25 lg amphotericin B per mL), 50 lg/mL gentamicin sulfate, 33 lM biotin, 17 lM pantothenate, 100 lM ascorbate, 1 % bovine serum albumin (fatty acid free, Sigma–Aldrich, Lot 89H1269), 280 nM bovine insulin, 0.25 lM ciglitizone, and 5 mM glucose. Ciglitizone was included to promote differentiation of any preadipocytes that may have been present in the stromal-vascular fraction of the adipose tissue explants. Treatment medium was without (control) or with addition of 40 lM stearic acid, oleic acid, ALA, TVA, or CLA. Fatty acids were solubilized in trace amounts of 100 % ethanol and added to differentiation medium containing 5 % fatty acid-free bovine serum albumin to a stock concentration of 4 M. The
17
stock solutions of fatty acids were diluted to 40 lM final concentration with differentiation medium. Adipose tissue was incubated for 48 h. The medium was changed with fresh differentiation medium, including exogenous fatty acids, after 24 h. In Vitro Lipogenesis At the day of sampling (fresh adipose tissue) and after 48 h explant culture, i.m. and s.c. adipose tissue samples were transferred to flasks containing 3 mL of 37.5 °C incubation medium, and acetate and glucose incorporation into total lipids was measured as described previously [23, 25]. Flasks contained Krebs-Henseleit Buffer (pH 7.4), 5 mM glucose, 5 mM acetate, 1 lCi/mL [U-14C]glucose or [1-14C]acetate, and 10 mM HEPES. Adipose tissue explants were incubated at 37.5 °C in a shaking water bath for 2 h, after which reactions were halted by the addition of 3 mL of 1 M trichloroacetic acid to each flask. Adipose tissue samples were rinsed with 0.154 M NaCl and placed in 5 mL of chloroform:methanol (2:1, vol/vol), homogenized, and the lipid extracted [26]. The total lipid extract was transferred to a scintillation vial, 10 mL of scintillation cocktail (Econo-Safe) was added, and samples counted in a Beckman Coulter LS 6500 Multi-purpose Scintillation Counter (Beckman Coulter, Brea, CA). Adipose Tissue Cellularity Previously frozen i.m. and s.c. adipose tissue samples (25 mg) obtained at the day of sampling or after 48 h of explant culture were sliced as thinly as possible on a glass plate on ice [23]. The adipose tissue slices were transferred to scintillation vials and rinsed three times with 37 °C 0.154 M NaCl. A 0.6-mL aliquot of 50 mM collidine HCl was forcibly added to break up the sample; subsequently 0.5 of 3.0 % osmium in collidine buffer was added and the samples were incubated in a 37 °C water bath for 96 h, swirling occasionally. The osmium was removed and 10 mL of 0.154 NaCl was added. The samples were rinsed continuously with NaCl until the solution was clear, after which 10 mL of 8 M urea was added and samples were incubated at room temperature for 96 h, swirling occasionally. The fixed adipocytes were resuspended with 0.01 % Triton in 0.154 M NaCl and used for determination of cell diameter using a bright-field microscope (Olympus Vanox ABHS3, Olympus, Tokyo, Japan), CCD Color Video Camera (DXC-960MD, Sony, Japan). Images were saved as tiff files and diameters were determined using ImageJ (rsbweb.nih.gov/ij/). Diameters were converted to volumes (lm3) and subsequently converted to pL (at 10-3 lm3/pL).
123
18
Lipids (2014) 49:15–24
RNA Extraction and Real-time PCR Following the 48 explant cultures, adipose tissue samples from parallel incubations were snap-frozen in liquid nitrogen and stored at -80 °C. Subsequently, RNA was extracted with Tri Reagent (Sigma Chemicals, St. Louis, MO) as reported previously [12]. The concentration of RNA was quantified with a NanoDrop ND-100 Spectrophotometer (Thermo Scientific, Washington, DE). The 260:280 ratio for all samples was [1.85. Quantitative PCR (qRT-PCR) was used to analyze the expression of C/EBPb, CPT1b, GPR43, PPARc, PRKAA1, and SCD1 (primers listed in Table 1). Commercially available eukaryotic 40S ribosomal protein S9 (RPS9) RNA (Applied Biosystems; GeneBank Accession #X03205) was used as the endogenous control. The mean ± SEM for RPS9 cycles over depot and age was 22.41 ± 0.12. RPS9 qPCR cycles did not vary with animal age (P = 0.22), nor were they different across adipose tissue depot (P = 0.45). Other studies in bovine adipose
Table 1 Forward and reverse primers and probes for real-time PCR
Maker gene
Gene no.
