Construction and Characterization of a Novel Recombinant Single ...

HYBRIDOMA Volume 19, Number 1, 2000 Mary Ann Liebert, Inc.

Construction and Characterization of a Novel Recombinant Single-Chain Variable Fragment Antibody Against Western Equine Encephalitis Virus MELISSA C. LONG,1 SCOTT JAGER,2 DAVE C. W. MAH, 2 LELLEAN JEBAILEY, 1 MARIA A. MAH, 2 SAAD A. MASRI,3 and LES P. NAGATA 1

ABSTRACT A novel recombinant single-chain fragment variable (scFv) antibody against Western equine encephalitis virus (WEE) was constructed and characterized. Using antibody phage display technology, a scFv was generated from the WEE specific hybridom a, 10B5 E7E2. The scFv was fused to a human heavy chain IgG 1 constant region (CH1–CH3) and contained an intact 6 His tag and enterokinase recognition site (RS10B5huFc). The RS10B5huFc antibody was expressed in E. coli and purified by affinity chromatography as a 70-kDa protein. The RS10B5huF c antibody was functional in binding to WEE antigen in indirect enzyme-linked immunosorbent assays (ELISAs). Furthermore, the RS10B5huFc antibody was purified in proper conformation and formed multimers. The addition of the human heavy chain to the scFv replaced effector functions of the mouse antibody. The Fc domain was capable of binding to protein G and human complement. The above properties of the RS10B5huFc antibody make it an excellent candidate for immunodetection and immunotherapy studies.

serious hazard to human health. Viral transmission is by infected mosquitoes, causing disease in humans and horses. Symptoms of WEE infection range from malaise, fever, headaches, nausea, and vomiting to encephalitis, convulsions, and paralysis. The case fatality rate in humans is 2 to 7%. Currently, there are no known antiviral drugs against WEE. An inactivated WEE vaccine, with investigational new drug (IND) status, does exist for limited populations such as laboratory personnel who are at high risk of exposure to the virus. However, the immunogenici ty of the inactivated WEE vaccine is often poor and short term. (4) Alphavirus antigen specificities and neutralization have been studied with mouse monoclonal antibodies (MAbs). Murine neutralizing and non-neutralizing antibodies, generated against E1 and E2, have demonstrated protection against subsequent viral infection. In passive immunization studies, anti-E2 MAbs were able to protect mice from lethal infections of Semliki Forest virus (SFV).(5) Mice were protected from challenge with

INTRODUCTION

W

(WEE), like other members of the alphavirus genus, is an enveloped single-stranded RNA virus. The genome of WEE is positive-sense, approximately 12 kb in length, and encodes for nonstructural (5 9 end) and structural (39 end) proteins. The structural proteins are translated from a subgenom ic mRNA (26S mRNA) as a polyprotein that is processed by viral and cellular proteases into nucleocapsid (30 kDa), E1 (53 kDa), E2 (47 kDa), E3 (10 kDa), and 6K (6 kDa) proteins. The nucleocapsid protein binds the RNA genome in an icosahedral structure, and the E1 and E2 proteins are glycoproteins present in the lipid envelope. The E3 protein is also a glycoprotein that is most often not a component of the virion, but is required for infectivity in wild-type virus. The 6K protein is virion associated and promotes efficient virus assembly [reviewed in refs]. (1–3) WEE is endem ic in the Western Hemisphere and can pose a E STE RN EQ U IN E E N C EPH A LITIS V IR U S

1 Medical Countermeasur es Section, Defence Research Establishment Suffield, P.O. Box 4000, Station Main, Medicine Hat, Alberta, Canada, T1A 8K6. 2 Canada West Biosciences, 113-339 50th Ave. S.E., Calgary, Alberta, Canada, T2G 2B3. 3 Canadian Food Inspection Agency, Centre of Plant Health, 8801 East Saanich Road, Sidney, British Columbia, Canada, V8L 1H3.

1

2 Venezuelan equine encephalitis virus (VEE) and WEE, when injected with antibodies directed against E1 and E2, respectively. (6,7) Likewise, mice were protected from Sindbis virus when treated with neutralizing and non-neutralizing antibodies to E1 and E2, before or after infection with virus. (8) Animal antisera and MAbs provide an important source of antibody. However, recombinant antibody technology is providing an alternative and practical source of useful antibodies. Genetically, recombinant antibodies have the advantages of being produced economically, in large quantities, and in short periods of time. Furthermore, recombinant antibodies are stable and can be genetically manipulated to obtain enhanced properties. (9–11) Of the recombinant antibodies, single-chain fragm ent variable (scFv) antibodies can be readily cloned and screened using antibody phage display technology. These antibodies contain monovalent binding activity and structurally consist of V L and V H regions separated by a flexible peptide linker, most com monly (Gly4 Ser) 3 .(12) Although smaller in size than MAbs and Fab fragm ents, scFv antibodies maintain their ability to bind to antigen often with identical specificity and affinity. (13–16) Because of their small size, in clinical applications, antibody fragments are able to penetrate solid tumors more effectively and be cleared from nontarget tissues more rapidly than whole immunoglobulins. (9–11,17) Recom binant scFv antibodies have been generated against many viral proteins, including the recent cloning of scFv antibodies to members of the alphaviru s genus, including VEE (1 8 ) and WEE.(19 ) Furthermo re, scFv antibodies show ing neutraliza tion activity have been construct ed against tickborne flavivirus , (1 4 ) picornavi rus, (1 5 ) respirator y syncytial virus, (20 ) rabies virus, (21 ) and coronavir us. (1 6 ) A scFv antibody against the F glycoprote in of respirator y syncytial virus significan tly reduces viral titers in the lungs of mice when administ ered before or 1 day after virus challenge . (2 0) For tick-borne flavivirus infected mice, partial in vivo protection activity is observed when mice are treated with a scFv antibody against a viral envelope glycoprot ein prior to infection. (1 4 ) Immune defenses against viral infections are complex and multifaceted, involving not only neutralization but also the removal of viral infected cells. Ideally, therapeutic recombinant antibodies should neutralize WEE de novo, induce antibody dependent cell-mediated cytotoxicity (ADCC) to destroy viral infected cells, and not induce adverse host immune responses. Murine antibodies when administered to hum ans may be toxic. To reduce the immunogenici ty of the murine antibodies, chimeric proteins consisting of mouse variable regions and human constant regions have been constructed. Moreover, specificity of antigen binding given by variable regions may be com bined with effector properties such as Fc receptor binding, increased serum half-life, and complement fixation conferred by constant regions. (9) The addition of a hum an constant region to the scFv structure could potentially replace effector functions, such as mediating the in vivo destruction of target cells by cytotoxic mechanism s. We report the cloning of the human heavy chain IgG 1 constant region linked to a scFv against WEE. Fusion antibodies of scFv linked to hum an Fc (RS10B5huFc) were expressed in bacteria, purified, and characterized. The potential use of the

