the wild type (Jack et al., 1994). This observation suggests that the 35s promoter may lack some of the regulatory ele- ments present in theAP3 promoter that are ...
The Plant Cell, Vol. 7, 1635-1644, October 1995 O 1995 American Society of Plant Physiologists
Conservation of Floral Homeotic Gene Function between Arabidopsis and Antirrhinum Vivian F. Irish’ and Yuri T. Yamamoto2 Department of Biology, Osborn Memorial Laboratory, P.O. Box 208104, Yale University, New Haven, Connecticut 06520-8104
Severa1 homeotic genes controlling floral development have been isolated in both Antirrhinum and Arabidopsis. Based on the similarities in sequence and in the phenotypes elicited by mutations in some of these genes, it has been proposed that the regulatory hierarchy controlling floral development is comparable in these two species. We have performed a direct experimental test of this hypothesisby introducinga chimeric Antirrhinum Deficiens (DefA)/ArabidopsisAPETALA3 (AP3) gene, under the control of the Arabidopsis AP3 promoter, into Arabidopsis. We demonstrated that this transgene is sufficient to partially complement severe mutations at the AP3 locus. In combination with a weak ap3 mutation, this transgene is capable of completely rescuing the mutant phenotype to a fully functional wild-type flower. These observations indicate that despite differences in DNA sequence and expression, DefA coding sequences can compensate for the loss of AP3 gene function. We discuss the implications of these results for the evolution of homeotic gene function in flowering plants.
INTRODUCTION
Arabidopsis (Brassicaceae) and Antirrhinum (Scrophulariaceae) are widely divergent dicotyledonousspecies and belong to different subclasses. Based on morphological criteria and evidence from the fossil record, these species are considered to have diverged at least 70 million years ago (Cronquist, 1981, 1988; Muller, 1981). Although both species have the typical dicot arrangement of concentric whorls of floral organs, both the number and forms of these organs are quite different. The radially symmetric Arabidopsis flower, from outer to inner whorls, consists of four sepals, four petals, six stamens, and two fused carpels that form the pistil (Figures 1C and 1D). Antirrhinum flowers are subtended by a leaflike bract and consist of five sepals, five petals which are fused at the base, four stamens (a fifth stamen primordium aborts early in development), and two fused carpels that form the pistil (Figures 1A and 1B). Antirrhinum flowers are zygomorphic, and this bilateral symmetry is especially evident in the different shapes of the upper and lower petals and in the location of the aborted stamen. Floral organ identities appear to be established by the action of similar homeotic genes in both of these species. Genetic and molecular analyses of these homeoticgenes have provided the basis for the ABC model of floral development (Coen and Meyerowitz, 1991; Meyerowitz et al., 1991). In both species, mutations in the floral homeotic genes generally affect two adjacent whorls of organs; thus, three domains of function can be postulated. The A function is required for the development
’ To whom correspondence should be addressed. Current address: Department of Genetics, Box 7614, North Carolina State University, Raleigh, NC 27695.
of sepals and petals, the B function for peta1 and stamen development, and the C function for stamen and carpel development. The ABC model postulates that floral organ identity is specified by the combination of A, B, or C homeotic gene functions expressed in a particular whorl. In addition, the A and C functions are postulated to regulate negatively each other’s expression. Based on similarities in DNA sequence, expression patterns, and phenotypes elicited by mutations in a number of these homeotic genes, it has been suggested that the regulatory capabilities of these homeotic gene products have been conserved through dicot evolution (Coen, 1991). Homeotic mutations in either the Globosa (Glo) or Deficiens (DefA) loci in Antirrhinum affect the development of petals and stamens (Sommer et al., 1990; Trobner et al., 1992). In both cases, the mutant flowers display transformations of the five second whorl structures into sepaloid organs. In the third whorl, five fused carpelloid structures arise and fuse to form an enlarged gynoecium. 60th the DefA and Glo genes have been cloned, and they encode proteins containing a conserved 58-amino acid region termed the MADS box (Sommer et al., 1990; Trobner et al., 1992). The MADS box-containing domains of transcription factors from severa1systems have been shown to bind to DNA at a consensus motif, termed the CArG box (Norman et al., 1988; Passmore et al., 1988; Christ and Tye, 1991). In vitro studies have shown that the DefA and Glo gene products can bind to specific CArG motifs as heterodimers (Schwarz-Sommer et al., 1992). One such CArG box is found in the promoter of the DefA gene, suggesting that these MADS box-containing gene products may be autoregulatory (Schwarz-Sommer et al., 1992).
1636
The Plant Cell
B
Figure 1. Antirrhinum and Arabidopsis Wild-Type Flowers. (A) Wild-type Antirrhinum flower. (B) Diagram of an Antirrhinum flower. Organs are, from outside to inside, the subtending bract, five sepals, five petals, four stamens (a fifth aborted stamen is indicated by an X), and two fused carpels. (C) Wild-type Arabidopsis flower. (D) Diagram of an Arabidopsis flower. Organs are, from outside to inside, four sepals, four petals, six stamens, and two fused carpels. The inflorescence axis is indicated by black dots in (B) and (D).
Mutations in the Arabidopsis APETALA3 (AP3) and PISTILLATA (PI) genes also result in the homeotic transformation of petals into sepals, and stamens into carpelloid structures (Bowman et al., 1989; Hill and Lord, 1989; Jack et al., 1992). The AP3 gene encodes a MADS box-containing protein with a high degree of similarity with the Antirrhinum DefA gene product (Jack et al., 1992). Consistent with the mutant phenotype, AP3 transcripts are expressed early in floral development in the cells that are thought to give rise to petals and stamens (Jack et al., 1992). The PI gene appears to be the homolog of the Antirrhinum G/o gene (Goto and Meyerowitz, 1994). Both the PI and AP3 gene products are required for maintaining expression of the AP3 gene (Jack et al., 1994). This observation is consistent with the biochemical evidence from the Antirrhinum system showing that the G/o and DefA gene products form heterodimers (Schwarz-Sommer et al., 1992).