RPS9
DT860044
tissue explants [27] and bovine liver [28] demonstrated that RPS9 mRNA expression was stable and suitable as a housekeeping gene under their conditions. Additionally, RPS9 was used as a housekeeping gene for the expression genes in bovine muscle [29, 30]. Complementary DNA was produced from 1 lg RNA using Taq-Man Reverse Transcriptase Reagents (Applied Biosystems, Foster City, CA) and the protocol recommended by the manufacturer. Random hexamers were used as primers in cDNA synthesis. Measurement of the relative quantity of the cDNA of interest was carried out using TAMRA PCR Master Mix (Applied Biosystems, Foster City, CA), appropriate forward and reverse primers, and 1 lL of the cDNA mixture. Assays were performed in duplicate in the GeneAmp 5700 Sequence Detection System (Applied Biosystems) using thermal cycling parameters recommended by the manufacturer (40 cycles of 15 s at 95 °C and 1 min at 60 °C). Cycle threshold (Ct) values were the means of duplicate measurements. The comparative Ct values were employed to determine expression
Forward
C/EBPb
GGTCGAGGCGGGACTTCT
Taqman probe
6FAM-ATGTGACCCCGCGGAGACCCTTC-TAMRA
NM_176788 Reverse Taqman probe NM_001034349 Forward
GPR43
SCD1
ACACATCTACCTGTCCGTGATCA CCCCTGAGGATGCCATTCT 6FAM-TCCTGGAAGAAACGCCTGATTCGC-TAMRA
FJ_562212 GGCTTTCCCCGTGCAGTA
Reverse
ATCAGAGCAGCGATCACTCCAT
Taqman probe
6FAM-AAGCTGTCCCGCCGGCCC-TAMRA
NM_181024 ATCTGCTGCAAGCCTTGGA
Reverse
TGGAGCAGCTTGGCAAAGA
Taqman probe
6FAM-CGCGAGGTCAGCACCCTGC-TAMRA
NM_001109802 Forward
ACCATTCTTGGTTGCTGAAACTC
Reverse Taqman probe
CACCTTGGTGTTTGGATTTCTG 6FAM-CAGGGCGCGCCATACCCTTG-TAMRA
AB075020 Forward
123
TCGGGCAGCGTCTTGAAC 6FAM-CGCGAGGTCAGCACCCTGC-TAMRA
Taqman probe
Forward
PRKAA1
CCAGAAGAAGGTGGAGCAACTG
Reverse
Forward
PPARc
GAGCTGGGTTTGTCGCAAAA
Reverse
Forward
CPT1b
Sequence (50 to 30 )
TGCCCACCACAAGTTTTCAG
Reverse
GCCAACCCACGTGAGAGAAG
Taqman probe
6FAM-CCGACCCCCACAATTCCCG-TAMRA
Lipids (2014) 49:15–24
levels for target genes; fold change was determined as 2DDCT with RPS9 as the endogenous control. Titration of the target mRNA primers against increasing amounts of cDNA gave linear responses with slopes between -2.8 and -3.0. In order to reduce the effect of assay-to-assay variation in the PCR assay, all values were calculated relative to a calibration standard run on every real-time PCR assay. The ABI Prism 7000 detection system (Applied Biosystems) was used to perform the assay utilizing the thermal cycling variables recommended by the manufacturer (50 cycles of 15 s at 95 °C and 1 min at 60 °C). Statistical Analysis Effects of fatty acids during explant culture were compared to their respective controls within animal by a paired t test. Similarly, effects of adipose tissue depot were compared within animal by a paired t test. Effects of animal age were compared by Student’s t test. Means were considered different at the P \ 0.05 level.
