125
Constant expression of hexose-6-phosphate dehydrogenase during differentiation of human adipose-derived mesenchymal stem cells Silvia Senesi1*, Paola Marcolongo1*, Ivana Manini2, Rosella Fulceri1, Vincenzo Sorrentino2, Miklo´s Csala3,4, Ga´bor Ba´nhegyi1,3,4 and Angelo Benedetti1 1
Department of Pathophysiology, Experimental Medicine and Public Health, University of Siena, Via A. Moro no. 1, 53100 Siena, Italy
2
Molecular Medicine Section, Department of Neuroscience and Center for Stem Cell Research, University of Siena, Siena, Italy
3
Department of Medical Chemistry, Molecular Biology and Pathobiochemistry, Semmelweis University, Budapest, Hungary
4
Pathobiochemistry Research Group of the Hungarian Academy of Sciences, Budapest, Hungary
(Correspondence should be addressed to A Benedetti; Email:
[email protected]) *S Senesi and P Marcolongo contributed equally to this work
Abstract The reductase activity of 11b-hydroxysteroid dehydrogenase type 1 (HSD11B1) plays an important role in the growth and differentiation of adipose tissue via the prereceptorial activation of glucocorticoids. This enzyme colocalizes with hexose-6phosphate dehydrogenase (H6PD) at the luminal surface of the endoplasmic reticulum membrane, and the latter enzyme provides NADPH to the former, which can thus act as an 11b-reductase. It was suggested that, during adipogenesis, the increased expression of H6PD causes a dehydrogenase-to-reductase switch in the activity of HSD11B1. However, only the expression of the HSD11B1 has been extensively studied, and little is known about the expression of H6PD. Here, we investigated the expression and the activity of H6PD in the course of the differentiation of human adipose-derived mesenchymal stem cells (ADMSCs) and murine 3T3-L1 cells. It was found that H6PD is already present in adipose-derived stem cells and in 3T3-L1 fibroblasts even before the induction of adipogenesis. Moreover, mRNA and protein levels, as well as the microsomal H6PD activities remained unchanged during the differentiation. At the same time a great induction of HSD11B1 was observed in both cell types. The observed constant expression of H6PD suggests that HSD11B1 acts as a reductase throughout the adipogenesis process in human ADMSCs and murine 3T3-L1 cells. Journal of Molecular Endocrinology (2008) 41, 125–133
Introduction Hexose-6-phosphate dehydrogenase (H6PD) catalyzes the first two reactions of the pentose phosphate pathway in the endoplasmic reticulum (ER), thereby generating reduced NAD (NADPH) within the luminal compartment (Buetler & Morrison 1967, Takahashi & Hori 1978, Ozols 1993, Collard et al. 1999, Mason et al. 1999, Clarke & Mason 2003). It uses a separate pool of glucose-6phosphate and NADPC distinct from the cytosolic ones (Ba´nhegyi et al. 2004, Czegle et al. 2005). It has been proposed that the luminal [NADPH]/[NADPC] ratio determines the direction of the activity of the ER luminal enzyme 11b-hydroxysteroid dehydrogenase type 1 (HSD11B1; Atanasov et al. 2004, Hewitt et al. 2004, Odermatt et al. 2006). Indeed, HSD11B1 in vitro catalyzes the reversible conversion between (inactive) 11-ketoglucocorticoids and (active) 11-hydroxyglucocorticoids, although in intact cells acts predominately as a reductase consuming NADPH and activating glucocorticoids. Journal of Molecular Endocrinology (2008) 41, 125–133 0952–5041/08/041–125 q 2008 Society for Endocrinology Printed in Great Britain
The local activation of glucocorticoids could have various pathophysiological roles, such as stimulation of adipogenesis (Seckl & Walker 2004, Tomlinson et al. 2004, Draper & Stewart 2005). An enhanced lipogenesis, for example, is considered to be key event in abdominal obesity and metabolic syndrome (Tomlinson & Stewart 2002, Seckl et al. 2004, Andrew et al. 2005). An important role in adipogenesis has been attributed to H6PD (Atanasov et al. 2004, Hewitt et al. 2004, Odermatt et al. 2006). It was demonstrated that mutations in genes of both HSD11B1 and H6PD in a triallelic digenic model of inheritance result in the loss of HSD11B1 reductase activity (Draper et al. 2003). During the differentiation of human omental adipose stromal cells, a switch was observed in HSD11B1 activity from dehydrogenase to reductase direction (Bujalska et al. 2002). Later an increased H6PD expression was reported during adipocyte differentiation and it was associated with the previously described switch in HSD11B1 activity (Atanasov et al. 2004). A transient mild increase in DOI: 10.1677/JME-08-0028 Online version via http://www.endocrinology-journals.org
126
S SENESI, P MARCOLONGO
and others . H6PD expression during adipogenesis