Despite these many similarities between DefA and APS, another member of this orthologous gene family appears to be required only for petal identity. A null mutation in green petals (gp), a petunia homolog of DefA, affects the development of petals but does not affect stamens (Kush et al., 1993; van der Krol et al., 1993). Furthermore, ectopic expression of gp induces the formation of petaloid organs in place of sepals (Halfter et al., 1994). One explanation for these observations is that the regulatory function encoded by the petunia homolog has diverged from that of Antirrhinum and Arabidopsis. Here, we describe a direct test of the hypothesis that similar Antirrhinum and Arabidopsis homeotic genes are functionally conserved. We generated transgenic Arabidopsis plants containing a chimeric AP3-DefA coding sequence driven by the Arabidopsis APS promoter. We also generated transgenic plants carrying a control construct consisting of the AP3
Conservation of Floral Homeotic Gene Function
pBam21
H
H
44 RB
I
Y//Y////////A
AP3 promoter
ATG
,
AP3 cDNA
E
ter
kH -
LB
100 bD
pDef7 H
RB
E
H
,
4
Y/A\\\\\\\Y
AP3 promoter
ATG
I
DefA cDNA ter
kH
LB
~
100 bD
Figure 2. Plasmid Constructs Used in This Study
pBam21 contains a 9-kb AP3 genomic region, with the position of the exons and introns within the transcription unit indicated by a jagged arrow. pla19 and pDet7 contain AP3 cDNA and DefA sequences, respectively, which are fused to genomic sequencesthat include the promoter and part of the 5‘ most exon derived from AP3. A nopaline synthase translational terminator (ter) was fused to the 3’ end. AP3 coding sequences are indicated by rightward hatching, and DefA coding sequences are indicated by leftward hatching. Selected restriction sites are BamHl (E), EcoRl (E), and Hindlll (H). Left border (LB) and right border (RB) sequences of the T-DNA are indicated by arrowheads. promoter driving the AP3 coding sequence. We observed that the AP3-DefA transgene can partially complement severe mutations at the AP3 locus. Furthermore,the AP3-DefA transgene is able to restore completely a weak ap3 mutant phenotype to the wild type. These observations demonstrate that the DefA coding sequences are sufficient to compensate for a mutation in the AP3 locus. We propose several models to explain these complementation results and discuss the evolutionary implications of the functional conservation we observed.
RESULTS
Generation of Transgenic Arabidopsis Plants Containing AP3 and AP3-DefA Chimeric Genes Three constructs were generated in the pBinl9 binary transformation vector (Bevan, 1984) and are illustrated in Figure 2. pBam21 contains a 9-kb Arabidopsis genomic insert containing the entire AP3 locus, with -6 kb 5’ and 4 . 5 kb 3’to the coding region. pla19 consists of a translational fusion of a 1.9-kb Arabidopsis genomic fragment to an AP3 cDNA at amino acid position 53,followed by a nopaline synthase translational terminator. pDef7 is similar to pla19, except that a DefA
1637
cDNA was fused to the AP3 genomic fragment at the same site. This fusion resulted in a chimeric gene that contains the AP3 promoter, followed by the AP3 MADS box coding region fused to the C-terminal portion of the DefA coding sequence. Although the coding regions of DefA and AP3 are highly conserved, especially in the MADS box domain, the promoters have diverged significantly (Figure 3). The AP3 promoter does not contain the large inverted repeat found in the DefA promoter, nor does it contain the putative MADS box binding site CCTTTTTAGG (Schwarz-Sommeret al., 1992). Instead, avery similar sequence, CCTTTTTGGG, is found at approximately the same position upstream of the translational start site. We identified several other sequences that may serve as potentia1 MADS box binding sites in theAP3 promoter and that may function as regulatory elements (Figure 3A; S.Carr, C.D. Day, T. Hill, and V.F. Irish, unpublished data). Within the coding regions, the deduced amino acid sequences of AP3 and DefA are 92% identical (53 of 58 amino acids) through the MADS box domain and only 51% identical (87 of 169 amino acids) beyond the MADS box domain (Figure 36). Transgenic Arabidopsis plants were generated with all three constructs by using Agrobacterium-mediated transformation of root explants (Valvekens et al., 1988). For each construct, we generated >40 independent transgenic lines and characterized three transgenic lines for each construct (Table 1). The number of independently segregating transgene inserts was estimated by progeny tests. Despite the segregation data suggesting that all tested lines contained a single locus of insertion, DNA gel blot analyses demonstratedthat most lines contained multiple, independent insertions of the transgene (Table 1). The relative leve1 of transgene expression was assessed by RNA gel blot analysis and indicated that transgene expression in each line was roughly correlated with the number of transgene inserts (data not shown). Transgenic plants were used as the polien donors in crosses to plants homozygous f3r either ap3-7, ap3-3, or ap3-4. These mutations differed in their severity, with ap3-7 plants showing a weaker phenotype and ap3-3 and ap3-4 mutations resulting in more extreme second and third whorl homeotic transformdions (Tables 2 and 3, and Figure 4; Bowman et al., 1989; Jack et al., 1992). The ap3-7 allele is temperature sensitive, and at 22OC, ap3-7 homozygous flowers display four sepals in place of petals and a conversion of the six stamens into carpelloid stamens (Figures 4B and 5C). The ap3-7 lesion is correlated with a single nucleotide change in the K-box, resulting in a conversion of lysine-153 to methionine (Jack et al., 1992). The K-box is predicted to form several amphipathic a-helices that may be required for protein-protein interactions (Ma et al., 1991; Pnueli et al., 1991; Schwarz-Sommer et al., 1992). Flowers homozygous for ap3-3 have four sepals in place of petals. The third whorl organs of ap3-3 plants have a variable phenotype, ranging from free-standingfilaments to carpels fused to the central two fourth whorl carpels (Jack et al., 1992). We have rarely observed unfused carpelloid structures in the third whorl of ap3-3 plants (Tables 2 and 3, and Figure 4C). The phenotype of homozygous ap3-4 flowers is similar to that
1638
The Plant Cell
A
of ap3-3 (Tables 2 and 3, and Figure 4D). The ap3-3 and ap3-4 mutations appear to be caused by single nucleotide changes resulting in stop codons within the MADS box and presumably abolish function (Jack et al., 1992). The F1 plants heterozygous for both an ap3 allele and a transgene were allowed to self-fertilize, and kanamycin-resistant progeny were recovered. For each transgenic construct, three independent lines were analyzed for their ability to complement the ap3 mutations. In ali cases, plants homozygous for the ap3 allele and heterozygous for the transgenic insert were assayed for their phenotype, and the genotype was confirmed by progeny testing.