19
thesis from glucose in i.m. adipose tissue (P \ 0.05), whereas no fatty acids affected glucose incorporation into lipids in s.c. adipose tissue. ALA, oleic acid, and TVA increase acetate incorporation into lipids in i.m. adipose tissue, while CLA decreased lipid synthesis from acetate in s.c. adipose tissue. There were no differences in i.m. and s.c. adipocyte volumes between fresh adipose tissue samples and control samples following 48 h incubation (Table 2). All fatty acids increased i.m. and s.c. adipocytes following the incubation period (P \ 0.05). The greatest increases in i.m. volume were seen in adipose tissue explants incubated with ALA, stearic acid, and TVA (P \ 0.01). In s.c. adipose tissue, all fatty acids strongly increased adipocyte volume (P \ 0.01). Gene expression was not measured in fresh adipose tissue samples, but was not affected by any of the added fatty acids (P [ 0.05) in i.m. and s.c. adipose tissues. Effects of Animal Age and Adipose Tissue Depot on Lipid Synthesis, Adipocyte Volume, and Gene Expression
Results Preliminary Incubations There was a main effect of fatty acid concentration in i.m. and s.c. adipose tissue; the rate of lipid synthesis from glucose as greater (P \ 0.05) in tissues incubated with 40 lM fatty acids than with tissues incubated with no added fatty acids. Individually, 40 lM CLA, oleic acid, stearic acid, and TVA increased lipogenesis from glucose, relative to incubations with no added fatty acids (P \ 0.05). The 40 lM concentration of CLA and oleic acid increased lipogenesis from glucose in s.c. adipose tissue (P \ 0.05). Lipid synthesis at 100 lM fatty acids was not different from rates with no added fatty acids except for TVA (i.m. adipose tissue, A) and oleic acid (s.c. adipose tissue, B). Effects of Exogenous Fatty Acids on Lipid Synthesis, Adipocyte Volume, and Gene Expression There was no difference (P [ 0.05) in glucose incorporation into lipids between fresh i.m. and s.c. adipose tissue (i.e., incubated immediately after post-exsanguination) and control i.m. adipose tissue explants following 48 incubation (Table 2). However, acetate incorporation into lipids increased approximately threefold following 48 h incubation in control samples. Lipid synthesis from acetate was not different between fresh samples and control samples following 48 h of culture. Oleic acid increased lipid syn-
Lipid synthesis from glucose was lower in i.m. adipose tissue from 14-month-old and 16-month-old steers than in adipose tissue from 12-month-old steers (P \ 0.05 and P \ 0.01, respectively) (Table 3; data pooled over fatty acid treatments). Acetate incorporation into lipids was greater at 16 months of age than at 12 months of age in i.m. adipose tissue (P \ 0.01). There was a linear increase in i.m. adipocyte volume with age. Glucose incorporation into lipids in s.c. adipose tissue was lower at 14 months of age (P 0.05) and at 16 months of age (P \ 0.01) than at 12 months of age, and acetate incorporation into lipids was less at 16 months of age than at 12 months of age (P \ 0.05) (Table 3). Adipocyte volume in s.c. adipose tissue was greater at 14 and 16 months of age than at 12 months of age (P \ 0.01). C/EBPb, PPARc, and SCD1 gene expression was higher at 16 months of age than at 12 months of age in i.m. adipose tissue, whereas CPT1b expression declined between 12 months and 14 months of age (P \ 0.01) (Table 3). The expression of PRKAA1 was lower at 16 months of age than at 12 months of age in s.c. adipose (P \ 0.05), whereas C/EBPb expression was higher at 16 months of age than at 12 months of age (P \ 0.01). SCD1 gene expression was higher at 14 months of age than at 12 months of age in s.c. adipose tissue (P \ 0.05). Adipocyte volume, glucose and acetate incorporation into lipids, and C/EBPb and SCD1 gene expression levels were greater (P \ 0.01) in subcutaneous adipose tissue than in i.m. adipose tissue.
123
20
Lipids (2014) 49:15–24
Table 2 Media fatty acid main effects for lipid biosynthesis in vitro, adipocyte volume, and adipogenic gene expression Itema
Fresh tissuea
48 h incubation media fatty acidb
Pooled SEM
Control
ALA
CLA
Oleic
Stearic
TVA
Intramuscular adipose tissue Glucose to lipidsc
3.88
3.31
3.44
2.87
4.63*
3.46
3.40
0.73
Acetate to lipids
5.24
16.05
24.21*
21.87
23.73*
19.96
22.44*
1.27
374
342
766**
597*
596*
612**
684**
30
PRKAA1
ND
2.10
2.77
4.68
2.58
3.46
2.62
0.38
C/EBPb CPT1b
ND ND
0.33 0.97
0.50 1.21
0.24 1.97
0.21 0.62
0.34 1.18
0.32 0.79
0.05 0.13
GPR43
ND
3.76
3.63
6.11
5.21
6.13
3.57
0.76
PPARc
ND
1.16
2.66
0.72
0.74
0.94
1.83
0.31
SCD1
