Letters to the Editor
374 stimulation against multiple (unknown) epitopes that are present in vivo. We are currently investigating the putative supportive roles of cotransferred nontumour reactive CD4 T-helper cells in combination with professional antigen presenting cells in mHag specific CTL responses against tumours. In conclusion, we provide the first direct evidence for in vivo interaction of human CTLs specific for only one mHag HA-1 leading to human leukaemia eradication. Our results show the crucial role of numbers and maintenance of HA-1 CTLs in the antileukaemic effector phase of human mHag specific CTLs in vivo. The overall limited persistence of adoptively transferred CTLs is a crucial starting point for improvements of cellular adoptive immunotherapy. Our findings are important for the rationale to apply mHag HA-1-specific immunotherapy of leukaemia in men either by adoptive cellular transfer and/or by mHag HA-1 peptide vaccination.
Acknowledgements We thank Mr M Kester for tetramer synthesis, Dr WN van Wieringen for statistical analysis and Dr R Offringa for critical reading of the manuscript. This work was in part supported by the Dutch Cancer Society and the Deutsche Forschungsgemeinschaft.
L Hambach1, BA Nijmeijer2, Z Aghai1, MLJ van Schie2, MHM Wauben1, JHF Falkenburg2 and E Goulmy1 1 Department of Immunohaematology and Blood Transfusion, E3Q, Leiden University Medical Centre, RC Leiden, The Netherlands and 2 Department of Haematology, Leiden University Medical Centre, Leiden, The Netherlands E-mail:
[email protected]
References 1 Kolb H, Schattenberg A, Goldman J, Hertenstein B, Jacobsen N, Arcese W et al. Graft-versus-leukemia effect of donor lymphocyte transfusions in marrow grafted patients. European Group for Blood and Marrow Transplantation Working Party Chronic Leukemia. Blood 1995; 86: 2041–2050. 2 Marijt W, Heemskerk M, Kloosterboer F, Goulmy E, Kester M, van der Horn M et al. Hematopoiesis-restricted minor histocompatibilty antigens HA-1- or HA-2-specific T cells can induce complete remissions of relapsed leukemia. Proc Natl Acad Sci USA 2003; 100: 2742–2747. 3 Hambach L, Goulmy E. Immunotherapy of cancer through targeting of minor histocompatibility antigens. Curr Opin Immunol 2005; 17: 202–210. 4 Nijmeijer B, Willemze R, Falkenburg J. An animal model for human cellular immunotherapy: specific eradication of human acute lymphoblastic leukemia by cytotoxic T lymphocytes. Blood 2002; 100: 654–660. 5 Mutis T, Verdijk R, Schrama E, Esendam B, Brand A, Goulmy E. Feasibility of immunotherapy of relapsed leukemia with ex vivogenerated cytotoxic T lymphocytes specific for hematopoietic system-restricted minor histocompatibility antigens. Blood 1999; 93: 2336–2341. 6 Bonnet D, Warren E, Greenberg P, Dick J, Riddell S. CD8+ minor histocompatibility antigen-specific cytotoxic T lymphocyte clones eliminate human acute myeloid leukemia stem cells. Proc Natl Acad Sci USA 1999; 96: 8639–8644. 7 Verra N, Jorritsma A, Weijer K, Ruizendaal J, Voordouw A, Weder P et al. Human telomerase reverse transcriptase transduced human cytotoxic T cells suppress the growth of human melanoma in immunodeficient mice. Cancer Res 2004; 64: 2153–2161. 8 Yee C, Thompson J, Byrd D, Riddell S, Roche P, Celis E et al. Adoptive T cell therapy using antigen-specific CD8+ T cell clones for the treatment of patients with metastatic melanoma: In vivo persistence, migration, and antitumor effect of transferred T cells. Proc Natl Acad Sci USA 2002; 99: 16168–16173.