AAGCTTCTTAAGAATTATAGTAGCACTTGTTGATATCGGG GTTCTTTTTTCTTAACATAGGTTTTGGTGGGTAGATCAAC AGAAGACCTCGCTGTGGACATTGATTTGGGAAGAGAAAAG CGGGGTAGCA AAATATCTCG ACGACAGGTC GGTCAATAGT AGATACTTCT ATTTGTATTT TAGGTCTTTA AGTTGTATGA
-1682 -1642 -1602 -1562 -1522 GAAGCAGCAGCCCAGGATCTGTAATGGTTGTTGTGTATGT -1482 T T T T T T m m T T A C T G A A T G C A G G C G A T C A T A C G -1442 GCTGGGTGATGACGGTTCGTTTCATATAAAAAACCCTGGG -1402 GAAGTATTCAATCTCAGTAAATGAGAAGGAAGTAGATCCT -1362 GGACAGAGTTTAA'ICCTCAAATCCGATTGTCTAGTTGAGG -1322 TTTGATCCGG GATACTCTTT TATGACTCAT TACTTACGTT -1282 CTAGGTCCGT ACTTAAACCC GATATATCGT GCGCGCAGAT -1242 ACGGGGAATGCCTTTTATATTTGAAACAAACCAAAGTTGC -1202 ATGCAAGAGTACCTGAAGAGAAGAGGGAAAGTGAACTGAG -1162 ACCAGATCAAGAGTGCGTGTTGTTTGTGTAGATGAATGAT - 1 1 2 2 GCATCTCTTGTGTAATGTACCTTAGCCATAGGAACACGTC -1082 TTGTAGATCT TTTAATACAT CTTTAGTTCC GCATCATGCA -1042 TAGTTGACCCTGTTTTAAGGCGTTGAAATGAAAATACAAG -1002 TCTCTTGTATCTGAATTTGTGT'ITTAAGCGAAGAATGATT -982 GTTCTTGTGA AGTTGATACA CAAGTTCTTT GGATATCCTA -922 TCAGTATAAAGGATAGGTTTCCATTTTCGTGACTCACTCA -882 CTGATTTCCATTGCTGAAAATTGATGATGAACTAAGATCA -842 ATCCATGTAGTTCAAACAACAGTAACTGTGCCACTAGTTT -802 GAACAACACTAACTGGTCGAGCAAAAGAAAAAGAGTTCAT -762 CATATATCTGATTTGATGGACTGTTTGGAGTTAGGACCAA -722 ACATTATCTACAAACAAAGACTTTTCTCCTAACTTGTGAT -682 TCCTTCTTAAACCCTAGGGGTAATATTCTATTTTCCAAGG -642 ATCTTTAGTTAAAGGCAAATCCGGGAAATTATTGTAATCA -602 TTTGGGGCCACATATAAAAGATTTGAGTTAGATGGAAGTG -562 ACGATTAATCCAAACATATATATCTCTTTCTTCTTATTTC -522 CCAAATTAACAGACAAAAGTAGAATATTGGCTTTTAACAC -482 CAATATAAAA ACTTGCTTCA CACCTAAACA CTTTTGTTTA -442 CTTTAGGGTAAGTGCAAAAAGCCAACCAAAWCACCTGCA -402 CTGATTTGACGTTTACAAACGCCGTTAAGTTTGTCACCGT -3 62 CTAAACAAAAACAAAGTAGAAGCTAACGGAGCTCCGTTAA -322 TAAATTGACGAAAAGCAAACCAAGTTTTTAGCTTTGGTCC -2 82 CCCTCTTTTACCAAGTGACAATTGATTTAAGCAGTGTCTT -2 42 GTAATTATACAACCATCGATGTCCGTTGATTTAAACAGTG -2 02 TCTTGTAATT AAAAAAATCA G T T T W =AAAATT -162 TATCACTTAGTTTTCATCAACTTCTGAACTTA-122 G A T T A G G C A A T A C T T T D m T A A CTCAAGTGGA -82 CCCTTTACTTCTTCAACTCCATCTCTCTCTTTCTATTTCA -42 CTTCTTTCTTCTCATTATATCTCTTGTCCTCTCCACCAAA -2 TCTCTTCAACAAAAAGATTAAACAAAGAGAGAAGAATATG +39
AP3 Genomic and cDNA Constructs Rescue the ap3 Mutant Phenotype Of four transgenic lines containing the pBam21 construct tested, three lines showed complete rescue to a wild-type floral phenotype of plants homozygous for the ap3-7, ap3-3, and ap3-4 alleles. One pBam21-containingline did not complement the ap3 mutations and was not analyzed further. Complementation of the weak ap3-7 allele by a 6-kb genomic AP3 fragment has also been demonstrated by Okamoto et al. (1994). The three lines containing the pla19 construct also showed complete rescue of these mutant phenotypes to the wild type (Figure 4E). The transgenic complementation was confirmed by segregation analysis of progeny from candidate rescued plants. The pla19 construct contains 1.7 kb 5'of the transcriptional start site and 0.24 kb of 3' untranslated sequence, but it does not contain any intron sequences. Therefore, it appears that essentially all of the spatial and temporal regulatory signals required for proper function of the AP3 gene are contained within this 5' region. Surprisingly, a fusion of the AP3 coding sequence to the constitutive cauliflower mosaic virus 35s
B
Table 1. Transnenic Lines Used in This Studv
I
DefA T
A??3 I Figure 3. Sequence Analysis of the AP3 Promoter.