LONG ET AL. RS10B5huFc antibody in immunodetecti on and immunotherapy will be assessed.

MATERIALS AND METHODS Construction of pRSD12huFc pRSD12huFc, an Escherichia coli (E. coli) expression vector expressing human Fc, was constructed by amplifying the constant regions of the hum an IgG 1 heavy chain using the polymerase chain reaction (PCR) (Fig. 1). First, total RNA, isolated from Ficoll purified human lymphocytes, was reverse transcribed with SuperScript reverse transcriptase (Gibco BRL, Gaithersburg, MD) and an oligo dT primer (12–18mer) to generate cDNA. Second, the cDNA was amplified using huFc 5 9 (5 9 AGGGCCCATCGGTCTTCC 3 9 ) and huFc 3 9 (5 9 CCGGAGACAGGGAGAGGCT 3 9 ) primers, derived from bases 483–500 and 1457– 1439, respectively, from the hum an IgG 1 heavy chain of an anti-hepatitis A virus MAb. (22) To create new restriction enzym e sites for cloning, nested primers FcNot I (1 ) (5 9 GGGGGCACAGCGGCCGCGGGCTGCCTGGTCAAG 39 ) and huFc2Hind (5 9 AGGGATAAGCTTTTCTGCGTGTAGTGGTTGTGC 39 ) were used. Bases changed from the original sequence are underlined. PCR with FcNot I (1 ) and huFc2Hind prim ers and the human IgG 1 PCR template generated a 919-bp product. Digestion with Not I and Hind III produced a 901-bp human Fc fragment. The human Fc fragment was ligated into the Not I and Hind III sites of pRSD12-8 (3.9 kb), a T7 based bacterial expression vector consisting of DNA sequences that encode for an anti-botulinum toxin scFv gene, (23) to generate pRSD12huFc (4.6 kb).

Cloning of recombinant scFv antibodies reactive against WEE ScFv antibodies were generated using the recombinant phage antibody system (Amersham Pharmacia Biotech, Baie d’Urfé, Québec). In this system , total RNA from the 10B5 E7E2 hybridoma (24) was reverse transcribed with SuperScript reverse transcriptase and an oligo dT primer (12–18 mer) to produce cDNA. The 10B5 E7E2 hybridoma produces a mouse MAb against the WEE structural protein E2. (24) The V H and V L regions were joined by a (Gly 4 Ser) 3 linker and further amplified by PCR to yield a 758-bp assembled scFv with 5 9 Sfi I and 3 9 Not I sites, hereafter designated as 10B5 scFv. The 10B5 scFv DNA was cloned into the Sfi I/Not I site of pCANTAB 5 E phagemid and transformed into E. coli TG1 cells. Recombinant 10B 5 scFv–M13 phage were rescued from the clones and panned against WEE antigen immobilized on PVC 96-w ell plates. Positive clones were identified and 10B5 scFv DNA was then isolated and cloned into the Sfi I/Not I site of the expression vector pRSD12huFc, replacing the anti-botulinum toxin scFv gene [hereafter designated as pRS10B5huFc (4.6 kb)] (Fig. 1) and transformed into E. coli BL21 DE3 pLys S cells (Stratagene, La Jolla, CA). BL21 DE3 pLys S cells contain endogenous T7 polymerase and express genes under the control of the T7 promoter. Positive clones were identified for further analyses. Sequencing of pRS10B5huFc was performed using the ABI PRISM BigDye terminator cycle sequencing ready reaction kit

3

RECOMBINANT ScFv ANTIBODY AGAINST WEE

FIG. 1. Construction of pRS10B5huFc. (A) The constant regions of the human IgG 1 were amplified using PCR methods and huFc 59 and huFc 3 9 primers. (B) A second PCR step was performed using FcNot I (1 ) and huFc2Hind prim ers to generate Not I and Hind III end-sites. (C) The human Fc fragment was ligated into the Not I/Hind III sites of pRSD12-8 to produce pRSD12huFc. (D) The anti-WEE 10B5 scFv DNA, isolated by the recombinant phage antibody system from the mouse monoclonal hybridoma 10B5 E7E2, was cloned into pRSD12huFc, in replacement of the anti-botulinum toxin scFv. The resulting plasmid was pRS10B5huFc, containing DNA sequences that encode for the fusion protein 6 His-enterokinase (EK)-10B5 scFv-huFc (CH1–CH2–CH3). and the ABI PRISM 310 Genetic analyzer (Perkin Elmer, Foster City, CA). All 18 nucleotide primers for sequencing reactions were prepared using the Oligo 1000 DNA synthesizer (Beckman Instrum ents, Fullerton, CA). 10B5 scFv DNA was sequenced using the prim ers SC-1 (5 9 CATCATCATCATCATCAT 39 , nucleotides (nt) 13–20), SC-2 (59 ATCGAGCTCACTCAGTCT 3 9 , nt 586–603), SC-3 (59 AGACTGAGTGAGCTCGAT 39 , nt 603–586), SC-4 (59 AAGCTGAGGCCTGGACAA 3 9 , nt 295–312), SC-5 (5 9 TGAGGACTGTAGGACAGC 39 , nt 1023–1006), SC-6 (5 9 TGCTGATTGTGAGAGAAT 3 9 , nt 814–797), and SC-7 (59 CTGAAGTCCCAGGCTTCA 3 9 , nt 235–218). Human IgG 1 Fc was