Constitutive phosphoinositide 3-kinase activation in acute myeloid leukemia is not due to p110d mutations
Leukemia (2006) 20, 374–376. doi:10.1038/sj.leu.2404054; published online 8 December 2005
The phosphoinositide 3-kinase (PI3K)/AKT signaling pathway is activated in acute myeloid leukemia (AML) and may control both proliferation and apoptosis of leukemic progenitor cells.1 The mechanisms leading to PI3K activation are unknown. Class IA PI3K are heterodimeric enzymes composed of a p110 catalytic subunit associated to a regulatory p85 subunit, and signal downstream of tyrosine kinases (TK) and Ras. Three p110 isoforms (a,b,d) have been cloned that display many common structural and functional properties.2,3 We recently reported that the p110d isoform is expressed at high level in AML blast cells, whereas expression of a and b isoforms is variable between patients.4 Moreover, the p110d isoform is the main contributor of PI3K activity in AML blasts, as demonstrated by the complete inhibition of AKT phosphorylation induced by IC87114, a selective p110d inhibitor.4 Activating mutations in the PI3KCA gene of class IA PI3Ks have been described in solid tumors.5 These mutations are clustered in exons 9 and 20, coding for the helical and the kinase domains of the p110a protein, with rare mutations in the Leukemia
p85 binding domain and in the C2 domain.5 These mutants are oncogenic and can promote growth and invasion of human cancer cells, by activating the AKT pathway and the target of rapamycin (TOR) kinase.6,7 Given the major role assigned to the p110d isoform in PI3K activity in AML, we wished to determine if it could be genetically altered in AML. We selected 42 patients with primary AML and constitutive activation of PI3K, as assessed by analysis of AKT phosphorylation on Ser473. DNA from 14 normal donors were used as control. All patients expressed the p110d protein at high level and blast cell incubation with a specific p110d inhibitor led to the complete inhibition of AKT phosphorylation, as previously reported.4 Bone marrow (BM) samples were obtained by sternal aspiration after signed informed consent according to the declaration of Helsinki. The characteristics of these 42 patients are given in Table 1a. All samples contained over 30% blasts (mean: 65%). We sequenced the 22 exons of the PI3KCD gene coding for the p110d protein. The primers used for PCR amplification were also used as sequencing primers (Table 1b). No mutation was found in the DNA of the 42 AML patients studied, except a Y996Y polymorphism (according to SwissProt accession number PIK3CD O0329 protein sequence)
Letters to the Editor
375 Table 1a Characteristics of the 42 patients with AML and constitutive activation of the PI3K/AKT signaling pathway FAB classification AML0 AML1 AML2 AML4 AML4Eo AML5 Unknown
4 7 9 8 4 7 3
FLT3 mutations FLT3 ITD FLT3 D835 Total
4/42 2/42 6/42 (14%)
Ras mutations N-Ras K-Ras Total
4/42 2/42 6/42 (14%)
c-Kit mutations D816 (exon 17) D419 (exon 8) Total
P Cornillet-Lefebvre1,2, W Cuccuini1,2, V Bardet3,4, J Tamburini3,4, L Gillot1,2, N Ifrah5,6, P Nguyen1,2, 3,4 F Dreyfus , P Mayeux3,4, C Lacombe3,4 and D Bouscary3,4 1 Laboratoire d’He´matologie. CHU, Reims, France; 2 UPRES EA 3796, IFR 53, Faculte´ de Me´decine, Reims, France; 3 Universite´ Paris-Descartes. Faculte´ de Me´decine, Institut Cochin (INSERM U567, CNRS-UMR 8104), Hoˆpital Cochin, Paris, France; 4 AP-HP, Service d’He´matologie, Hoˆpital Cochin, Paris, France; 5 Service des Maladies du Sang. CHU Angers, Angers, France and 6 UPRES EA 3863 UFR Me´decine Angers, Angers, France E-mail:
[email protected]
0/7 2/7 2/7 (35%)
Karyotype t(8;21)(q22;q22) inv(16) (p13q22) Normal Complex Othern Undetermined
3 4 17 9 5 4
FAB, French-American-British classification; AML, acute myeloid leukaemia; FLT3 ITD, Internal Tandem Duplication of the FLT3 receptor; N-Ras mutations, one patient with mutation at codon 61, two with mutations at codon 12 and one at codon 13; K-Ras mutations, one at codon 13 and one at codon 12; c-kit mutations were studied in the seven patients with core binding factor (CBF)/AML; patients with the t(8;21)(q22;q22); patients with inversion of chromosome 16. n Y, Trisomy 8 and trisomy 11. Table 1b
as the result of a g.13910C4T mutation in the exon 20 of six patients. The same polymorphism was detected in 1/14 controls. Our data indicate that the PI3K3CD gene is not mutated in AML. Mutations identical to those reported in PI3KCA, leading to elevated lipid kinase activity, do not explain deregulated PI3K activity in AML. The mechanisms leading to PI3K activation in AML remain unknown. The frequency of PI3K spontaneous activation that we detected in our patients is much higher than the incidence of FLT3 receptor, Ras and c-Kit activating mutations identified in the same patients (Table 1a). Loss of function of the PTEN phosphatase, activation of the FLT3 receptor by autocrine signaling or overexpression as described in AML,8,9 activating mutations of other TK receptors, or of Src kinases may explain PI3K deregulation in AML patients. Nevertheless, independently of the mechanism of p110d activation, specific inhibitors of this PI3K isoform remain of special interest in AML.
References 1 Xu Q, Simpson SE, Scialla TJ, Bagg A, Carroll M. Survival of acute myeloid leukemia cells requires PI3 kinase activation. Blood 2003; 102: 972–980.