H6PD mRNA levels was observed during the differentiation of the transformed human s.c. preadipocyte cell line Chub-S7 (Bujalska et al. 2008). These results were supported by the observation that HSD11B1 has increased reductase and decreased dehydrogenase activity when coexpressed with H6PD in HEK-293 cells (Atanasov et al. 2004, Bujalska et al. 2005, Nashev et al. 2007). Transfection of HEK-293 cells with an H6PD siRNA decreased HSD11B1 reductase activity (Bujalska et al. 2005). Moreover, it was found that in H6PD knockout mice, the HSD11B1-mediated prereceptorial glucocorticoid activation was impaired (Lavery et al. 2006). Therefore, it was postulated that the early induction of H6PD was responsible for the appearance of HSD11B1 reductase activity and the consequent prereceptorial glucocorticoid activation in preadipocyte differentiation. However, the theory has some drawbacks. The absence or low activity of a luminal NADPH-generating enzyme is not enough to postulate a low [NADPH]/ [NADPC] ratio. One should suppose the presence of an NADPH-dependent reductase in the same compartment that could regenerate NADPC for the dehydrogenase activity of HSD11B1; however, such activity has not been reported in preadipocytes. On the other hand, several reports showed that H6PD is present in a variety of cell types, including fibroblast (Takahashi & Hori 1978). Moreover, NADPH-generating enzymes other than H6PD can be found in the ER lumen (Margittai & Ba´nhegyi 2008). These circumstances can query the postulated role of H6PD in adipogenesis. Therefore, we (re)examined the expression and activity of H6PD and HSD11B1 during the process of adipogenesis. To this end, we used highly undifferentiated cells prepared from human adipose tissue, which present with the differentiation properties of mesenchymal stem cell – referred to here as adiposederived mesenchymal stem cells (ADMSCs) – and murine 3T3-L1 fibroblasts. As a main result, we observed that H6PD expression and activity do not change during adipogenesis, while HSD11B1 expression largely increases in our experimental systems. As a main conclusion, therefore, the hypothesis that the appearance of H6PD confers the reductase activity to HSD11B1 does not have a general validity.
ADMSCs were prepared from human adipose tissue obtained from patients undergoing elective liposuction or lipectomy procedures. Cells were isolated using a protocol previously described (Zuk et al. 2001), with some modifications. Adipose tissue was minced into small pieces and washed with PBS, containing antibiotics (100 IU/ml penicillin, 100 mg/ml streptomycin). To isolate the stromal-vascular fraction (SVF), the tissue fragments were treated with 0.075% collagenase and 0.25 mM CaCl2, in PBS (4 ml of solution for g of tissue), for 1 h, at 37 8C, under gentle agitation. Digestion was stopped by adding an equal volume of a-MEM containing 10% FBS, 100 U/ml penicillin, 100 mg/ml streptomycin, and 2 mM L-glutamine and the cell suspension was centrifuged at 600 g, for 10 min, at 22 8C. The pellet was resuspended in culture medium, filtered through nylon sheet (100 mm mesh), and centrifuged again as above. The SVF pellet was resuspended in culture medium and filtered again through 70 mm nylon mesh. The stromal cells were counted and plated at 1 00 000 cells/cm2 onto tissue culture plastic dishes for 24 h at 37 8C in a humidified atmosphere of 5% CO2 and 95% air. Contaminating erythrocytes and non-adherent cells were then removed by washing dishes with PBS. Cells were cultured for 7–10 days to reach a 70–80% confluence, detached with 0.25% Trypsin/0.53 mM EDTA in PBS, and seeded at 4000 cells/cm2 and subcultured after 7 days. Cells were used between passages 2–5. For differentiation into adipocytes, cells were plated at 20 000 cells/cm2 in MesenCult Basal Medium supplemented with 10% FBS, antibiotic, and 1% L-glutamine. After 24–48 h, the same medium containing 1 mM dexamethasone, 10 mM insulin, 0.5 mM IBMX, and 200 mM indomethacin, was added. After 21 days of adipogenic stimulation, cells were fixed in 4% PFA for 1 h and incubated with Oil Red-O to stain lipid vacuoles. Chondrogenic and osteogenic differentiations were induced as described elsewhere (Gallo et al. 2007).
Materials and methods
Culturing and differentiation of 3T3-L1 fibroblasts
Materials
Cortisone, cortisol, dexamethasone, isobutylmethyl xanthine (IBMX), glucose-6-phosphate, NADPC , NADPH, triton X-100, collagenase (type IA), and 4-morpholinepropanesulfonic acid (MOPS) were purchased from Sigma Chemical Co. Dulbecco’s minimum essential medium (DMEM), a-Minimum Essential Journal of Molecular Endocrinology (2008) 41, 125–133
Medium Eagle (a-MEM), and fetal bovine serum (FBS) were from Cambrex. All other reagents and solvents were of analytical grade. Preparation, culturing, and differentiation of ADMSCs
3T3-L1 fibroblasts (American Type Culture Collection, Rockville, MD, USA) were cultured and differentiated as described by Frost & Lane (1985). Briefly, 2 days after confluence – referred to as 0 day – adipogenesis was induced by the addition of DMEM containing 10% FBS, 5 mg/ml insulin, 0.5 mM IBMX, and 0.5 mM dexamethasone. After 2 days, the medium was removed and cells were further cultured for 2 days in DMEM containing www.endocrinology-journals.org
H6PD expression during adipogenesis .