sequenced using the primers SC-2, SC-8 (5 9 GGAGCTGGGACAAAGTTG 39 , nt 880–897), and SC-9 (59 CAGCAGCCAACTCAGCTT 39 ). Sequence assembly and alignments were done using Lasergene software (DNASTAR, Madison, WI). The sequence was submitted to Genbank (Accession number AF189283).

Expression and purification of the RS10B5huFc antibody BL21 DE3 pLysS E. coli transformants of pRS10B5huFc were grow n in 20-m L LB broth supplemented with 200 m g/mL

4 ampicillin for 16 h at 37°C. The overnight culture was used to inoculate 250 mL of LB broth containing 200 m g/mL ampicillin, which was then grown for 2 to 3 h at 37°C, until an OD 600 nm of greater than 0.8 was reached. The BL21 DE3 pLysS pRS10B5huFc culture was induced for expression by the addition of isopropyl b -D -thiogalactopyran oside (IPTG) at a final concentration of 1 mM. The expression of the RS10B5huFc antibody was allowed to proceed by incubating the culture for an additional 3 h at 37°C, while shaking at 200 rpm. The cells were harvested by centrifugation at 1428 3 g for 20 min at room tem perature. The supernatant was decanted and the cell pellets were resuspended in 2 mL 5 mM borate pH 9.3 and 4 M urea. The resuspended cells were pooled and sonicated with the Soniprep 150 (MSE Scientific Instrum ents, Crawley, UK) in pulses of 10 sec at a power level of 8 for 10 3 . The sonicates were centrifuged at 13,000 3 g, for 10 min at 4°C. The pellets were resuspended to the original volume in 5 mM borate pH 9.3, 8 M urea, and 100 mM sodium chloride, and the pH of the sam ple was adjusted to 12 using 1 M sodium hydroxide. A second sonication step was then performed for 10 sec at a power level of 8 for 5 3 . The pH of the solubilized protein solution was adjusted to 9.3 with 1 M HCl. The solubilized protein solution was diluted 1/4 with 5 mM borate pH 9.3, 8 M urea, and 100 mM sodium chloride and mixed with one fourth sample volume of washed Talon metal affinity resin (Clontech, Palo Alto, CA). The suspension was mixed for 30 min at room tem perature and then poured into a column. The flow through was allowed to pass through the column, after which the colum n was washed with 10 bed volumes of 5 mM borate pH 9.3, 8 M urea, and 100 mM sodium chloride. Proteins bound to the Talon metal affinity resin were eluted from the column with 4 bed volum es of 5 mM borate pH 9.3, 8 M urea, 100 mM sodium chloride, and 100 mM imidazole. After the protein had eluted from the column, L -arginine was added to a concentration of 1 M. The protein sample was then renatured by removal of the 8 M urea by dialyzing against 20 volumes of 5 mM borate pH 9.3 and 1 M L -arginine for . 50 h at 4°C in dialysis bags (MWCO 3500 Da) (Gibco BRL). Dialysis was continued for an additional 16 h at 4°C in 100 volumes of 5 mM borate pH 9.3. The protein samples were concentrated to approxim ately 0.5 mg/ml in dialysis bags on a bed of Aquacide II (Calbiochem , La Jolla, CA) and polyethylene glycol MW 10,000 (Sigma, St. Louis, MO).

Western blotting of the RS10B5huFc antibody RS10B5huFc antibody and other proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). SDS-PAGE was perform ed using the Mini-Protean II apparatus (Bio-Rad Laboratories, Mississauga, Ontario) and discontinuous polyacrylamide (12%) gels, as previously described. (25) Samples for SDS-PAGE were prepared by com bining equal volumes of protein with 2 3 laemm li sample buffer (Bio-Rad Laboratories) containing 2% b -mercaptoethan ol. For protein samples run in nonreducing conditions, b -mercaptoethanol was excluded from the 2 3 laemmli sample buffer. Coomassie Brilliant Blue R-250 (Bio-Rad Laboratories) was used to stain protein bands. Proteins were also transferred from SDS-PAGE gels to Immobilon-P membranes (0.45 m m pore size, PVDF filter type)

LONG ET AL. (Millipore, Bedford, MA) using the Mini transblot electrophoretic transfer cell (Bio-Rad Laboratories), as described previously. (26) The filters were then blocked, washed, and probed with antibodies as described previously. (27) One primary antibody used was the mouse monoclonal Anti-Xpress antibody (Invitrogen, Carlsbad, CA), which recognizes the peptide sequence Asp-Leu-Tyr-A sp-Asp-Asp-A sp-Lys. Blots were probed with a 1:5000 dilution of Anti-Xpress antibody in phosphate-buffered saline (PBS) containing 0.1% Tween 20 (PBST) and 0.02% SDS. These blots were later incubated with a 1:3000 dilution of horseradish peroxidase-conjug ated goat anti-mouse immunoglobu lin (H 1 L) (Caltag Laboratories, Burlingame, CA) in PBS-T containing 0.02% SDS. Proteins were detected using the enhanced chemilumines cence (ECL) method (Amersham Pharmacia Biotech). In certain Western blots, a one-step antibody incubation was performed. The immunoblots were probed directly with horseradish peroxidase-conjugated donkey anti-human antibody (Jackson ImmunoResearch Laboratories Inc., West Grove, PA) at a dilution of 1:500 in PBS-T containing 0.02% SDS. Blots were probed directly with horseradish peroxidase-conjugated Ni-NTA antibody (Qiagen, Valencia, CA) at a dilution of 1:1000 in PBST containing 0.02% SDS. The membranes were also probed with horseradish peroxidase-conjugated goat anti-mouse antibody at a dilution of 1:3000 in PBS-T containing 0.02% SDS. The immunoblots were stripped, as described by Amersham Pharmacia Biotech (ECL) to reprobe with different antibodies.