ND
0.99
1.21
0.45
0.62
0.76
0.44
0.15
6.62
7.40
5.77
4.94
5.49
8.52
0.63
Adipocyte volume
d
Gene expressione
Subcutaneous adipose tissue Glucose to lipids
8.41
Acetate to lipids
74.99
80.27
70.80
48.39*
72.45
76.01
69.08
8.32
Adipocyte volume
695
635
1,031**
1,124**
1,081**
1,119**
1,047**
37
PRKAA1
ND
1.77
2.60
2.86
3.05
3.08
2.96
0.35
C/EBPb
ND
0.71
0.71
0.90
0.43
0.86
0.45
0.09
CPT1b
ND
0.78
1.30
1.38
1.44
1.42
1.32
0.14
GPR43
ND
2.08
6.50
5.42
2.86
2.72
4.13
0.79
PPARc
ND
1.40
2.08
2.54
1.78
1.98
2.14
0.22
SCD1
ND
1.66
2.24
2.50
2.09
2.51
1.42
0.18
Gene expression
ND not determined * P \ 0.05, ** P \ 0.01 compared to control
P \ 0.05, control compared to fresh tissue
a
Tissue incubated immediately after slaughter. All data are means (n = 12 or n = 48 (control), pooled over slaughter age). Data were analyzed by a paired t test, comparing fatty acid treatments to their corresponding control values
b
Tissues incubated for 48 h. ALA a-linolenic acid, CLA trans-10, cis-12 conjugated linoleic acid, TVA trans-vaccenic acid
c
Lipid synthesis, nmol glucose or acetate incorporated into total lipids/(3 h 9 105 cells)
d
Adipocyte volume, pL
e
Gene expression data reported as determined as 2DDCT relative to RSP9 expression
Discussion There was no difference in the rate of acetate incorporation into lipids between fresh s.c. adipose tissues and following 48 h explant incubation, and acetate incorporation into lipids was threefold greater after 48 h incubation than in fresh i.m. adipose tissue. It is not apparent why lipogenesis from acetate increased during explant culture, but the data indicate that the adipose tissue explants retained viability during the 48-h incubation period. Previous studies in our laboratory demonstrated that incubation of 3T3-L1 preadipocytes with 10 mg/mL (35.7 lM) mixed isomers of CLA depressed preadipocyte proliferation by 50 % but was not cytotoxic [31]. Cheguru et al. [32] incubated 3T3-L1 preadipocytes with 300 lM
123
fatty acids with no apparent cytotoxic effects. However, bovine primary preadipocytes may be more sensitive to exogenous fatty acids than 3T3-L1 preadipocytes. Chung et al. [16] demonstrated that 40 lM trans-10, cis-12 CLA depressed SCD1 and FASN gene expression in bovine primary preadipocytes by nearly 50 %, and incubation of bovine preadipocytes with 100 lM trans-10, cis-12 CLA or cis-9, trans-11 CLA depressed SCD1 and FASN gene expression further. Because cis-9, trans-11 CLA has not been shown to reduce SCD1 gene expression, the effects of 100 lM CLA isomers may have been cytotoxic. More recently, Kadehowda et al. [20] demonstrated that 50 lM trans-10, cis-12 CLA reduced SCD1 gene expression in the bovine preadipocytes by over 50 %, similar to the results of Chung et al. [16]. Further, 200 lM but not 100 lM trans-
Lipids (2014) 49:15–24
21
Table 3 Age and adipose tissue depot main effects for lipid biosynthesis in vitro, adipocyte volume, and adipogenic gene expression Itema
Age, months 12
Pooled SEM
14
16
Intramuscular adipose tissue Glucose to lipidsb
4.27
2.97*
2.57**
0.15
Acetate to lipidsc Adipocyte volumed
16.20 456
16.36 596*
26.28** 747**
1.00 30
GPR43
6.10
3.15
4.66
0.76
PRKAA1
2.86
2.72
3.32
0.38
C/EBPb
0.22
0.11
0.69**
0.05
PPARc
0.98
0.47
2.88**
0.31
CPT1b
1.13
0.30**
1.47
0.13
SCD1
0.23
0.77*
1.44**
0.15 0.33
Gene expressione
f
Subcutaneous adipose tissue Glucose to lipids
9.57
7.07*
3.48**
Acetate to lipids
81.04
80.66
61.17*
2.48
Adipocyte volume
830
1,074**
1,132**
37
GPR43
5.29
3.20
2.94
0.79
PRKAA1 C/EBPb
3.56 0.58
2.63 0.40
1.74* 1.08**
0.35 0.09
PPARc
1.82
1.69
2.29
0.22
CPT1b
1.17
1.06
1.47
0.14
SCD1
1.43
2.51*
2.25
0.13
Gene expression
* P \ 0.05; ** P \ 0.01, compared to samples taken at 12 months of age; Student’s t test a
All data are means (n = 12, pooled over fatty acid treatments)
b, c
Lipid synthesis, nmol glucose or acetate incorporated into total lipids/(3 h 9 105 cells) d
Adipocyte volume, pL
Gene expression data reported as determined as 2DDCT relative to RSP9 expression
e
f
Adipocyte volume, glucose and acetate incorporation into lipids, and C/EBPb and SCD1 gene expression levels were greater (P \ 0.01; paired t test) in subcutaneous adipose tissue than in intramuscular adipose tissue
10, cis-12 CLA was cytotoxic to bovine preadipocytes [20]. Based on the preliminary studies of this study and results of previous studies with bovine preadipocytes, we chose the concentration of 40 lM for our fatty acid treatments during explant culture. The genes C/EBPb, PPARc, GPR43, PRKAA1 (previously AMPKa), CPT1b and SCD1 were selected as genetic markers of adipose tissue differentiation. As a cellular energy sensor, PRKAA1 inactivates energy-consuming processes such as fatty acid biosynthesis, while activating energy-producing processes such as fatty acid oxidation [33]. Acetate and propionate activate GPR43 (a cell surface receptor) [21, 34], with acetate having greater agonist