~~
~
Transgenic Linea
Kanr/KanS Seqreqationb
Number of lnsertsC
B6
160:58 (3:l) 66:27 (3:l)
4 1
72:27 (3:l) 26:9 (3:l) 45:18 (3:l)
1 2 3
88:36 (3:l) 71:26 (3:l) 94:36 (3:l)
2 2
73:17 (3:l)
1
88
B16
(A) Sequence of theAP3 region 5'to the start of translation. Sequences showing similarity with the CArG box motif are underlined. A putative
A6 A7
TATA box is shown in boldface letters. The initiation of transcription as defined by Jack et al. (1992) is at position +l. The 5' ends of the three AP3 cDNAs isolated in this study are at positions +9, +20, and +22. (B)Sequencecomparison of theAP3 and DefA genes. Promoter regions are denoted by a thin bar and exons by a thick bar. lntrons are shown as lines. The positionof introns is conserved between LkfA and AP3, but the length is not. The degree of nucleotide sequence similarity is shown for the promoter regions and exons, with black indicating >80% identity, dark hatching 40 to 80% identity, light hatching 20 to 40%, and no hatching 0.05) segregation of progeny derived from a self of heterozygous plants is given in parentheses. Kan', kanamycin resistant; Kans,kanamycin sensitive. Number of inserts is estimated from number of bands hybridizing on DNA gel blots.
Conservation of Floral Homeotic Gene Function
1639
Table 2. Summarv of Second Whorl Homeotic Transformations in Control and Transgenic Plantsa
Second Whorl Sepaloid Petals
Second Whorl Petaloid Sepals
Second Whorl Sepals
Genotype (N)b
W)
(O4
I010)
ap3-7 (18) ap3-3 (16) ap3-3 D6 (21) ap3-3 D11 (15) ap3-4 (17) ap3-4 D3 (21) ap3-4 D6 (22) a ~ 3 - 4D11 f18)
O O 52
O O 48 67
1O0 1O0 O 33 1O0 42 O 33
O O
~~
a
O 58 27 67
O 73 O ~
~~
~
Average Number of Second Whorl Organs per Flower
~
The percentage of different organ types recovered and the average number of organs per whorl scored in dissected flowers from each geno-
type are listed. N, number of flowers scoced; the number
IS
given in parentheses.
promoter does not completely restore the ap3-3 phenotype to the wild type (Jack et al., 1994). This observation suggests that the 35s promoter may lack some of the regulatory elements present in theAP3 promoter that are necessary to drive expression effectively in these floral tissues.
Complementation of ap3 Mutant Phenotypes by the Chimeric AP3-DefA Construct Transgenic plants containing the pDef7 construct were also crossed to plants homozygousfor the ap3-7,ap3-3, or the ap3-4 allele. For all three of the transgenic lines examined, similar results were obtained. The pDef7 construct is sufficient to rescue plants homozygous for ap3-7 to a wild-type phenotype (Figure 4F). These pDef7 ap3-7 flowers are fertile and have normal seed set. The pDef7 transgene partially complements the strong ap3-3 or ap3-4 lesions. The phenotype produced by ap3-3 plants carrying the pDef7 transgene is less severe than that of ap3-3 homozygous mutants. The pDef7 ap3-3 plants have second whorl organs that are generally petaloid sepals or sepaloid petals (Table 2 and Figure 4G). The epidermal cells in these
second whorl organs have a shape and size very similar to these of wild-type peta1cells but do not appear quite as round or regular (Figure 5E). Furthermore, these transgenic second whorl organs do not appear to be mosaic organs of different cell types. In pDef7 ap3-3 flowers, the most frequent third whorl phenotype consists of freestanding carpelloid stamens, often with distinct locules, that occasionally have ovules along the lateral edges of each organ (Table 3 and Figures 5G to 51). In the pDef7 ap3-4 flowers, we observed a phenotype that is milder than that of ap3-4 flowers (Tables 2 and 3, and Figures 4H and 5J). These phenotypes are similar to those produced by pDef7 ap3-3 plants. In addition, we ObseNed a slight difference in the frequency of these phenotypes with different pDef7 lines (Tables 2 and 3). Plants homozygous for ap3-3 or ap3-4 carrying the D6 transgene showed slightly less severe phenotypes than those carrying the D3 or D11 transgene.