WEE indirect ELISA The WEE indirect ELISA was performed by immobilizing antigen onto Nunc Maxisorb flat bottomed 96-well plates (Gibco BRL). The antigen used was formalin inactivated WEE (described below) or bovine serum (BSA). The wells were coated for 16 h at 4°C with 1 to 100 m g/mL of antigen in coating buffer, consisting of 15 mM sodium carbonate, 35 mM sodium bicarbonate, and 0.02% (w/v) sodium azide (pH 9.6). The plates were washed 5 3 with wash buffer, consisting of PBS, 0.05% Tween 20, and 0.1% BSA. The plates were then blocked in PBS-T and 2% BSA for 1 h at 37°C. Blocking was followed by washing the plates 5 3 with wash buffer. Plates were then subjected to an additional blocking and washing step as described above. The wells were next incubated with various concentrations of primary antibodies for 1 h at 37°C. The primary antibodies used were RS10BhuFc and 10B5 E7E2, diluted to various concentrations in wash buffer. For the ELISA using varying concentrations of inactivated WEE antigen, a fixed concentration of 10 ng/ m L RS10B5huFc antibody was added to the wells. Plates were washed 5 3 with wash buffer after which the wells were incubated for 1 h at 37°C with either horseradish peroxidase-conjug ated goat anti-m ouse antibody or horseradish peroxidase-conjug ated donkey anti-hum an antibody, at a dilution of 1:3000 in wash buffer. The plates were washed 5 3 with wash buffer, followed by incubation for 30 min at room temperature with a 1:1 solution of 2, 29 -azinobis (3-ethylbenzothia zoline-6-sulfonic acid) diammonium salt (ABTS) and hydrogen peroxide (Kirkegaard and Perry Laboratories, Inc., Gaithersburg, MD). The plates were read at an absorbance of 405 nm using the MAXline microplate reader (Molecular Devices, Crawley, UK).

5


Inactivated WEE preparation Inactivated WEE preparation for ELISAs were perform ed similarly to that described by Xu et al.(19) The WEE strain B11, kindly provided by Dr. G. Ludwig from the U.S. Army Medical Research Institut e of Infectiou s Diseases, Frederick , MD, were used to infect African green monkey kidney (Vero) cells, grow n either as monolayer s or in suspensi on culture. Vero cells (CCL-81) (American Type Culture Collection, Rockville, MD) were infected with WEE at a multiplicity of infectio n (M.O.I.) of 0.1 to 1. When 90% cytopathic effect was reached, the culture supernat ants were harveste d. To collect virus particles from cellular debris, the culture was centrifug ed at 10,000 3 g for 30 min at 4°C. The supernat ant was treated with 7% polyethy lene glycol and 2.3% sodium chloride and incubate d for 15 to 20 h at 4°C. Precipitat ed virus particles were collected by centrifug ing at 10,000 3 g for 30 min at room tem perature. The pellet was then resuspen ded in PBS and further purified on a 20 to 60% (w/w) continuo us sucrose density gradient . Samples were centrifu ged at 100,000 g for 3.5 h at 4°C. The virus band was collecte d and inactiva ted by the addition of 0.5% formalin buffered saline. The virus sam ple was dialyzed against several changes of TNE buffer, consisti ng of 10 mM TrisHCl pH 7.4, 100 mM sodium chloride , and 1 mM ethylene diam inetetraa cetic acid (EDTA). To ensure that WEE was efficient ly inactivat ed, aliquots of the virus sam ple were tested for grow th in Vero cells over a 2-w eek period.

Protein G binding assays Antibodies (RS10B5huFc, 3F3E9, and 11H9) were incubated with washed protein G agarose from Gibco BRL, in radioim munoprecipitatio n (RIP) buffer (50 mM Tris-HCl pH 7.4, 150 mM sodium chloride, 0.1% SDS, and 1% Triton X-100) for 1 h at room temperature. 3F3E9 and 11H9 are mouse MAbs that recognize the WEE E2 and nucleocapsid proteins respectively. (24) The antibody-protein G complexes were precipitated by centrifugation at 13,000 3 g for 1 min. The pellets were washed in RIP buffer and centrifuged at 13,000 3 g for 1 min; this step was repeated three additional times. The final pellets were resuspended in 2 3 Tricine sample buffer containing fresh 2% b -mercaptoethanol, after which the sam ples were heated at 100°C for 10 min. The samples were then centrifuged at 13000 3 g for 1 min, and the supernatant was collected for SDS-PAGE analysis.

C1q indirect ELISA The C1q indirect ELISA was performed using the circulating immune complexes (CIC)-C1q test kit (QUIDEL Corporation, San Diego, CA). In brief, a 96-well plate immobilized with purified human C1q protein was rehydrated with wash solution, consisting of PBS, 0.05% Tween 20, and 0.01% Thimerosal. Various concentrations (1–100 ng/ m L) of the RS10B5huFc antibody were applied to each of the wells. The wells were washed 4 3 with wash solution and then incubated with horseradish peroxidase-conjugate d goat anti-hum an antibody. The wells were washed as described above and incubated with substrate solu-

tion, consisting of 0.7% 2, 29 -azino-di (3[ethylbenzothiaz oline sulfonic acid) diamm onium salt. Stop solution, containing 250 mM oxalic acid, was added to each of the wells, and the plate was read at an absorbance of 405 nm using the MAXline microplate reader.