10% FBS and 5 mg/ml insulin. Cells were then maintained in DMEM containing 10% FBS until use, normally at the seventh day after starting adipogenesis. Real-time RT-PCR assay
Total RNA from ADMSCs and 3T3-L1 cells was isolated with RNeasy Plus Mini kit (Qiagen), according to the manufacturer’s instructions. One microgram of RNA was reverse transcribed in a final volume of 20 ml, using the SuperScript first-strand synthesis System III (Invitrogen) and Oligo(dT)12–18. Expression levels of HSD11B1 and H6PD – as well as of Rplp0 and b-2-microglobulin (B2M) as reference genes – were quantified by fluorescent real-time PCR with an Opticon Monitor 3 (Biorad, Segrate, Milan, Italy). Analyses were performed in triplicate in a 25 ml reaction mixture. cDNA (1 ml) was amplified with Platinum SYBR Green qPCR SuperMix UDG (Invitrogen) and 50 nM of the sense and antisense primers. Amplification protocol was: 95 8C (15 min), 45 cycles of 95 8C (20 s), variable (20 s), 72 8C (20 s). Sequences of PCR primers for human and murine genes are given in Table 1. The annealing temperature and the amplification efficiency for each primer pair are also indicated. Amplification efficiency was evaluated by serial (tenfold) dilutions of suitable template cDNA and was calculated as reported (Pfaffl 2001). Every assay was run in triplicate and negative controls (no template, template produced with no reverse transcriptase enzyme) were always included. In the negative controls, no signal was detected in the investigated amplification range (45 cycles). Preparation of microsomal fractions
3T3-L1 cells (before and after the induction of adipogenesis) were washed with PBS, scraped off, and homogenized in 300 mM sucrose, 20 mM HEPES, 1 mM EDTA (pH 7.4), including protease inhibitors (Complete, Roche), using a Dounce-type glass tissue homogenizer. Homogenates were centrifuged at 10 000 g for 10 min and the supernatant was
S SENESI, P MARCOLONGO
and others
subsequently centrifuged at 150 000 g for 90 min. The microsomal pellet was resuspended in the Mops buffer (100 mM KCl, 20 mM NaCl, 1 mM MgCl2, 20 mM Mops (pH 7.2)) and stored in liquid nitrogen until used. Liver microsomes were prepared as reported (Burchell et al. 1987). To prepare adipose microsomes, human omental adipose tissue was minced and homogenized at 20% (w/v) in 300 mM sucrose, 20 mM HEPES (pH 7.2), including protease inhibitors (Complete, Roche). Homogenates were centrifuged at 10 000 g for 20 min, and the supernatant was subsequently centrifuged at 100 000 g for 120 min. The microsomal pellet was resuspended in the Mops buffer and stored in liquid nitrogen until use. Human liver and omental adipose tissue samples were small portions of wedge samples obtained for the investigation of the original condition for which the patient was referred. The local Ethical Committee of the Semmelweis University approved this study. Preparation of lysates from ADMSCs
ADMSCs (before and after the induction of adipogenesis) were washed with PBS, scraped off, and incubated in 20 mM Tris, 135 mM NaCl, 10% glycerol, 1% Nonidet P-40, 10 mM EDTA – including protease inhibitors (Complete, Roche) – for 30 min at 0–4 8C. Lysates were then centrifuged at 10 000 g for 10 min, and supernatants were used for western blot analysis. Western blot analysis
Microsomal proteins or proteins of cellular lysates were resolved on 12% polyacrylamide gels and blotted on nitrocellulose. Immunoblots were probed with the different antibodies and analyzed by enhanced chemiluminescence (ECL). Horseradish peroxidase-conjugated anti-rabbit Ig-specific secondary antibody and an ECL kit were from Amersham Biosciences. The H6PD protein was immunoreacted with a rabbit polyclonal antiserum against the lactonase domain (residues 539– 791) of human H6PD (Marcolongo et al. 2007) kindly
Table 1 Primer sequences for real-time RT-PCR. Sense and antisense primers are given for each gene at 5 0 –3 0 direction as specified. The annealing temperature and the amplification efficiency for each primer pair are also indicated
Gene m Rplp0 m Hsd11b1 m H6pd h B2M H HSD11B1 h H6PD
Sense (5 0 –3 0 )
Antisense (5 0 –3 0 )
Annealing temperature (8C)
Amplification efficiency
AAG CGC GTC CTG GCA TTG TCT CCA GCA AAG GGA TTG GAA GAG A GGA GCT GAT CTC CAA GCT GGC TGCTGTCTCCATGTTTGATGTATCT CCAGCAAAGGGATCGGAAGAG ATGAAAGAGACCGTGGATGCTGAA
CCG CAG GGG CAG CAG TGG T GTA GTG AGC AGA GGC TGC TCC CCC TGA CAG TGC CAG GTG GAA TCTCTGCTCCCCACCTCTAAGT GTAGTGTGCTGAGGCTGCTCC CTCCATGGCCACGAGGGTGAG
58 55.2 56 53 55.4 57
1.99 1.93 1.77 1.92 1.85 1.86
m, murine; h, human. www.endocrinology-journals.org
Journal of Molecular Endocrinology (2008) 41, 125–133
127
128
S SENESI, P MARCOLONGO
and others . H6PD expression during adipogenesis
provided by Dr E van Schaftingen (Laboratoire de Chimie Physiologique, ICP and UCL, Brussels B-1200, Belgium). The HSD11B1 protein was immunorevealed with rabbit polyclonal antibodies recognizing a 15 amino acid sequence common to the human and murine proteins (Cayman Chemical, Ann Arbor, MI, USA). Measurement of microsomal H6PD activity