activity [34]. In response to activation by volatile fatty acids, GPR43 activates cellular responses through a variety of secondary messenger cascades such as PRKAA1, which subsequently depress triacylglycerol turnover [33]. Although Wang et al. [35] reported that GPR41 and GPR43 gene expression was not detected in bovine adipose tissues, both PRKAA1 and GPR43 mRNAs were readily detectable in both i.m. and s.c. adipose tissues in this study and in our previous report of gene expression in bovine adipose tissues [12]. Chung et al. [16] and Kadegowda et al. [20] demonstrated that trans-10, cis-12 CLA depressed lipid synthesis in bovine preadipocytes, but the effects of the other media fatty acids on lipid synthesis in bovine adipose tissue have not been reported. In the current study, CLA depressed acetate incorporation into lipids by 40 % in s.c. adipose tissue, similar to results with bovine preadipocytes [16], although the other fatty acids had no effect on lipid in s.c. adipose tissue. In i.m. adipose tissue, ALA, oleic acid, and TVA increased acetate incorporation into lipids, and oleic acid increased lipid synthesis from glucose, and all exogenous fatty acids increased i.m. and s.c. adipocyte volumes. Bovine i.m. and s.c. adipocytes rapidly esterify exogenous stearic, oleic, linoleic and ALA, most of which is incorporated into triacylglycerols [36]. Similarly, 3T3L-1 preadipocytes accumulate lipid linearly with increasing concentrations of mixed isomers of CLA [31], and incubation of 3T3-L1 preadipocytes with 300 lM oleic acid and linoleic acid (18:2n-6) resulted in increased accumulation of lipid, especially in the presence of insulin [32]. Thus, the increase in adipocyte volume caused by fatty acids observed in this study likely represented both the increase in de novo fatty acid biosynthesis from acetate as well as the assimilation and esterification of the exogenous fatty acids. In 3T3-L1 preadipocytes, oleic acid (in the presence of insulin) increased PPARc, C/EBPa, and fatty acid binding protein-4 gene expression by d 5 of differentiation compared to preadipocytes incubated with insulin alone; linoleic acid had less effect on gene expression [32]. We had proposed that fatty acids present in pastures or produced within the rumen would increase expression of genes associated with adipocyte differentiation (i.e., C/EBPb and PPARc). This is based on the assumption that the stromalvascular fraction of the adipose tissue explants contained non-differentiated preadipocytes that could be stimulated to differentiate during explant culture. In support of this supposition, C/EBPb and PPARc gene expression increased with age in i.m. adipose tissue between 12 and 16 months of age. A limited number of studies that have reported effects of fatty acids on gene expression in bovine adipose tissue used bovine preadipocytes [16, 20], and the fatty acid treatments were included during the final stages of differentiation. The adipose tissues of the cattle used in
123
22
Lipids (2014) 49:15–24
Fig. 1 Glucose incorporation into total lipids in subcutaneous adipose tissue as a function of fatty acid concentration in intramuscular (i.m.) adipose tissue (a) and subcutaneous (s.c.) adipose tissue (b). Lipid synthesis was measured in vitro in i.m. and s.c. adipose tissue explants after 48 h incubation with 0, 40, or 100 lM each alinolenic acid (ALA), trans-10, cis-12 conjugated linoleic acid (CLA), oleic acid, stearic acid, or trans-vaccenic acid (TVA). Each symbol is the mean of samples from four steers for each fatty acid;
pooled SEM are affixed to the symbols. There was a main effect of fatty acid concentration in i.m. and s.c. adipose tissue; the rate of lipid synthesis from glucose as greater (P \ 0.05) in tissues incubated with 40 lM fatty acids than with tissues incubated with no added fatty acids. Lipid synthesis at 100 lM fatty acids was not different from rates with no added fatty acids except for TVA (i.m. adipose tissue, a) and oleic acid (s.c. adipose tissue, b)