Primers used for PCR amplification and sequencing of p110d
Exon name
Forward primer
Reverse primer
1 2 3 4 5 6 7 8 9 10 11 12–13 14–15 16–17 18 19–20 21 22
ctgtgcgtgctcctgtg tccagctgctgtggcac aggcctccacgagtttga gtgtttgccaggtgtctgtg cgggatgagcagagcaac ctgcactttgagccgtgtta ctgcctcctcacccatcatc ggttgggagatgttagctg cagccgttctgtgggaatc tgtactaccccgccctgg cagccgtttgttgcagatc cttaccctgaccacctccac cagatgctggtcacccct tagaggagcccctgctgac gacagcccttgaccatgc ggagctgcaaaatggtatgg ccagagcctcacttcctctg cccttaacgtggacaccg
aaggtctgaggaccggatg ctacctttgccgatgagg ctcgctgccctcaaactta tccttgtgctctcagagag gtggctcagaggggagg tgtctctcccacctatccca gtactggctctccggggt ggcagatgaagttgtagagg taaagatgatgcccacgctg gctccaggatttcccgcag gggtcagggtggtgggtag actcaggggctgggattc ctctggcctccactcacga agggacgatgtggggtg ttggaaaggagagggaacct acaccgaggggcatctg cttggaagtccactggcg cgctgcatgaaggaggc
Annealing temp (1C)
(MgCl2 mm)
60 60 60 55 55 62 60 60 60 60 60 60 60 62 60 60 58 60
1.5 1.5 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.5 1.0 1.0 1.0 1.0 1.5 1.5 1.5 1.5
Primers were designed from the Genbank accession number PI3KCD AL691449.21 DNA and U57843.1 mRNA sequences using software http:// gsf.de/cgi-bin/primer/ExonPrimer.pl. Amplifications were performed using an ABI 9700 thermocycler, in 50 ml reaction mixture containing 100 ng of genomic DNA, 0.5 mM of forward and reverse primers, 200 mM dNTP, 1 or 1.5 mM MgCl2, 20 mM Tris-HCl (pH 8.0), 50 mM KCl and 1.75 U of Taq DNA Polymerase (Invitrogen, USA). Samples were initially denaturated at 921C for 5 min and DNA amplification was achieved by 35 cycles of denaturation (921C, 30 s), annealing (55 to 621C, 40 s), and extension (721C, 40 s). Sequencing was carried out using a BigDye Terminator v3.1 Cycle Sequencing kit, ABI prism 377 DNA sequencer and the Sequence Analysis and Navigator softwares (Applied Biosystems, USA). Leukemia
Letters to the Editor
376 2 Vanhaesebroeck B, Leevers SJ, Panayotou G, Waterfield MD. Phosphoinositide 3-kinases: a conserved family of signal transducers. Trends Biochem Sci 1997; 22: 267–272. 3 Vanhaesebroeck B, Welham MJ, Kotani K, Stein R, Warne PH, Zvelebil MJ et al. P110delta, a novel phosphoinositide 3-kinase in leukocytes. Proc Natl Acad Sci USA 1997; 94: 4330–4335. 4 Sujobert P, Bardet V, Cornillet-Lefebvre P, Hayflick JS, Prie N, Verdier F et al. Essential role for the p110delta isoform in phosphoinositide 3-kinase activation and cell proliferation in acute myeloid leukemia. Blood 2005; 106: 1063–1066. 5 Samuels Y, Wang Z, Bardelli A, Silliman N, Ptak J, Szabo S et al. High frequency of mutations of the PIK3CA gene in human cancers. Science 2004; 304: 554.
6 Samuels Y, Diaz Jr LA, Schmidt-Kittler O, Cummins JM, Delong L, Cheong I et al. Mutant PIK3CA promotes cell growth and invasion of human cancer cells. Cancer Cell 2005; 7: 561–573. 7 Kang S, Bader AG, Vogt PK. Phosphatidylinositol 3-kinase mutations identified in human cancer are oncogenic. Proc Natl Acad Sci USA 2005; 102: 802–807. 8 Zheng R, Levis M, Piloto O, Brown P, Baldwin BR, Gorin NC et al. FLT3 ligand causes autocrine signaling in acute myeloid leukemia cells. Blood 2004; 103: 267–274. 9 Ozeki K, Kiyoi H, Hirose Y, Iwai M, Ninomiya M, Kodera Y et al. Biologic and clinical significance of the FLT3 transcript level in acute myeloid leukemia. Blood 2004; 103: 1901– 1908.