RESULTS Construction of the RS10B5huFc antibody To construct the RS10B5huFc antibody, the constant regions of the human IgG 1 heavy chain gene were amplified by PCR and then ligated into pRSD12–8, a T7 based bacterial expression vector (Fig. 1). The anti-botulinum toxin scFv gene of pRSD12–8 was next replaced with the anti-WEE scFv gene 10B 5. The resulting plasmid, pRS10B5huFc, consisted of a fusion of human Fc and mouse anti-WEE 10B5 scFv under the control of the T7 promoter. In addition, the N-terminus of 10B5 scFv was fused to a 6 His tag and an enterokinase recognition site. The pRS10B5huFc plasmid was DNA sequenced to confirm the accuracy of each cloning step. DNA (GenBank AF189283) and protein sequences (Fig. 2A) of the 10B5 scFv of RS10B5huFc were homologous to sequences of other mouse scFv antibodies, such as digoxin-binding, (28) anti-idiotype (GenBank AF000955), and anti-CD30 (GenBank AF002242) antibodies, especially in the peptide linker and the sequences surrounding the com plem entarity determining region (CDR) dom ains. Overall, the 10B5 scFv displayed 70.2, 75.9, and 69% protein sequence identity with the anti-digoxin, anti-idiotype, and anti-CD30 antibodies, respectively. The CDRs were determined by conserved sequence position and identification. The encoded 10B 5 scFv protein was 245 amino acids with a molecular weight of approximately 25.7 kDa. Upstream of the 10B5 scFv were the 6 His tag and enterokinase recognition site. We confirmed that the RS10B5huFc heavy-chain constant nucleotide (GenBank AF189283) and protein (Fig. 2B) sequences were largely in agreement with other heavy-chain constant regions (22,29–31). As expected from the primers used in the amplification of lymphocyte cDNA, the heavy-chain constant domains of the RS10B5huFc antibody were highly homologous to the heavy chain constant domains of a human IgG 1 anti-hepatitis A virus MAb,(22) displaying a 99% protein sequence similarity. Furtherm ore, the heavy-chain constant region (g 1) of a hum an immunoglobulin from fetal liver (29) and of a hum an IgG 1 anti-Rhesus (D) antibody (31) were strongly homolgous to the Fc domain of the RS10B5huFc antibody, both showing a 99% protein sequence similarity. Although it is likely that the RS10B5huFc antibody is an IgG 1 , containing a heavy chain of the class g 1, RS10B5huFc also displayed strong homology to a human immunoglobulin g 2 heavy chain. (30) The RS10B5huFc and g 2 heavy chains displayed a 91% protein sequence similarity. The Fc region of the RS10B5huFc antibody was missing the first 22 amino acids of CH1, but contained the rest of the hinge and CH2 regions. The last 9 amino acids of CH3 were also missing. The encoded Fc protein was 301 amino acids with a molecular weight of approxim ately 33.3 kDa. These sequences, together with the 6 His-enterokinas e-10B5 scFv sequences, encoded for a protein of 604 amino acids with

6

LONG ET AL.

FIG. 2. Protein sequence of the RS10B5huFc antibody. The plasm id pRS10B5huF c was DNA sequenced (GenBank AF189283), and the corresponding protein sequence for the antibody was determined, as described in the Materials and Methods section. The RS10B5huFc antibody is shown as the top sequence with underlying homologous 10B5 scFv (A) and human Fc sequences (B). The 10B5 scFv and the heavy chain constant domains extend from amino acids 59–304 (in bold) and 305–604, respectively. Conserved Cys and Asn residues involved in disulfide bond formation and glycosylation, respectively, are enclosed by triangles. Amino term inal sequences include the 6 His tag and enterokinase recognition site (in bold) (A).

a molecular weight of 65.7 kDa. The identity of the 6 His-enterokinase-10B5 scFv-CH1–CH2–CH3 fusion protein was confirm ed. Conserved Cys residues potentially involved in disulfide bonds are amino acids 83, 157, 217, 283, 308, 364, 384, 390, 393, 425, 485, 531, and 589. Conserved Asn residues potentially involved in N-linked glycosylation are amino acids 122 and 461.

Characterization of the RS10B5huFc antibody The RS10B5huFc antibody was expressed in E. coli and purified by affinity chromatography on a Talon metal affinity resin. Samples were removed from various purification steps and analyzed by SDS-PAGE (12%) and Coomassie staining (Fig. 3). The supernatant collected from bacterial pellets after

7


FIG. 2.

the initial sonication step indicated the presence of a number of proteins in the sample (Fig. 3, Lane 2). Upon further purification, the solubilized protein fraction was collected, where most proteins were removed except for a main protein migrating at 70 kDa (Fig. 3, Lane 3), corresponding to the approximate expected size (65.7 kDa) of the RS10B5huFc antibody. At later steps in the purification, when the samples were treated with the TALON metal affinity resin, the 70-kDa protein appeared to be present in the flow through (Fig. 3, Lane 4), but barely detected in the column washes (Fig. 3, Lane 5). The protein was eluted from the column with imidazole, renatured, and

(continued )

concentrated to give the purified protein fraction (Fig. 3, Lane 6). The purification of the RS10B5huFc antibody appeared to be successful as indicated from the Coomassie gel. A single protein of approximately 70 kDa was isolated from transform ed E. coli cells carrying pRS10B5huFc. To positively identify the protein purified and to confirm that this protein was intact, a series of Western blotting experim ents were performed (Fig. 4). The samples obtained from each of the purification steps were subjected to immunoblot analysis using mouse MAbs and horseradish peroxidase-conjug ates directed against different epitopes on the RS10B5huFc antibody.

8

LONG ET AL. Lane 5). The solubilized protein sample and flow through also contained the antibody (Fig. 4C, Lanes 2–3). Taken together, the results obtained from the Western blots indicated that the RS10B5huFc antibody produced was what was expected from the original DNA clone.