this study may have been sufficiently differentiated that gene expression, even in i.m. adipose tissue, was refractory to the fatty acid treatments. Animal age had clear effects on gene expression that differed between i.m. and s.c. adipose tissues. We reported previously that, for these cattle, fat thicknesses (i.e., s.c. fat thickness over the 12th thoracic vertebra) were 1.42, 2.51, and 2.81 cm at 12, 14, and 16 months of age, respectively; fat thickness was significantly greater at 14 and 16 months than at 12 months of age [12]. Marbling scores (reflecting i.m. adipose tissue amounts) were 448, 413, and 548 at 12, 14, and 16 months of age, respectively; marbling score was significantly greater at 16 months than at 14 months of age [12]. For i.m. adipose tissue, the pattern of PPARc gene expression was similar to that for marbling scores; no difference between 12 and 14 months of age, but substantially elevated PPARc and marbling scores by 16 months of age. Also, SCD1 gene expression attained a plateau in s.c. adipose tissue at 14 months of age (similar to adjusted fat thickness), but increased from 14 to 16 months of age in i.m. adipose tissue (similar to marbling scores). Thus, the pattern of PPARc and SCD1 gene expression generally resembled changes in adiposity of s.c. and i.m. adipose tissues. The different patterns of gene expression over time in i.m. and s.c. adipose tissues support earlier studies that
documented differences in metabolism between these adipose tissue depots. Early studies demonstrated that glucose and acetate incorporation differed between i.m. and s.c. adipose tissues in that s.c. adipose tissue exhibits much greater rates of lipogenesis from acetate than i.m. adipose tissue [37–39]. Additionally, i.m. and s.c. adipose tissues exhibit different capacities to esterify fatty acids in vitro [36], respond differently to starvation [40], and have different adipogenic capacities [41]. The close proximity of i.m. adipocytes to muscle fibers, and especially muscle satellite cells embedded in the sarcolemma of muscle, may influence genes associated with adipogenesis in i.m. adipocytes [42]. The elevated lipid metabolism at 16 months of age in i.m. adipose tissue is supported by the larger i.m. adipocyte volume and sixfold greater SCD1 gene expression at 16 months of age than at 12 months of age. However, even given the capacity for additional differentiation over the ages of these cattle, gene expression in i.m. adipose tissue was no more sensitive to the fatty acid treatments than in s.c. adipose tissue. We hypothesized that ALA (a predominant fatty acid in forages) or fatty acids produced in the rumen and absorbed from the small intestine would influence adipogenic and lipogenic gene expression and fatty acid biosynthesis in i.m. and s.c. adipose tissues, with the saturated fatty acid,
123
Lipids (2014) 49:15–24
stearic acid, and perhaps TVA, promoting adipogenesis and unsaturated fatty acids decreasing adipogenesis. Plasma nonesterified fatty acids in beef cattle average 200 lM [43] to 1,000 lM [44]. Plasma stearic and oleic acid constitute 15–20 % of total fatty acids in plasma [15], so their concentrations in nonesterified fatty acids would be as little as 30 lM to as much as 200 lM; therefore, for stearic and oleic acid, the fatty acid concentration used in this study (40 lM) represented a physiological dose of fatty acids. However, for ALA, CLA, and TVA, whose concentrations typically are \1 % of plasma fatty acids [15], the 40 lM concentration was much greater than that to which the tissues would be exposed in vivo. Although CLA depressed lipogenesis from acetate in s.c. adipose tissue, there were no effects of any of the fatty acids on gene expression at the ages tested in this group of animals. This indicates that there is little likelihood that ALA, CLA, or TVA concentrations in plasma would ever be sufficient to modify lipogenic or adipogenic gene expression in bovine adipose tissue in growing animals. Thus, our initial hypothesis was incorrect. However, we were able to demonstrate several differences in lipid metabolism and gene expression between i.m. and s.c. adipose tissues that support a growing body of evidence that these are distinct adipose tissue depots with different lipogenic and adipogenic capacities (Fig. 1). Acknowledgments Supported by funds from the Beef Checkoff and by an international cooperative project with the Rural Development Administration, Republic of Korea, project number PJ00908001.