Just before each experiment, 3T3-L1 microsomes were thawed and washed by rapid centrifugation, and the microsomal pellets resuspended in Mops buffer (Marcolongo et al. 2007). H6PD activity was evaluated in the microsomal suspensions (0.1–0.33 mg of protein per ml, in the Mops buffer) by measuring NADPH formation upon the subsequent addition of 2 mM NADPC, 1 mM G6P, and Triton X100 (1% final concentration) as previously reported in details (Marcolongo et al. 2007). Fluorescence of NADPH was monitored at a 350 nm excitation and a 460 nm emission wavelength using a Cary Eclipse fluorescence spectrophotometer (Varian, Palo Alto, CA, USA). HSD11B1 activities in ADMSCs and 3T3-L1 cells
Reduction of cortisone to cortisol and oxidation of cortisol to cortisone were measured by incubating the cells (0.2–1!106 in a final volume of 1 ml) in the presence of 1 mM steroid, for 2 h at 37 8C. The reaction was terminated by the addition of equal volume of ice-cold methanol and the samples were kept at K20 8C until analysis. After the sedimentation of the precipitates by centrifugation (20 000 g for 10 min at 4 8C), the cortisol and cortisone contents of the supernatants were measured by HPLC (Waters Alliance 2690) using a Nucleosil 100 C18 column (5 mm 25!0.46) (Teknokroma. Barcelona, Spain). The mobile phase was isocratic methanol–water (58:42, v/v) at 0.7 ml/min flow rate and absorbance was detected at 245 nm wavelength (Waters Dual l Absorbance Detector 2487). The retention times of cortisone (14.1 min) and cortisol (16.8 min) were determined by injecting standards.
Results Characterization of the human ADMSCs
Previous studies on glucocorticoid-induced adipogenesis have been conducted in rodent cell lines such as the mouse 3T3-L1 or in SVF from human adipose tissue. However, SVF represents a heterogeneous cell population (Varma et al. 2007, De Sousa Peixoto et al. 2008); therefore, we prepared mesenchymal precursor/stem cells from human adipose tissue ADMSCs, as these cells represent undifferentiated precursor of several mesenchymal lineages including chondrocytes, osteocytes, and Journal of Molecular Endocrinology (2008) 41, 125–133
adipocytes (Zuk et al. 2001, 2002). The differentiative potentials of these mesenchymal cells were confirmed following culture in specific media for differentiation in adipogenic, osteogenic, and chondrogenic phenotypes as detailed in the ‘Materials and methods’ section. The degree of adipogenic, osteogenic, and chondrogenic differentiations was evaluated by specific staining with Oil Red-O, Alizarin Red S, and Alcian blue, as shown in Fig. 1. Differentiation of these cells in the three lineages was also confirmed by RT-PCR analysis of specific genes (peroxisome proliferator-activated receptor-g, alkaline phosphatase, and decorin respectively; data not shown). Cortisone reductase activity increases in ADMSCs and 3T3-L1 cells during differentiation
Undifferentiated ADMSCs reduced a negligible amount of cortisone to cortisol. The adipogenic differentiation was associated with a remarkable increase in the reductase activity: at the 7th and 14th days of the adipogenesis-inducing treatment, ADMSCs converted 36.5 and 32.8% (means of two separate experiments) of the added cortisone to cortisol respectively. In accordance with the previous observations (Napolitano et al. 1998), a little (lower than 2%) cortisone to cortisol conversion was measured in undifferentiated 3T3-L1 cells. Differentiation was accompanied by a severalfold elevation of the reductase activity, reaching a peak value at the seventh day (Fig. 2). Dehydrogenase activity (i.e., cortisol to cortisone conversion) was under the detection limit in the undifferentiated cells, and remained very low even at the seventh day (approx 3%, see Fig. 2). Increased reductase activity is due to HSD11B1 rather than H6PD induction
Increased 11-ketoglucocorticoid reductase activity upon adipogenesis has been attributed to both HSD11B1 and H6PD induction. However, the induction of H6PD was demonstrated only at mRNA level. Our immunoblot analysis using an antibody against the lactonase domain of H6PD (Marcolongo et al. 2007) revealed that the amount of this protein in the undifferentiated ADMSCs and 3T3-L1 fibroblasts is well comparable with that observed after the induction of adipogenesis in both cell types (Fig. 3). By contrast, the HSD11B1 protein was hardly detectable in ADMSCs and 3T3-L1 fibroblasts, but a strong induction could be demonstrated during the differentiation process (Fig. 3). Since the amount of ADMSCs did not allow the preparation of sufficient amounts of microsomal fraction – and cell lysates cannot be used for obvious reasons – H6PD activity was measured in microsomes prepared from 3T3-L1 cells. In accordance with the results obtained by immunoblotting, the H6PD activity was practically www.endocrinology-journals.org
H6PD expression during adipogenesis .