A novel t(3;17)(p25;q21) variant translocation of acute promyelocytic leukemia with rearrangement of the RARA locus
Leukemia (2006) 20, 376–379. doi:10.1038/sj.leu.2404062; published online 8 December 2005
The vast majority of patients with acute promyelocytic leukemia (APL, FAB M3) have the t(15;17)(q22;q21) chromosomal translocation (reviewed in Melnick and Licht1). This introduces the gene for PML into the retinoic acid receptor a (RARA) locus, which leads to expression of a PML-RARA fusion. There is convincing evidence that expression of PML-RARA underlies the APL phenotype.1 Yet, there have been rare cases of APL identified that do not manifest t(15;17). Many of these cases exhibit cryptic rearrangements of PML and RARA.2 However, in a number of cases a fusion protein different from PML-RARA is expressed. The RARA gene has been consistently involved in these variant translocations. These include the t(11;17)(q23;q21) that expresses a PLZF-RARA fusion; t(5;17)(q35;q21) that encodes NPM-RARA; t(11;17)(q13;q21) that encodes NUMA-RARA; and der(17) with duplication of 17q21.3-q23 that fuses STAT5b to RARA (reviewed in Redner3). These variant rearrangements are rare; fewer than 20 cases of the PLZF-RARA variant have been reported; only four cases of NPM-RARA; and one each of NUMA-RARA and STAT5b-RARA. Nevertheless, these variant translocations hold great importance as ‘experiments of nature’ and serve as tools to identify common biologic pathways that truly underlie development of the APL phenotype. We here report a novel case of APL with fusion of RARA with a locus on 3p25. A 72-year-old man presented with a white blood cell count of 20.4 109/l, hemoglobin 10.3 g/l, and platelets 22 109/l. The peripheral blood white cell differential revealed 20% polymorphonuclear leukocytes, 4% bands, 15% lymphocytes, 19% monocytes, 34% blasts, 1% promyelocyte, 6% myelocytes, and 1% metamyelocytes. The majority of blasts demonstrated reniform or bilobed nuclear features. Auer rods were seen in many blasts along with prominent cytoplasmic granulation. The bone marrow biopsy was hypercellular
(approximately 80%), with 88% blasts, 1.7% promyelocytes, 0.3% myelocytes, 0.3% polymorphonuclear leukocytes, 0.3% eosinophils, 3% monocytes, 0.3% pronormoblasts, 3.7% normoblasts, and 2.3% lymphocytes. The blasts were similar morphologically to those seen in the peripheral blood. The blasts were positive for chloroacetate esterase staining and were negative for staining with nonspecific esterase. Flow cytometry studies performed on the bone marrow showed the blasts to be positive for CD117, CD13 and/or CD33, partial CD15, CD33, and strongly myeloperoxidase positive. The blasts were negative for expression of CD34 and HLA-DR. The morphologic findings along with the flow cytometry results were consistent with a diagnosis of APL. Cytogenetic studies indicated a mosaic abnormal chromosome pattern with an apparent normal cell line, represented by six cells, and one, represented by 14 cells, that demonstrated a 47,XY,t(3;17)(p25;q21), þ 8 karyotype (Figure 1). Analysis for PML-RARA expression by RT-PCR was indeterminate, owing to poor quality of the extracted RNA. FISH was therefore performed on two hundred unstimulated cells, primarily in interphase. FISH was carried out according to manufacturer instructions, using the Vysis LSI PML/RARA dual color single fusion and LSI RARA dual color break apart DNA probes (Downers Grove, IL). For identification of a partner chromosome, sequential FISH using the Vysis CEP3 DNA probe for the centromeric region of chromosome 3 was performed on the metaphase cells, previously hybridized with the LSI RARA DNA probe. The PML/RARA probe, when hybridized to a cell containing t(15;17)(q22q21), is expected to result in a pattern of one yellow fusion signal on der(15)t(15;17), a red signal on normal chromosome 15 and a green signal on normal chromosome 17. In the case of an atypical translocation between chromosome 17 and a partner chromosome other than 15, the fusion signal will not be produced. In the current case, this test revealed 98.5% of the cells to be negative for PML-RARA rearrangement (the value of 1.5% positivity is within the
Figure 2 FISH: Vysis (Downers Grove, Il) t(15;17) dual color DNA probe was used to determine PML-RARA rearrangement. Separate signals for PML and RARA were seen in both metaphase (a) and interphase spreads (b), indicating absence of PML-RARA fusion. The metaphase spread also indicates that one (green) signal for RARA is located on an A-group sized chromosome, consistent with this being chromosome 3. Metaphase (c) and interphase (d) cells were scored using the LSI RARA dual color DNA probe. 100% showed a split signal, indicating rearrangement of RARA and relocation of the green signal to an A-Group sized chromosome. The metaphase preparation (c) was sequentially hybridized using CEP probes for chromosomes 3 (red) and 17 (green) (e). Comparison of (c) and (e) indicate that the nonsplit RARA hybridzed to chromosome 17, and that the split RARA signal localizes to der (17) and der(3). Leukemia