References 1. Brooks MA, Choi CW, Lunt DK, Miller RK, Choi CB, Smith SB (2011) Carcass and meat characteristics and M. longissimus thoracis histology of beef from calf-fed and yearling-fed Angus steers. Prof Anim Sci 27:385–393 2. Brooks MA, Choi CW, Lunt DK, Kawachi H, Smith SB (2011) Subcutaneous and intramuscular adipose tissue stearoyl-CoA desaturase gene expression and fatty acid composition in calfand yearling-fed Angus steers. J Anim Sci 89:2556–2570 3. Sessler AM, Kaur N, Palta JP, Ntambi JM (1996) Regulation of stearoyl-CoA desaturase 1 mRNA stability by polyunsaturated fatty acids in 3T3-L1 adipocytes. J Biol Chem 22:29854–29858 4. Sampath H, Miyazaki M, Dobryzn A, Ntambi JM (2007) Stearoyl-CoA desaturase-1 mediates the pro-lipogenic effects of dietary saturated fat. J Biol Chem 282:2483–2493 5. St. John LC, Lunt DK, Smith SB (1991) Fatty acid elongation and desaturation enzyme activities of bovine liver and subcutaneous adipose tissue microsomes. J Anim Sci 69:1064–1073 6. Chang JHP, Lunt DK, Smith SB (1992) Fatty acid composition and fatty acid elongase and stearoyl-CoA desaturase activities in tissues of steers fed high oleate sunflower seed. J Nutr 122:2074–2080 7. Waldman RC, Suess GG, Brungardt VH (1968) Fatty acids of certain bovine tissue and their association with growth, carcass and palatability traits. J Anim Sci 27:632–635 8. Westerling DB, Hedrick HB (1979) Fatty acid composition of bovine lipids as influenced by diet, sex and anatomical location
23
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
and relationship to sensory characteristics. J Anim Sci 48:1343–1348 Adams TH, Walzem RL, Smith DR, Tseng S, Smith SB (2010) Hamburger high in total, saturated and trans-fatty acids decreases HDL cholesterol and LDL particle diameter, and increases TAG, in mildly hypercholesterolemic men. Br J Nutr 103:91–98 Gilmore LA, Walzem RL, Crouse SF, Smith DR, Adams TH, Vaidyanathan V, Cao X, Smith SB (2011) Consumption of higholeic acid ground beef increases HDL-cholesterol concentration but both high- and low-oleic acid ground beef decrease HDL particle diameter in normocholesterolemic men. J Nutr 141:1188–1194 Chung KY, Yano H, Kawachi H, Smith SB, Lunt DK (2007) Lipogenesis and stearoyl-CoA desaturase gene expression and enzyme activity in adipose tissue of short- and long-fed Angus and Wagyu steers fed corn- or hay-based diets. J Anim Sci 85:380–387 Smith SB, Go GW, Johnson BJ, Chung KY, Choi SH, Sawyer JE, Silvey DT, Gilmore LA, Gharahramany G, Kim KH (2012) Adipogenic gene expression and fatty acid composition in subcutaneous adipose tissue depots of Angus steers between 9 and 16 months of age. J Anim Sci 90:2505–2514 Huerta-Leidenz NO, Cross HR, Savell JW, Lunt DK, Baker JF, Smith SB (1996) Fatty acid composition of subcutaneous adipose tissue from male calves at different stages of growth. J Anim Sci 74:1256–1264 Ekeren PA, Smith DR, Lunt DK, Smith SB (1992) Ruminal biohydrogenation of fatty acids from high-oleate sunflower seeds. J Anim Sci 70:2574–2580 Chung KY, Lunt DK, Choi CB, Chae SH, Rhoades RD, Adams TH, Booren B, Smith SB (2006) Lipid characteristics of subcutaneous adipose tissue and M. longissimus thoracis of Angus and Wagyu steers fed to us and Japanese endpoints. Meat Sci 73:432–441 Chung KY, Choi CB, Kawachi H, Yano H, Smith SB (2006) Trans-10, cis-12 conjugated linoleic acid antagonizes argininepromoted differentiation of bovine preadipocytes. Adipocytes 2:93–100 Wu Z, Bucher NL, Farmer SR (1996) Induction of peroxisome proliferator-activated receptor c during the conversion of 3T3 fibroblasts into adipocytes is mediated by C/EBPb, C/EBPd, and glucocorticoids. Mol Cell Biol 16:4128–4136 Saladin R, Fajas L, Dana S, Halvorsen YD, Auwerx J, Briggs M (1999) Differential regulation of peroxisome proliferator activated receptor c1 (PPARc1) and PPARc2 messenger RNA expression in the early stages of adipogenesis. Cell Growth Differ 10:43–48 Kim E, Lee JH, Ntambi JM, Hyun CK (2011) Inhibition of stearoyl-CoA desaturase1 activates AMPK and exhibits beneficial lipid effects in vitro. Eur J Pharmacol 672:38–44 Kadegowda AKG, Burns TA, Pratt SL, Duckett SK (2013) Inhibition of stearoyl-CoA desaturase 1 reduces lipogenesis in primary bovine adipocytes. Lipids 48:967–976 Ge H, Li X, Weiszmann J, Wang P, Baibault H, Chen JL, Tian H, Li Y (2008) Activation of G protein-coupled receptor 43 in adipocytes leads to inhibition of lipolysis and suppression of plasma free fatty acids. Endocrinology 149:4519–4526 Yin W, Mu J, Birnbaum MJ (2003) Role of AMP-activated protein kinase in cyclic AMP-dependent lipolysis in 3T3-L1 preadipocytes. J Biol Chem 278:43074–43080 May SG, Savell JW, Lunt DK, Wilson JJ, Laurenz JC, Smith SB (1994) Evidence for preadipocyte proliferation during culture of subcutaneous and intramuscular adipose tissues from Angus and Wagyu crossbred steers. J Anim Sci 72:3110–3117 Smith SB, Chapman AA, Lunt DK, Harris JJ, Savell JW (2007) Adiposity of calf- and yearling-fed steers raised to constant-age and constant-body weight endpoints. J Anim Sci 85:1136–1143