S SENESI, P MARCOLONGO
and others
Figure 1 Mesenchymal multilineage differentiation of ADMSCs. Cytochemical staining of mesenchymal precursor/stem cells at passage 5, following the induction of differentiation toward (B) adipogenic, (D) osteogenic, and (F) chondrogenic lineages. Cells maintained in proliferative medium – i.e., in the absence of the differentiating agents – were used as negative controls (A, C, and E). Adipogenic, osteogenic, and chondrogenic differentiations were evaluated by specific staining with Oil Red-O (A and B), Alizarin Red S (C and D), and Alcian blue (E and F) respectively. Note that chondrogenic differentiation, using the micromass technique, leads to the formation of a chondrocyte nodule (F). Images were taken with an inverted microscope Zeiss Axiovert 40C equipped with a Canon Power Shot G6 digital. Original magnification 20!.
constant during the differentiation (day 0Z2.74G0.91; day 3Z2.99G1.54; day 7Z2.92G1.14 nmol/min per mg microsomal protein, nZ3, meansGS.D). H6PD mRNA levels do not change during adipogenesis
To further confirm the results obtained at protein level, H6PD and HSD11B1 mRNA levels were measured by real-time RT-PCR in ADMSCs and 3T3-L1 fibroblasts before and after the induction of adipogenesis. While the relative expression of HSD11B1 was strongly elevated in both cell types in fully differentiated cells (37-fold in ADMSCs and 204-fold in 3T3-L1 cells, Fig. 4A and B respectively), H6PD expression remained at the same level (Fig. 4).
Discussion The present results demonstrate that H6PD mRNA, protein, and activity are present in undifferentiated www.endocrinology-journals.org
cells including mesenchymal precursor/stem cells ADMSCs and 3T3-L1 fibroblasts even before the induction of adipogenesis. Moreover, the mRNA and protein levels, as well as the microsomal H6PD activities remain more or less unchanged during the differentiation toward an adipocyte phenotype. These findings are in line with the supposed housekeeping function of the enzyme. In fact, a systematic screening of the occurrence of H6PD protein in various tissues showed that it is a ubiquitous enzyme (Banhegyi, unpublished results; see also Gomez-Sanchez et al. 2007). The presence of an active H6PD protein in progenitor cells suggests that HSD11B1 must act as a reductase throughout adipogenesis. A very recent study supports this view demonstrating that the mouse adipose stromal vascular cells (ASVCs) express H6PD, consistent with dominant reductase activity of HSD11B1 (De Sousa-Peixoto et al. 2008). Conflicting results were previously reported by others in human ASVCs showing a dehydrogenase-to-reductase switch during the adipogenic differentiation (Bujalska et al. 2005, Nashev et al. 2007). Journal of Molecular Endocrinology (2008) 41, 125–133
129
130
S SENESI, P MARCOLONGO
and others . H6PD expression during adipogenesis
Figure 2 Reduction of cortisone to cortisol and oxidation of cortisol to cortisone by 3T3-L1 cells in the course of adipogenesis. Adipogenic differentiation was induced in 3T3L1 cells and the conversion of cortisone to cortisol or cortisol to cortisone was measured at the indicated days of differentiation. Reduction of cortisone to cortisol and oxidation of cortisol to cortisone were measured by incubating the cells (0.2–1!106 in a final volume of 1 ml) in the presence of 1 mM steroid, for 2 h at 37 8C. Cortisol and cortisone contents of the samples were measured by HPLC. The activities are reported as % of conversion of the added steroid and values are meansGS.D. of four independent experiments.
However, the initial dehydrogenase activity observed in the ASVCs might be due to an HSD11B1-independent cortisol dehydrogenase activity. ASVCs are a heterogeneous population including preadipocytes, fibrocytes, monocytes, and endothelial cells. Interestingly, HSD11B1 is expressed in preadipocytes only, at levels comparable
with differentiated adipocytes (De Sousa Peixoto et al. 2008). The cellular heterogeneity of the preparation might thus explain the relatively high dehydrogenase activity before adipogenic differentiation. For example, endothelial cells – potentially present in the preparation – express 11b-HSD2 (Brem et al. 1998). As far as the reconstitution experiments (Atanasov et al. 2004, Bujalska et al. 2005) are concerned, attention should be posed on the level of (over)expression of HSD11B1. In the presence of non-physiological, high level of the enzyme, the regeneration of NADPH by H6PD might not be sufficient to allow the reductase activity. Alternatively, the overexpressed HSD11B1 might not be properly targeted to the inner face of the ER membrane but directly or indirectly – in ER-derived bodies resulting from an ER overloading/stress – to the cytosol, where it works as a dehydrogenase (Odermatt et al. 1999). A study in 3T3-L1 cells, whose HSD11B1 has been silenced by short hairpin RNA constructs (Kim et al. 2007), is in line with the aforementioned hypothesis. These authors observed that the re-expression of HSD11B1 at relatively low levels restores the dehydrocorticosterone-induced differentiation, a process that requires the HSD11B1-dependent reductase activity. Paradoxically, high levels of re-expression of the HSD11B1 enzyme resulted in no dehydrocorticosterone dependent differentiation, indicating a lack of reductase activity of the overexpressed enzyme. A further theoretical reasoning is that a
Figure 3 Expression of H6PD and HSD11B1 proteins in ADMSC and 3T3-L1 cells before and after the induction of adipogenesis. Lysates were prepared from ADMSCs before (0 day) and at 7 and 14 days after initiating the treatments to induce adipogenesis. As controls, microsomes were prepared from liver as well as human adipose tissue specimens. Microsomes were prepared from 3T3-L1 fibroblasts before (0 day) and at 3 and 7 days after initiating the treatments to induce adipogenesis. Proteins of cell lysates as well as of microsomal fractions were separated by 12% SDS-PAGE. Gels were blotted on a nitrocellulose membrane, and the H6PD and HSD11B1 proteins were immunorevealed with antibodies toward the lactonase domain of the H6PD protein or with rabbit polyclonal antibodies, recognizing a 15 amino acid sequence common to the human and murine protein as an epitope of the HSD11B1 protein. In the case of ADMSC cell lysates, 20 mg protein were applied; a representative result of three experiments is shown. In the case of liver and adipose tissue microsomes, 30 mg protein of two different preparations were applied. In the case of microsomes from 3T3-L1 fibroblasts, 40 mg of protein were applied; a representative result of four experiments is shown. On the right side of the immunoblots, the size of molecular mass markers is shown in kDa units. Journal of Molecular Endocrinology (2008) 41, 125–133
www.endocrinology-journals.org
H6PD expression during adipogenesis .