Some Transgenic Lines Show a Cosuppressed Phenotype Approximately 10% of the transgenic lines that we generated displayed a dominant cosuppressed phenotype. These included
~
Table 3. Summary of Third Whorl Homeotic Transformations in Control and Transgenic Plantsa
Carpeloid Stamens
Third Whorl Third Whorl Stamenoid Carpels Fused Carpels
Third Whorl Filaments
( 0 4
( 0 4
(O4
(04
84 O 1O0 89 O
16
O
3
89
O O O 70 44 51
O 1 61 O
O 8 O 10
Third Whorl
Genotype (N) ap3-7 (18) ap3-3 (16) ap3-3 D6 (21) ap3-3 D11 (15) ap3-4 (17) ap3-4 D3 (21) ap3-4 D6 (22) a ~ 3 - 4D11 (18)
30 53 21
~~
a
Notations are as given in Table 2.
O 2
39 O 3 26
Average Number of Third Whorl Organs per Flower 5.6
3.9 5.6 4.7 4.1 4.7 5.5 5.4
1640
The Plant Cell
Figure 4. Phenotypes of ap3 Mutant and Transgenic Arabidopsis Flowers. (A) Wild-type flower. (B) to (D) ap3-7, ap3-3, and ap3-4 homozygous mutant flowers, respectively. (E) Flower from a homozygous ap3-3 mutant plant carrying the A6 transgene shows complete rescue of the mutant phenotype. (F) Flower from a homozygous ap3-7 mutant plant carrying the D3 transgene also shows complete rescue. (G) Flower from a homozygous ap3-3 mutant carrying the D6 transgene shows partial rescue, as compared with the flower in (C). (H) Flower from a homozygous ap3-4 mutant carrying the D3 transgene also shows partial rescue, as compared with the flower in (D). Scale bar in (A) = 0.5 mm for (A) to (H).
three pBam21, four pla19, and five pDef7 lines. The severity of the cosuppressed phenotype varied between lines as well as within individual plants of any one line. In the most severely affected lines, the mutant phenotype resembled that produced by a strong ap3 aliele. Lines showing moderate phenotypes displayed sepaloid petals and partially transformed stamens. Some lines were weakly fertile, had nearly normal organ development, and showed some defects only in the size and shape of the stamens. These were characterized as having weakly cosuppressed phenotypes. In addition, most of the cosuppressed lines had flowers that showed a reversion to a wild-type phenotype. This reversion would often extend through several flowers along an inflorescence.
DISCUSSION
Arabidopsis and Antirrhinum Homeotic Gene Functions Are Conserved We showed that coding sequences from the Antirrhinum DefA gene can functionally complement the Arabidopsis ap3-1 mutation. This functional test demonstrated that the chimeric DefA gene product that we used can interact appropriately with various Arabidopsis proteins to confer a normal developmental pattern to the Arabidopsis flower. However, the pDef7 transgene did not completely complement the strong ap3-3 and
ap3-4 mutations. Plants carrying both the pDef? transgene and a strong ap3 mutation showed defects in both second and third whorl organs, but these transformations were much milder than those produced by strong ap3 mutations alone. In fact, one pDef7-containing line showed almost complete rescue of strong mutations at the AP3 locus (D6; see Tables 2 and 3). The D6 transgenic line produced an almost full restoration of the second whorl to a wild-type phenotype and partial restoration of third whorl organs (Figures 4G and 5G to 51). The chimeric pDef7 construct that we used to rescue mutant ap3 plants contains essentially all of the MADS box domain derived from AP3, with other sequences, including the K-box, derived from the DefA coding region. Thus, the lack of complete rescue seen in the complementation experiments with strong ap3 alleles is due to sequence differences outside the MADS box. This observation indicates that specificity of MADS box gene function is modulated by sequences outside the MADS box. However, the regulatory specificity of homeoboxcontaining genes in Drosophila appears to depend primarily on the specificity of the homeodomain (Kuziora and McGinnis, 1989; Mann and Hogness, 1990). Thus, the mechanisms by which the regulatory specificities of MADS box-containing and homeodomain-containing homeotic genes are specified appear to be distinct. The partial rescue of strong ap3 mutations by the pDef7 transgene can be explained in at least two ways. The pDef7 transgenic product may be able to activate completely only a subset of downstream genes. This model is supported by
Conservation of Floral Homeotic Gene Function
1641
Figure 5. Cellular Phenotypes of Wild-Type, Mutant, and Transgenic Arabidopsis Flowers. (A) to (E) Abaxial surface view of first or second whorl organs. In (A), wild-type (Landsberg erecfa) second whorl petal cells are shown. In (B), wild-type first whorl sepal cells are shown. In (C), ap3-1 second whorl cells at 22°C resemble sepal cells. Note elongated epidermal cells and stomata. In (D), ap3-3 second whorl cells with sepal-like characteristics are shown. In (E), second whorl cells produced by an ap3-3 plant carrying the 06 transgene are shown. The size and shape of epidermal cells are similar to petal cells; note the lack of stomata. (F) to (J) Third whorl organs. In (F), a wild-type stamen during anthesis is shown. In (G) to (I), third whorl organs with increasingly carpelloid characteristics from transgenic ap3-3 plants containing the D6 transgene are shown. In (J), a filamentous third whorl organ from a transgenic ap3-4 plant containing the D3 transgene is shown. Scale bar in (A) = 10 urn for (A) to (E). Scale bar in (F) = 100 urn for (F) to (J).
the observation of intermediate cellular phenotypes in both the second and third whorls. These mosaic organs do not appear to be a mixture of different tissue types, as seen with some of the floral homeotic mutations (Bowman et al., 1989; Irish and Sussex, 1990); rather, the cells themselves appear to have an intermediate shape and size. One interpretation of this intermediate cellular phenotype is that the pDef7 transgene can appropriately regulate some but not all of the downstream genes required to elaborate the cellular architecture. Another possible explanation of the partial rescue results is that the chimeric transgene is not as active as the endogenous AP3 gene, so there is a threshold effect in the ability of the DefA sequences to participate in activating downstream targe! genes. This threshold effect could explain why the chimeric transgene can fully complement the ap3-7 mutation; the chimeric transgene and the defective ap3-1 protein product together could be sufficient to effect normal regulatory functions.