Antigen binding activity of the RS10B5huFc antibody

FIG. 3. Coomassie stain of samples from the purification of the RS10B5huFc antibody. Samples were removed from various purification steps and run on SDS-PAGE gels (12% ), which were Coomassie stained. Lanes: (1) molecular weight markers; (2) initial bacterial sonicate; (3) solubilized protein fraction; (4) column flow through; (5) column washes; and (6) final protein preparation.

In the first Western blotting experiment, the anti-Xpress antibody recognized the purified 70-kDa protein (Fig. 4A, Lane 5). This confirmed that the 70-kDa protein was the RS10B5huFc antibody, which contained an intact enterokinase recognition site. Other fractions from the purification steps also had varying amounts of the RS10B5huFc antibody (Fig. 4A, Lanes 1–4). In the second Western blotting experiment, the anti-human Fc antibody detected the RS10B5huFc antibody (Fig. 4B, Lane 5), confirming that the antibody possessed a human Fc domain. Other sam ples also contained different proportions of the RS10B5huFc antibody (Fig. 4B, Lanes 1–4). The third Western blotting experiment, utilizing the Ni-NTA horseradish peroxidase-conjugate , detected the RS10B5huFc antibody, indicating that the antibody contained an intact 6 His tag (Fig. 4C,

We sought first to determine the antigen binding activity of the RS10B5huFc antibody using the indirect ELISA assay. Inactivated WEE antigen was immobilized onto 96-well plates and incubated with antibody. Absorbance values of controls where no antigen was present were subtracted from absorbance values for samples containing antigen. Increasing concentrations of the mouse MAb 10B5 E7E2, the parental clone of RS10B5huFc, resulted in increasing absorbance values or antibody-antigen binding (Fig. 5A). For the RS10B5huFc antibody, increases in antigen binding were gradual upon increasing concentrations of antibody. The optimum RS10B5huFc antibody concentration was 10 ng/ m L, using a set antigen concentration of 10 ng/ m L (Fig. 5A). An additional ELISA was perform ed using fixed concentrations of the RS10B5huFc antibody (10 ng/ m L) and varying concentrations of antigen (Fig. 5B). We found that as antigen concentration increases, the absorbance or antibody-antigen binding also increases. At a concentration of 10 ng/ m L RS10B5huFc, the antibody displayed a lower limit of detection of , 1 ng/ m L antigen. The ELISA data demonstrated that the RS10B5huFc antibody was functionally active and capable of binding to WEE antigen. We were unable to detect definitive RS10B5huFc activity in Western blotting or immunoprecipitatio n experiments (data not shown), although som e preliminary results indicate that the parental clone 10B5 E7E2 recognizes E2 in Western blots (Nagata et al., unpublished data).

Fc function of the RS10B5huFc antibody Functional antibodies have been previously found to bind to protein G during purification and immunoprecip itation studies through their Fc domains. (32) We were thus interested in deter-

FIG. 4. Western blot analyses of samples from the purification of the RS10B5huFc antibody. Samples removed from the purification steps were run on SDS-PAGE gels (12%) and immunoblotte d. The samples were probed with (A) the anti-Xpress antibody, (B) the anti-human Fc antibody, or (C) the Ni-NTA horseradish peroxidase-conjug ate. Lanes: (1) initial bacterial sonicate; (2) solubilized protein fraction; (3) column flow through; (4) column washes; and (5) final protein preparation.


9

FIG. 5. WEE indirect ELISAs. Inactivated WEE antigen was immobilized onto 96-well plates, after which various antibodies were added to each of the wells. Binding was detected with horseradish peroxidase-conjug ated antibodies and ABTS solution. The plates were read at an absorbance of 405 nm. (A) Varying antibody concentrations with 10 ng antigen/ m L or (B) varying antigen concentrations with 10 ng/ m L antibody were used.

mining whether the RS10B5huFc antibody bound to protein G. Antibodies were incubated with protein G and then pelleted by centrifugation. The pellets were analyzed by SDS-PAGE (12% ) and Coomassie staining (Fig. 6). The RS10B5huFc (Fig. 6, Lane 6), 10B5 E7E2 (Fig. 6, Lane 7), and 11H9 (Fig. 6, Lane 8) antibodies were efficiently precipitated, indicating that all three antibodies bound to protein G. Precipitated antibodies were com parable to untreated antibodies that were also run on the SDS-PAGE gels (Fig. 6, Lanes 2–4). The RS10B5huFc antibody consisted of one single-chain molecule of approximately 70 kDa (Fig. 6, Lanes 2 and 6), whereas 10B5 E2E7 and 11H9 antibodies consisted of heavy and light chains of approximately 50 and 25 kDa, respectively (Fig. 6, Lanes 3, 4, 7, and 8). Be-

cause the RS10B5huFc antibody efficiently binds to protein G, the hum an Fc region of the antibody displayed at least some of its proper native conformation. The Fc region of antibodies are not only sites for protein G binding but are also the sites for disulfide bond formation between heavy chains. Disulfide bond formation in the Fc domain is essential for native conformation and dimerization between chains. (32) Our next experiment addressed whether disulfide bonds formed to produce dimers between each of the scFv molecules. Antibodies were treated in either nonreducing or reducing conditions, either in the absence or presence of b -mercaptoethanol, respectively. The antibodies were then analyzed by SDS-PAGE and immunoblotti ng (Fig. 7). In nonreducing

10

LONG ET AL.