S SENESI, P MARCOLONGO
and others
Figure 4 Real-time RT-PCR analysis of HSD11B1 and H6PD mRNAs in (A) ADMSCs and (B) 3T3-L1 fibroblasts before and after the induction of adipogenesis. Total RNA was extracted and real-time RT-PCR was performed at different days after the induction of adipogenesis in ADMSCs (A) and 3T3-L1 fibroblasts (B). Real-time RT-PCR assay was also performed on B2M as a reference gene for human cells and on Rplp0 as a reference gene for the murine cell line 3T3-L1. Relative expression to 0 day (value equal to 1) was calculated according to Pfaffl (2001). Ct, threshold cycle number at which fluorescence is detected above the baseline. Values are meansGS.D. of four independent experiments.
NADPC-regenerating system should be present in the ER lumen in order to permit a continuous HSD11B1 dehydrogenase activity, but such enzyme systems have never been described. Our results confirm that H6PD plays an important role in the prereceptorial glucocorticoid activation in adipogenesis, assisting HSD11B1 in its reductase activity. During the adipogenic differentiation, in the continuous presence of H6PD activity, the dramatic induction of HSD11B1 per se can explain the crescendo of reductase activity. In terms of human disease, our results endorse the strategy for a targeted inhibition of HSD11B1 in patients with obesity and metabolic syndrome, as this enzyme appears always to contribute in local glucocorticoid activation (Tomlinson & Stewart 2005). Theoretically, H6PD can be also a reasonable therapeutic target. However, the fact that H6PD is constantly expressed, thus likely being a housekeeping enzyme, raises some concerns. H6PD is likely a main source of reduced pyridine nucleotides in the luminal environment (Piccirella et al. 2006), which – in addition to the cofactor supply for HSD11B1 – may serve to (vital) cell functions as well. This view is supported by the observation that the indirect blockade of H6PD – through the downregulation of the ER glucose-6phosphate transporter – induces apoptosis in neutrophils (Leuzzi et al. 2003) and glioma cells (Belkaid et al. www.endocrinology-journals.org
2006a,b). Moreover, it has been recently reported (Lavery et al. 2008) that H6PD knockout mice develop a skeletal myopathy associated with the unfolded protein response, which does not seem to be related to local glucocorticoid inactivation or insufficient activation. Further studies are required to clarify the underlying mechanisms.
Declaration of interest The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding This work was supported by a grant of the University of Siena (‘quota Progetti 2004-06’ to AB), by a grant of Regione Toscana to the Center for Stem Cell Research, the University of Siena, by the Hungarian Scientific Research Fund (grants T48939 and IN70798), by the Hungarian Academy of Sciences, by the Ministry of Health, Hungary (ETT 182/2006 and 183/2006).
References Andrew R, Westerbacka J, Wahren J, Yki-Jarvinen H & Walker BR 2005 The contribution of visceral adipose tissue to splanchnic cortisol production in healthy humans. Diabetes 54 1364–1370. Journal of Molecular Endocrinology (2008) 41, 125–133
131
132
S SENESI, P MARCOLONGO
and others . H6PD expression during adipogenesis
Atanasov AG, Nashev LG, Schweizer RA, Frick C & Odermatt A 2004 Hexose-6-phosphate dehydrogenase determines the reaction direction of 11b-hydroxysteroid dehydrogenase type 1 as an oxoreductase. FEBS Letters 571 129–133. Ba´nhegyi G, Benedetti A, Fulceri R & Senesi S 2004 Cooperativity between 11b-hydroxysteroid dehydrogenase type 1 and hexose-6phosphate dehydrogenase in the lumen of the endoplasmic reticulum. Journal of Biological Chemistry 279 27017–27021. Belkaid A, Copland IB, Massillon D & Annabi B 2006a Silencing of the human microsomal glucose-6-phosphate translocase induces glioma cell death: potential new anticancer target for curcumin. FEBS Letters 580 3746–3752. Belkaid A, Currie J-C, Desgagne´s J & Annabi B 2006b The chemopreventive properties of chlorogenic acid reveal a potential new role for the microsomal glucose-6-phosphate translocase in brain tumor progression. Cancer Cell International 6 7. Brem AS, Bina RB, King TC & Morris DJ 1998 Localization of 2 11bOH steroid dehydrogenase isoforms in aortic endothelial cells. Hypertension 31 459–462. Buetler E & Morrison M 1967 Localization and characteristics of hexose 