The DefA domain used in these experiments includes the K-box, which is thought to be required for heterodimer formation (Schwarz-Sommer et al., 1992; Trobner et al., 1992). The lack of complete rescue of strong mutant ap3 alleles by the pDef7 transgene suggests that this transgene may not be able to participate as readily in heterodimer formation. Because the AP3 protein is thought to be stabilized by heterodimerizing with PI through the K-box domain (Goto and Meyerowitz, 1994; Jack et ai., 1994), it seems possible that the sequence differences we have introduced have attenuated the stability of such heterodimeric complexes.
Conservation of AP3 and DefA Target Sequences The AP3 and DefA gene products are thought to autoregulate and so presumably bind to sequences present in the respective promoter regions (Schwarz-Sommer et al., 1992; Jack et
1642
The Plant Cell
al., 1994). In vitro studies have shown that the DefA CArG box at position -1207 effectively binds DefA-Glo heterodimers (Trobner et al., 1992). The conservation of a putative CArG box at approximately the same distance upstream of the start of AP3 and DefA translation, embedded in an otherwise nonconserved promoter region, suggests that these gene products may bind to this sequence to effect appropriate autoregulation. Additional evidence that this autoregulatory circuit is conserved within dicots is based on observationsthat thisAP3 promoter drives apparently normal B gene expression of a reporter gene in tobacco (Day et al., 1995). The complementation assay we have used is conceptually different from that used to examine the functional equivalence of orthologous homeotic genes in other systems. Conservation of mammalian and Drosphila homeotic gene functions has been assessed by comparing the phenotypes produced by ectopic overexpression of mammalian Hox genes with that produced by ectopic overexpression of the orthologous endogenous genes in Drosophila. In some cases, these experiments suggest that the orthologous genes are functionally similar, whereas other comparisons indicate differences in function (Malicki et al., 1990; McGinnis et al., 1990; Bachiller et al., 1994). However, it is not clear whether these differences are due to unexpected interactions between the ectopically expressed genes and spatially restricted gene products that do not normally participate in such regulatory cascades (Bachiller et al., 1994). Similarly, the fact that ectopically induced expression of Brassica AGAMOUS (BAG7) and tobacco AGAMOUS (NAG7) in tobacco produces somewhat different phenotypes can be explained by nove1 and different interactions of these ectopic gene products with the endogenous regulatory machinery (Mande1 et al., 1992; Kempin et al., 1993). In our experiments, the heterologous Antirrhinum sequences were expressed in the appropriateAP3 domain so that we could investigatethe extent to which this gene can replace the normal regulatory functions of its ortholog. Thus, these experiments provide a more sensitive assay for assessing the equivalence of orthologous gene functions.
lmplications for the Evolution of Regulatory Pathways Despite the observations of similarities in the sequences of and mutant phenotypes conferred by the floral homeotic genes, explicit models for how these developmental pathways might be similar have not been detailed (Coen, 1991). How are the extreme differences in floral morphology generated? At least four possibilities explain the wide variety of speciesspecific differences in peta1 and stamen morphology. First, differences in the expression of homeotic genes could potentially confer some of these unique morphologies. The slight differences in expression patterns of apparently similar floral homeotic genes from different species provide some support for such a model. Second, altering the specificity of heterodimeric pairing partners of the AP3 and DefA proteins could lead to new regulatory cascades. Although the K-box, which is
thought to be required for heterodimerizationof these proteins, has diverged at the sequence level, these K-box domains appear to share a conservation of secondary Structure (Ma et al., 1991; Pnueli et al., 1991). One could imagine a coevolution of pairing partners that could then lead to activation of new suites of target genes. However, we demonstrated here that the DefA K-box can partially substitute forAP3 sequences and so presumably can interact with the PIgene product. Third, differences in CArG box binding sites could be responsible for differences in target gene activation. In vitro studies have suggested that different MADS box-containing genes have somewhat different target site specificities (Trobner et al., 1992; Huang et al., 1993; Shiraishi et al., 1993), but the extent to which these differences play a role in modulating target gene expression in vivo is unclear. Our comparison of promoter sequences suggests that such differences may be subtle (Figure 2). Finally, differences in target gene function could be largely responsible for defining species-specific morphologies. Our evidence showing that the DefA coding sequences can compensate for mutations in the AP3 gene suggests that differences in target gene function probably are responsible in large part for the significant morphologicalchanges we see in flower form.
METHODS
Cloning and Sequencing DNA manipulationswere performed according to standard techniques. Four APE TALA3 (AP3) genomic clones were recovered by screening a XFlX genomic Landsbergerecta library (a gift from 8. Hauge, Massachusetts General Hospital, Boston, MA) with pDeflB (kindly provided by Z. Schwarz-Sommer, Max-Planck-lnstitutfür Züchtungsforschung, Cologne, Germany) (Sommer et al., 1990). Hybridizationswere performed at Iow stringency with washes at 60% in 0.3 M NaCI, 20 mM sodium phosphate, 2 mM EDTA, 0.5% SDS, pH 7.0. A 1.9-kb Hindlll fragment corresponding to the MADS box and 5’ upstream region of AP3 was subcloned into pBluescribe (Stratagene) to give pV15. This 1.9-kb region was sequenced using a combination of Xbal or Sacl subclones in pBluescript II SK+ (Stratagene) and specific primers. 60th strands were sequenced in double-strandedsequencing reactions using Sequenase (U.S. Biochemical). The AP3 promoter sequence has GenBank accession number of U30729.