FIG. 6. Coomassie stain of protein G binding antibodies. Antibodies were incubated in the presence of protein G-agarose and precipitated by centrifugation. The pellets were run on SDSPAGE gels, which were then Coomassie stained. Lanes: (1) molecular weight markers; (2) RS10B5huFc alone; (3) 10B5 E7E2 alone; (4) 11H9 alone; (5) no antibody control; (6) RS10B5huFc precipitate with protein G; (7) 10B5 E7E2 precipitate with protein G; and (8) 11H9 precipitate with protein G. conditions, high molecular weight aggregates were observed for mouse MAbs, 3F3E9 (Fig. 7, Lane 1) and 10B5 E2E7 (Fig. 7, Lane 3). When b -mercaptoethano l was added, the disulfide bonds were broken and the single monomer chains were observed (Fig. 7, Lanes 2 and 4). Likewise, similar results were obtained with the RS10B5huFc antibody. In nonreducing conditions, high molecular weight aggregates were obtained (Fig. 7, Lane 5), whereas in reducing conditions, the monomer was present (Fig. 7, Lane 6). These results indicated that the RS10B5huFc antibody contained disulfide bonds between individual protein chains. We were interested in determining whether the RS10B5huFc antibody was capable of binding to complement. One of the key functions of the Fc dom ain is to bind and activate complement. The complement system is responsible for the defense against bacteria and the elimination of immune complexes. Furthermore, the complement system is part of the innate immune system and consists of many proteins that act in a cascade; one enzym e acts as a catalyst for next enzyme. One of the ways in which the complement cascade is activated is known as the classical pathway, which links the innate immune response to the adaptive immune response and is activated by the binding of immune complexes at the Fc domain to C1q.(33) The RS10B5huFc antibody was applied to ELISA plates coated with purified human C1q protein. We find that the RS10B5huFc antibody bound strongly to C1q (Fig. 8). As the concentration of the antibody increased, the absorbance reading or RS10B5huFc–C1q binding increased. These results indicated that the human Fc domain of the RS10B5huFc antibody was capable of complement fixation and may be functional in antibody-dependent complement mediated cytolysis (ADCMC).

DISCUSSION Protection from WEE infection and disease is an issue that is currently being addressed and actively researched. It has been

found that protection from alphavirus by activated T cells alone is not effective or sufficient. Instead, clearance and protection from infectious virus in the nervous system of mice is accom plished by delivered antibodies. (8) Thus, an important method for protection against WEE may be facilitated by passive immunization, where viral-specific antibodies are administered to help prevent illness or mediate recovery of individuals exposed to virus. Many scFv antibodies have been found to be capable of neutralizing virus, (14–16 ,20,21) although few have been found to be able to protect mice in vivo. This may be because scFv antibodies do not have immunoglobul in constant regions, which mediate effector function. Functions mediated by the Fc portion of immunoglobuli ns include ADCMC,(34,35) antibody-dependent cellular cytotoxicity (ADCC),(3 6,37) transcytosis of IgG across epithelial surfaces, (38) and long serum half-life. (9 ,10) In hopes of restoring effector functions to a scFv, we report the construction and characterization of a fusion antibody of anti-WEE scFv and human heavy chain IgG 1 constant regions (RS10B5huFc). For optimal beneficial use for future therapystudies and to reduce the host anti-mouse antibody (HAMA) response, (39,40) we have attempted to humanize this fusion antibody by using sequences to the human heavy chain constant regions (CH1–CH3). The RS10B5huFc antibody is efficiently expressed and purified from bacteria. The majority of the antibody is isolated from the insoluble inclusion bodies by sonication in high con-

FIG. 7. Western blotting of multimerized antibodies. Antibodies were incubated in nonreducing or reducing conditions, in the absence or presence of b -mercaptoethanol , respectively. The antibodies were then run on SDS-PAGE gels and immunoblotted. The samples were probed with either anti-mouse or anti-human horseradish peroxidase-conju gates, binding to either mouse or human Fc domains, respectively. Lanes: (1) 3F3E9, ( 2 ) b -mercaptoethano l; (2) 3F3E9, ( 1 ) b -mercaptoethanol; (3) 10B5 E7E2, (2 ) b -mercaptoethanol; (4) 10B5 E7E2, ( 1 ) b -mercaptoethanol; (5) RS10B5huFc, (2 ) b -mercaptoethanol; and (6) RS10B5huFc, ( 1 ) b -mercaptoethanol.


11

FIG. 8. C1q indirect ELISA. A 96-well plate immobilized with purified human C1q protein was incubated with the RS10B5huFc antibody. Binding was detected with an anti-human horseradish peroxidase-conju gated antibody and substrate solution, provided by QUIDEL Corporation. Absorbance values (405 nm) were recorded.

centrations of denaturant (8 M urea). A protein of approximately 70 kDa is present and confirmed to be the 6 His–enterokinase–10B5 scFv-CH1–CH2–CH3 fusion protein. Furthermore, DNA sequencing also confirms that the RS10B5huFc antibody is likely to be an IgG 1 immunoglobu lin of the class g 1, as the Fc dom ain of the RS10B5huFc antibody shows high sequence hom ology to other IgG 1 (g 1) antibodies, throughout CH1, CH2, and CH3. The 10B5 scFv domain of the RS10B5huFc antibody displays sequence conservation with other mouse scFv antibodies, especially within the peptide linker and sequences surrounding the CDR regions. The RS10B5huFc antibody shows good reactivity to WEE in ELISAs, displaying an optimum binding at 10 ng/ m L of antibody with 10 ng/ m L of antigen. Furtherm ore, detection of WEE antigen by the RS10B5huFc antibody is sensitive to less than 1 ng/ m L when 10 ng/ m L of antibody is used. As a result of the RS10B5huFc antibody’ s high WEE binding activity, the antibody can be used in WEE detection assays. The binding affinity of the antibody may be potentially optimized by chain shuffling and CDR mutagenesis. (9,41,42) The protein G binding capability of the RS10B5huFc antibody supports the hypothesis that the Fc domain of the antibody is in its native conformation with disulfide bonds between heavy chain regions. Our SDS-PAGE results determine that multimers are formed, likely between the hum an heavy chains, although the resolution on our gels does not enable us to determine the number of monom ers within the multimer. Due to the multimerization of the RS10B5huFc antibody, the antibody is likely to have multivalent binding activity. Disulfide bond formation within and between antibody chains is essential to their tertiary and quaternary structures. Two disulfide bonds in the Fc domain occur intermolecularly between single antibody chains at the hinge region, at Cys 219 and Cys 222 in the human IgG 1 myelom a protein Eu.(43) Furthermore, disulfide bonds exist with VH, CH1, CH2, and CH3 dom ains at Cys 22-Cys 96, Cys 145-Cys 193, Cys 254-Cys 314,