6-phosphate dehydrogenase (glucose dehydrogenase). Journal of Biological Chemistry 242 5280–5293. Bujalska IJ, Walker EA, Hewison M & Stewart PM 2002 A switch in dehydrogenase to reductase activity of 11b-hydroxysteroid dehydrogenase type 1 upon differentiation of human omental adipose stromal cells. Journal of Clinical Endocrinology and Metabolism 87 1205–1210. Bujalska IJ, Draper N, Michailidou Z, Tomlinson JW, White PC, Chapman KE, Walker EA & Stewart PM 2005 Hexose-6-phosphate dehydrogenase confers oxo-reductase activity upon 11b-hydroxysteroid dehydrogenase type 1. Journal of Molecular Endocrinology 34 675–684. Bujalska IJ, Gathercole LL, Tomlinson JW, Darimont C, Ermolieff J, Fanjul AN, Rejto PA & Stewart PM 2008 A novel selective 11b-hydroxysteroid dehydrogenase type 1 inhibitor prevents human adipogenesis. Journal of Endocrinology 197 297–307. Burchell A, Jung RT, Lang CC, Bennet W & Shepherd AN 1987 Diagnosis of type 1a and type 1c glycogen storage diseases in adults. Lancet 9 1059–1062. Clarke JL & Mason PJ 2003 Murine hexose-6-phosphate dehydrogenase: a bifunctional enzyme with broad substrate specificity and 6-phosphogluconolactonase activity. Archives of Biochemistry and Biophysics 415 229–234. Collard F, Collet JF, Gerin I, Veiga-da-Cunha M & van Schaftingen E 1999 Identification of the cDNA encoding human 6-phosphogluconolactonase, the enzyme catalyzing the second step of the pentose phosphate pathway. FEBS Letters 459 223–226. Czegle I, Piccirella S, Senesi S, Csala M, Mandl J, Ba´nhegyi G, Fulceri R & Benedetti A 2005 Cooperativity between 11b-hydroxysteroid dehydrogenase type 1 and hexose-6-phosphate dehydrogenase is based on a common pyridine nucleotide pool in the lumen of the endoplasmic reticulum. Molecular and Cellular Endocrinology 248 24–25. Draper N & Stewart PM 2005 11b-Hydroxysteroid dehydrogenase and the pre-receptor regulation of corticosteroid hormone action. Journal of Endocrinology 186 251–271. Draper N, Walker EA, Bujalska IJ, Tomlinson JW, Chalder SM, Arlt W, Lavery GG, Bedendo O, Ray DW, Laing I et al. 2003 Mutations in the genes encoding 11b-hydroxysteroid dehydrogenase type 1 and hexose-6-phosphate dehydrogenase interact to cause cortisone reductase deficiency. Nature Genetics 34 434–439. Frost SC & Lane MD 1985 Evidence for the involvement of vicinal sulfhydryl groups in insulin-activated hexose transport by 3T3-L1 adipocytes. Journal of Biological Chemistry 260 2646–2652. Gallo R, Gambelli F, Gava B, Sasdelli F, Tellone V, Masini M, Marchetti P, Dotta F & Sorrentino V 2007 Generation and expansion of multipotent mesenchymal progenitor cells from cultured human pancreatic islets. Cell Death and Differentiation 14 1860–1871. Journal of Molecular Endocrinology (2008) 41, 125–133
Gomez-Sanchez EP, Romero DG, de Rodriguez AF, Warden MP, Krozowski Z & Gomez-Sanchez CE 2007 Hexose-6-phosphate dehydrogenase and 11b-hydroxysteroid dehydrogenase-1 tissue distribution in the rat. Endocrinology 149 525–533. Hewitt KN, Walker EA & Stewart PM 2004 Hexose-6-phosphate dehydrogenase and redox control of 11b-hydroxysteroid dehydrogenase type 1 activity. Endocrinology 146 2539–2543. Kim J, Temple KA, Jones SA, Meredith KN, Basko JL & Brady MJ 2007 Differential modulation of 3T3-L1 adipogenesis mediated by 11b-hydroxysteroid dehydrogenase-1 levels. Journal of Biological Chemistry 282 11038–11046. Lavery GG, Walker EA, Draper N, Jeyasuria P, Marcos J, Shackleton CH, Parker KL, White PC & Stewart PM 2006 Hexose-6-phosphate dehydrogenase knock-out mice lack 11b-hydroxysteroid dehydrogenase type 1-mediated glucocorticoid generation. Journal of Biological Chemistry 281 6546–6551. Lavery GG, Walker EA, Turan N, Rogoff D, Ryder JW, Shelton JM, Richardson JA, Falciani F, White PC, Stewart PM et al. 2008 Deletion of hexose-6-phosphate dehydrogenase activates the unfolded protein response pathway and induces skeletal myopathy. Journal of Biological Chemistry 283 8453–8461. Leuzzi R, Ba´nhegyi G, Kardon T, Marcolongo P, Capecchi PL, Burger HJ, Benedetti A & Fulceri R 2003 Inhibition of microsomal glucose6-phosphate transport in human neutrophils results in apoptosis: a potential explanation for neutrophil dysfunction in glycogen storage disease type 1b. Blood 101 2381–2387. Marcolongo P, Piccirella S, Senesi S, Wunderlich L, Gerin I, Mandl J, Fulceri R, Ba´nhegyi G & Benedetti A 2007 The glucose-6-phosphate transporter – hexose-6-phosphate dehydrogenase – 11b-hydroxysteroid dehydrogenase type 1 system of the adipose tissue. Endocrinology 148 2487–2495. Margittai E & Ba´nhegyi G 2008 Isocitrate dehydrogenase: a NADPHgenerating enzyme in the lumen of the endoplasmic reticulum. Archives of Biochemistry and Biophysics 471 184–190. Mason PJ, Stevens D, Diez A, Knight SW, Scopes DA & Vulliamy TJ 1999 Human hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) encoded at 1p36: coding sequence and expression. Blood Cells, Molecules and Diseases 25 30–37. Napolitano A, Voice MW, Edwards CR, Seckl JR & Chapman KE 1998 11b-Hydroxysteroid dehydrogenase 1 in adipocytes: expression is differentiation-dependent and hormonally regulated. Journal of Steroid Biochemistry and Molecular Biology 64 251–260. Nashev LG, Chandsawangbhuwana C, Balazs Z, Atanasov AG, Dick B, Frey FJ, Baker ME & Odermatt A 2007 Hexose-6-phosphate dehydrogenase modulates 11b-hydroxysteroid dehydrogenase type 1-dependent metabolism of 7-keto- and 7b-hydroxy-neurosteroids. PLoS ONE 2 e561. Odermatt A, Arnold P, Stauffer A, Frey BM & Frey FJ 1999 The N-terminal anchor sequences of 11b-hydroxysteroid dehydrogenases determine their orientation in the endoplasmic reticulum membrane. Journal of Biological Chemistry 274 28762–28770. Odermatt A, Atanasov AG, Balazs Z, Schweizer RAS, Nashev LG, Schuster D & Langer T 2006 Why is 11b-hydroxysteroid dehydrogenase type 1 facing the endoplasmic reticulum lumen? Physiological relevance of the membrane topology of 11b-HSD1 Molecular and Cellular Endocrinology 248 15–23. Ozols J 1993 Isolation and the complete amino acid sequence of lumenal endoplasmic reticulum glucose-6-phosphate dehydrogenase. PNAS 90 5302–5306. Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29 2002–2007. Piccirella S, Czegle I, Lizak B, Margittai E, Senesi S, Papp E, Csala M, Fulceri R, Csermely P, Mandl J et al. 2006 Uncoupled redox systems in the lumen of the endoplasmic reticulum. Pyridine nucleotides stay reduced in an oxidative environment. Journal of Biological Chemistry 281 4671–4677. www.endocrinology-journals.org
H6PD expression during adipogenesis . Seckl JR & Walker BR 2004 11b-Hydroxysteroid dehydrogenase type 1 as a modulator of glucocorticoid action: from metabolism to memory. Trends in Endocrinology and Metabolism 15 418–424. Seckl JR, Morton NM, Chapman KE & Walker BR 2004 Glucocorticoids and 11b-hydroxysteroid dehydrogenase in adipose tissue. Recent Progress in Hormone Research 59 359–393. De Sousa Peixoto RA, Turban S, Battle JH, Chapman KE, Seckl JR & Morton NM 2008 Preadipocyte 11b-hydroxysteroid dehydrogenase type 1 is a keto-reductase and contributes to diet-induced visceral obesity in vivo. Endocrinology 149 1861–1868. Takahashi T & Hori SH 1978 Intramembraneous localization of rat liver microsomal hexose-6-phosphate dehydrogenase and membrane permeability to its substrates. Biochimica et Biophysica Acta 524 262–276. Tomlinson JW & Stewart PM 2002 The functional consequences of 11b-hydroxysteroid dehydrogenase expression in adipose tissue. Hormone and Metabolic Research 34 746–751. Tomlinson JW & Stewart PM 2005 Mechanisms of disease: selective inhibition of 11b-hydroxysteroid dehydrogenase type 1 as a novel treatment for the metabolic syndrome. Nature Clinical Practice. Endocrinology and Metabolism 1 92–99.
www.endocrinology-journals.org
S SENESI, P MARCOLONGO
and others
Tomlinson JW, Walker EA, Bujalska IJ, Draper N, Lavery GG, Cooper MS, Hewison M & Stewart PM 2004 11b-Hydroxysteroid dehydrogenase type 1: a tissue specific regulator of glucocorticoid response. Endocrine Reviews 25 831–866. Varma MJ, Breuls RG, Schouten TE, Jurgens WJ, Bontkes HJ, Schuurhuis GJ, van Ham SM & van Milligen FJ 2007 Phenotypical and functional characterization of freshly isolated adipose tissuederived stem cells. Stem Cells and Development 16 91–104. Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, Benhaim P, Lorenz HP & Hedrick MH 2001 Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Engineering 7 211–218. Zuk PA, Zhu M, Ashjian P, DeUgarte DA, Huang JI, Mizuno H, Alfonso ZC, Fraser JK, Benhaim P & Hedrick MH 2002 Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell 13 4279–4295.
Received in final form 21 June 2008 Accepted 27 June 2008 Made available online as an Accepted Preprint 27 June 2008
Journal of Molecular Endocrinology (2008) 41, 125–133
133