Plasmid Constructions pBam21 was generated by subcloning a BamHl genomic fragment containing theAP3 gene into pBin19 (Bevan, 1984). Three AP3 cDNA clones were obtained by screening a Landsberg erecta inflorescence cDNA library (Yamamoto et al., 1995) at high stringency with washes at 0.1 x SSC (1 x SSC is 0.15 M NaCI, 0.015 sodium citrate), 0.1% SDS at 65OC. One full-length AP3 cDNA, pla, was completely sequenced, and the coding region is identical to that published by Jack et al. (1992). The pla19 construct was generated by subcloning a HindlllSmal pla fragment corresponding to the 3’ end of the AP3 cDNA into a Hindlll-Smal cut pBinl9/cauliflower mosaic virus 35s promoterl
Conservation of Floral Homeotic Gene Function
nopaline synthase terminator vector (kindly provided by M. Conkling, North Carolina State University, Raleigh. NC). This intermediate construct was then cut with Hindlll, and the 1.9-kbgenomic Hindlll fragment corresponding to the promoter and 5' end of the AP3 gene was inserted to give pla19. pDef7 was generated in a similar manner, except that a Hindlll-EcoAV fragment of the pDeflB clone was used for subcloning into the pBinl9/35Slnopaline synthase terminator vector.
Generation and Analysis of Transformants Constructs generated in the binary pBinl9 vector were transferred to Agrobacterium tumefaciens LBA4404 by electroporation. Arabidopsis thaliana wild-type (Nossen ecotype) roots were transformed using standard procedures (Valvekenset al., 1988). Kanamycin-resistantplantlets were rooted, and seed were collected from putative transformants. The presence of the transgene was confirmed by segregation of the kanamycin resistance trait to progeny, as well as by DNA gel blotting with probes corresponding to AP3 or Deficiens (DefA) sequences. RNA gel blot analyses were performed using standard methods, with total RNA extracted using Trizol (Gibco BAL). Transgenic plants were used as pollen donors in crosses to ap3 mutant plants. Tissue was prepared for scanning electron microscopy as previously described (Irish and Sussex, 1990).
ACKNOWLEDGMENTS
We thank Zsuzsanna Schwarz-Sommerfor providing the pDeflB clone, Brian Hauge for the Arabidopsis genomic library, and Mark Conkling for the pBinl9/35S/nopaline synthase terminator vector. We also appreciate the technical assistance of Roberta Miller and Roshani Anandappa in plasmid generation and sequence analysis. We thank members of fhe lrish laboratory for critical comments on the manuscript. This work was supported by U.S. Department of Agriculture Grant No. 92-37304-7716and National Science Foundation Grant No. IBN9220536 to V.F.I., and a McKnight Foundation Grant to Yale University. Received April 28, 1995; accepted August 7, 1995.
REFERENCES
Bachiller, D., Macias, A., Duboule, D., and Morata, G. (1994). Conservation of a functional hierarchy between mammalian and insect Hox-Hom genes. EMBO J. 13, 1930-1941.
1643
Cronquist,A. (1981). An lntegratedSystem of Classification of Flowering Plants. (New York: Columbia University Press). Cronquist, A. (1988). The Evolution and Classification of Flowering Plants. (New York: New York Botanical Garden). Day, C.D., Galgoci, B.F.C., and Irish, V.F. (1995). Genetic ablation of petal and stamen primordia to elucidate cell interactions during floral development. Development 121, 2887-2895. Goto, K., and Meyerowitz, E.M. (1994). Function and regulation of the Arabidopsis floral homeotic gene PISTILLATA. Genes Dev. 8, 1548-1560. Halfter, U., Ali, N., Stockhaus, J., Ren, L., and Chua, N.-H. (1994). Ectopic expression of a single homeotic gene, the petunia gene green petal, is sufficient to convert sepals to petaloid organs. EMBO J. 13, 1443-1449. Hill, J.P., and Lord, E.M. (1989). Floral development in Arabidopsis thaliana: A comparison of the wild type and the homeotic pistillata mutant. Can. J. Bot. 67, 2922-2936. Huang, H., Mizukami, Y., Hu, Y., and Ma, H. (1993). lsolation and characterization of the binding sequences for the product of the Arabidopsis floral homeotic gene AGAMOUS. Nucleic Acids Res. 21, 4769-4776. Irish, V.F., and Sussex, I.M. (1990). Function of the apetala-7 gene during Arabidopsis floral development. Plant Cell 2, 741-753. Jack, T., Brockman, L.L., and Meyerowitz, E.M. (1992). The homeotic gene APETALA3 of Arabidopsis thaliana encodes a MADS box and is expressed in petals and stamens. Cell 68, 683-697. Jack, T., Fox, G.L., and Meyerowitz, E.M. (1994). Arabidopsis homeotic gene APETALA3 ectopic expression: Transcriptional and posttranscriptional regulation determine floral organ identity. Cell 76, 703-716. Kempin, S.A., Mandel, M.A., and Yanofsky, M.F. (1993). Conversion of perianth into reproductive organs by ectopic expression of the tobacco floral homeotic gene NAG7. Plant Physiol. 103, 1041-1046. Kush, A,, Brunelle, A., Shevell, D., and Chua, N.-H. (1993). The cDNA sequence of two MADS box proteins in petunia. Plant Physiol. 102, 1051-1052. Kuziora, M.A., and McGinnis, W. (1989). A homeodomain substitution changes the regulatory specificity of the Deformed protein in Drosophila embryos. Cell 59, 563-571. Ma, H., Yanofsky, M.F., and Meyerowitz, E.M. (1991). AGL7-AGLG, an Arabidopsis gene family with similarity to floral homeotic and transcription factor genes. Genes Dev. 5, 484-495. Malicki, J., Schughart, K., and McGinnis,W. (1990). Mouse Hox 2.2 specifies thoracic segmenta1 identity in Drosophila embryos and larvae. Cell 63, 961-967.