123
24 25. Archibeque SL, Lunt DK, Gilbert CD, Tume RK, Smith SB (2005) Fatty acid indices of stearoyl-CoA desaturase do not reflect actual stearoyl-CoA desaturase enzyme activities in adipose tissues of beef steers finished with corn-, flaxseed-, or sorghum-based diets. J Anim Sci 83:1153–1166 26. Folch J, Lees M, Stanley GHS (1957) A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226:497–509 27. Hosseini A, Sauerwein H, Mielenz M (2010) Putative reference genes for gene expression in studies in propionate and bhydroxybutyrate treated bovine adipose tissue explants. J Anim Physiol Anim Nutr (Berl) 94:e178–e184. doi:10.1111/j.14390396.2010.01002.x.Epub 28. Janovick-Guretzky NA, Dann HM, Carlson DB, Murphy MR, Loor JJ, Drackley JK (2007) Housekeeping gene expression in bovine liver is affected by physiological state, feed intake, and dietary treatment. J Dairy Sci 90:2246–2252 29. Baxa TJ, Hutcheson JP, Miller MF, Brooks JC, Nichols WT, Streeter MN, Yates DA, Johnson BJ (2010) Additive effects of a steroidal implant and zilpaterol hydrochloride on feedlot performance, carcass characteristics, and skeletal muscle messenger ribonucleic acid abundance in finishing steers. J Anim Sci 88:330–337 30. Chung KY, Baxa TJ, Parr SL, Luque LD, Johnson BJ (2012) Administration of estradiol, trenbolone acetate, and trenbolone acetate/estradiol implants alters adipogenic and myogenic gene expression in bovine skeletal muscle. J Anim Sci 90:1421–1427 31. Satory DL, Smith SB (1999) Conjugated linoleic acid inhibits proliferation but stimulates lipid filling of murine 3T3-L1 preadipocytes. J Nutr 129:92–97 32. Cheguru P, Chapalamadugu KC, Doumit ME, Murdoch GK, Hill RA (2012) Adipocyte differentiation-specific gene transcriptional response to C18 unsaturated fatty acids plus insulin. Pflugers Arch 463:429–447 33. Hardie GD (2007) Biochemistry. Balancing cellular energy. Science 315:1671–1672 34. Brown AJ, Goldsworthy SM, Barnes AA, Eilert MM, Tcheang L, Daniels D, Muir AI, Wigglesworth MJ, Kinghorn I, Fraser NJ, Pike NB, Strum JC, Steplewski KM, Murdock PR, Holder JC, Marshall FH, Szekeres PG, Wilson S, Ignar DM, Foord SM, Wise
123
Lipids (2014) 49:15–24
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
A, Dowell SJ (2003) The orphan G protein-coupled receptors GPR41 and GPR43 are activated by propionate and other short chain carboxylic acids. J Biol Chem 278:11312–11319 Wang A, Gu Z, Heid B, Akers RM, Jiang H (2009) Identification and characterization of the bovine G protein-coupled receptor GPR41 and GPR43 genes. J Dairy Sci 92:2696–2705 Lin KC, Cross HR, Smith SB (1992) Esterification of fatty acids by bovine intramuscular and subcutaneous adipose tissue. Lipids 27:111–116 Smith SB, Crouse JD (1984) Relative contributions of acetate, lactate and glucose to lipogenesis in bovine intramuscular and subcutaneous adipose tissue. J Nutr 114:792–800 Miller MF, Cross HR, Lunt DK, Smith SB (1991) Lipogenesis in acute and 48-hour cultures of bovine intramuscular and subcutaneous adipose tissue explants. J Anim Sci 69:162–170 May SG, Burney NS, Wilson JJ, Savell JW, Herring AD, Lunt DK, Baker JF, Sanders JO, Smith SB (1995) Lipogenic activity of intramuscular and subcutaneous adipose tissues from steers produced by different generations of Angus sires. J Anim Sci 73:1310–1317 Smith SB, Lin KC, Wilson JJ, Lunt DK, Cross HR (1988) Starvation depresses acylglycerol biosynthesis in bovine subcutaneous but not intramuscular adipose tissue homogenates. Comp Biochem Physiol B: Biochem Mol Biol 120:165–174 Ortiz-Colon G, Grant AC, Doumit ME, Buskirk DD (2009) Bovine intramuscular, subcutaneous, and perirenal stromal-vascular cells express similar glucocorticoid receptor isoforms, but different adipogenic capacity. J Anim Sci 87:1913–1920 Choi SH, Chung KY, Johnson BJ, Go GW, Kim KH, Choi CW, Smith SB (2013) Co-culture of bovine muscle satellite cells with preadipocytes increases PPARc and C/EBPb gene expression in differentiated myoblasts and GPR43 gene expression in adipocytes. J Nutr Biochem 24:539–543 Matsuzaki M, Takizawa S, Ogawa M (1997) Plasma insulin, metabolite concentrations, and carcass characteristics of Japanese Black, Japanese Brown, and Holstein steers. J Anim Sci 75:3287–3293 Smith SB, Prior RL, Mersmann HJ (1983) Interrelationships between insulin and lipid metabolism in normal and alloxandiabetic cattle. J Nutr 112:1002–1015