Bevan, M. (1984). Einary Agrobacterium vectors for plant transformation. Nucleic Acids Res. 12, 8711-8721.
Mandel, M.A., Bowman, J.L., Kempin, S.A., Ma, H., Meyerowitz, E.M., and Yanofsky, M.F. (1992). Manipulation of flower structure in transgenic tobacco. Cell 71, 133-143.
Bowman, J.L., Smyth, D.R., and Meyerowitz, E.M. (1989). Genes directing flower development in Arabidopsis. Plant Cell 1, 37-52.
Mann, R.S., and Hogness, D.S. (1990). Functional dissection of Ultrabithorax proteins in D. melanogastel: Cell 60, 597-610.
Christ, C., and Tye, B.-K. (1991). Functional domains of the yeast transcriptionlreplication factor MCMI. Genes Dev. 5, 751-763.
McGinnis, N., Kuziora, M.A., and McGinnis, W. (1990). Human Hox 4.2 and Drosophila Deformed encode similar regulatory specificities in Drosophila embryos and larvae. Cell 63, 969-976.
Coen, E.S. (1991). The role of homeotic genes in flower development and evolution. Annu. Rev. Plant Physiol. Plant MOI.Biol. 42,241-279. Coen, E.S., and Meyerowitz, E.M. (1991). The war of the whorls: Genetic interactions controlling flower development. Nature 353, 31-37.
Meyerowitz, E M . , Bowman, J.L., Brockman, L.L., Drews, G.N., Jack, T., Sieburth, L.E., and Weigel, D. (1991). A genetic and molecular model for floral development in Arabidopsis thaliana. Development 1, 157-167.
1644
The
Plant Cell
Muller, J. (1981). Fossil pollen records of extant angiosperms. Bot. Rev. 47, 1-140. Norman, A., Runswick, M., Pollock, R., and Treisman, R. (1988). lsolation and properties of fos cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element. Cell 55, 989-1003. Okamoto, H., Yano, A., Shiraishi, H., Okada, K., and Shimura, Y. (1994). Genetic complementation of a floral homeotic mutation, apetala3, with Arabidopsis thaliana gene homologous to DEFlClENS of Antirrhinum majus. Plant MOI. Biol. 26, 465-472. Passmore, S., Maine, G.T., Elble, R., Christ, C., and Tye, B.-K. (1988). Saccharomyces cerevisiae protein involved in plasmid maintenance is necessary for mating of MATa cells. J. MOI. Biol. 204, 593-606. Pnueli, L., AbuAbeid, M., Zamir, D., Nacken, W., Schwarz-Sommer, Z., and Lifschitz, E. (1991). The MADS box gene family in tomato: Temporal expression during floral development, conserved secondary structures and homology with homeotic genes from Antirrhinum and Arabidopsis. Plant J. 1, 255-266. Schwarz-Sommer, Z.,Hue, I., Huijser, P., Flor, P.J., Hansen, R., Tetens, F., Lonnig, W.-E., Saedler, H., and Sommer, H. (1992). Characterization of the Antirrhinum floral homeotic MADS-box gene deficiens: Evidence for DNA binding and autoregulation of its persistent expression throughout flower development. EMBO J. 11, 251-263.
Shiraishi, H., Okada, K., and Shlmura, Y. (1993). Nucleotide sequences recognized by the AGAMOUS MADS domain of Arabidopsis fhaliana in vitro. Plant J. 4, 385-398. Sommer, H., Beltran, J.-P., Huijser, P., Pape, H., Lonnig, W.-E., Saedler, H., and Schwarz-Sommer, 2. (1990). Deficiens, a homeotic gene involved in the control of flower morphogenesis in Antirrhinum majus: The protein shows homology to transcription factors. EMBO J. 9, 605-613. Trobner, W., Ramirez, L., Motte, P., Hue, I.,Huijser, P., Lonnig, W.E., Saedler, H.; Sommer, H., and Schwarz-Sommer, 2 . (1992). Globosa-A homeotic gene which interacts with deficiens in the control of Antirrhinum floral organogenesis. EMBO J. 11, 4693-4704. Valvekens, D., Van Montagu, M., and Van Lijsebettens, M. (1988). Agrobacterium tumefaciens-mediated transformation of Arabidopsis fhaliana root explants by using kanamycin selection. Proc. Natl. Acad. Sci. USA 85, 5536-5540. van der Krol, A.R., Brunelle, A., Tsuchimoto, S., and Chua, N.-H. (1993). Functional analysis of petunia floral homeotic MADS box gene pMADS1. Genes Dev. 7, 1214-1228. Yamamoto, Y.T., Conkling, M.A., Sussex, I.M., and Irish, V:F. (1995). An Arabidopsis cDNA related to animal phosphoinosttide-specific phospholipase C genes. Plant Physiol. 107, 1029-1030.