and Cys 360-Cys 418, respectively. In the light chain, disulfide bonds occur in the VL and CL domains at Cys 23–Cys-88 and Cys 134–194, respectively. (43) Our data confirm s that the corresponding sites for disulfide bond formation exist in the deduced RS10B5huFc antibody protein sequence. Both Cys 390 and Cys 393 of the RS10B5huFc antibody may be involved in intermolecular disulfide bonds between single polypeptide chains at the hinge region. Three Cys exist in CH1 at positions 308, 364, and 384, two of which may be involved in a disulfide linkage. It is likely that Cys 308 and Cys 364 form a disulfide bond, as the disulfide loop for CH1 consists of approximately 49 amino acids. (43) Cys 425–Cys 485 and Cys 531–Cys 589 may be involved in intramolecular disulfide bonds within CH2 and CH3, respectively. The RS10B5huFc antibody also possesses additional Cys in the 10B5 scFv sequence. These Cys may also be involved in maintaining the integrity and structure of the protein by intramolecular disulfide bonds within VH and VL at Cys 83–Cys 157 and Cys 217–Cys 283, respectively. The localization of the disulfide bonds is likely to be between chains in the Fc region and not between chains in the variable domains. Although disulfide bonds have been found to exist between the variable regions of two different scFv chains, this usually occurs only in specific conditions. Often disulfide bonds from between V H and V L domains of one scFv with the V L and V H dom ains of a second scFv, respectively to produce a bivalent antibody. This occurs only at high concentrations of antibody (. 1 mg/mL) or when the linker between V H and V L in the scFv is short (5–10 amino acids). (17) In our experiments, the concentration of the RS10B5huFc antibody is 0.5 mg/mL and the linker between the V H and V L region in the scFv is 15 amino acids, supporting the idea that the RS10B5huFc antibody contains disulfide bonds in the Fc domain and not between variable domains. Effective dimerization of the individual RS10B5huFc chains are essential in forming a conformationall y active Fc region. Functional recom binant antibodies with fusions of scFv to hu-

12

LONG ET AL.

man constant regions have been previously constructed and analyzed. For instance, a scFv fragment fused to the human IgG 1 CH3 domain efficiently dimerizes and dem onstrates strong bivalent binding affinity to the carcinoem bryonic antigen. Furthermore, the scFv-CH3 antibody is shown to have tum or targeting properties in vivo.(44) Another scFv-CH3 fusion antibody not only exists as a dimer, but has associated effector functions such as long serum half-life and Fc receptor binding. (45) Other fusion antibodies, scFv-CL (kappa) and scFv-hinge-CH 2–CH3, were found to exist in multim eric forms and displayed antigen binding activity. (46,47) The Fc region of the RS10B5huFc antibody may be able to mediate effector functions, as it is capable of binding complement. We have chosen to use human IgG 1 because IgG 1 , of the four human IgG subtypes, is the most effective in activating com plem ent (48) and mediating ADCC.(49) Because complement fixation occurs with the RS10B5huFc antibody, the antibody may be able to activate the classical complement pathway, aiding in the elimination of WEE infected cells. That is, the RS10B5huFc antibody may be functional in ADCMC. Neutralization and passive immunization studies are currently in progress. All IgG s are glycosylat ed at conserved positions (Asn 297) in their constant regions, suggestin g that glycosyla tion plays a crucial role in maintaining the structure and function of the antibody. The presence of carbohydr ates at Asn 297 may be essential for antigen clearance functions. (9 ,4 8,5 0) Furtherm ore, a significan t minority of antibodies have carbohydr ate addition sites in VH CDR2, where the affinity of an antibody for its antigen is increased 10 to 50 times by glycosyla tion at Asn 58. (9 ) Asn 297 correspon ds to Asn 461, in the RS10B 5huFc antibody as determin ed by our sequencin g data. Although the proper glycosyla tion sites are present in the protein sequence of the RS10B 5huFc antibody, the antibody is not properly glycosyla ted because E. coli lacks the machinery necessary for flycosyla tion. (1 0,5 1) While these products could be modified in vitro by glycosida ses and transferas es, the rules for glycosyla tion are not well understoo d and the degree of oligosacc haride processin g appears to be site and species specific. (5 2 ) The ideal source of therapeut ic recom binant hum an antibodie s would be mammalian cell or mammalian tissue system s where proper glycosylat ion patterns on the Fc domain would maximize the associated effector functions . The RS10B5huFc antibody may be used in further immunological studies. Bispecific antibodies, which have bifunctional binding specificities, can have a wide range of applications, ranging from immunohistochem istry immunoassays, radioim munodiagnosis, radioimm unotherapy, and immunotherapy. (10,53) Future work will focus on developing and expressing antibodies which cannot only neutralize WEE, but also mediate the elimination of WEE infected cells.

ACKNOWLEDGMENTS The authors thank Dr. G. Ludwig (U.S. Army Medical Research Institute of Infectious Diseases, Frederick, MD) for generously providing us with the WEEV B11 strain. We thank Fay Schmaltz (DRES, Medicine Hat, Alberta) and George Rayner (DRES, Medicine Hat, Alberta) for technical assistance. Also,

much thanks to Drs. Jonathan P. Wong and A. Rashid Bhatti (DRES) for reviewing the manuscript. Dr. Melissa Long (DRES) is supported by a Visiting Fellow ship from NSERC.

REFERENCES 1. Strauss JH, and Strauss EG: The Alphaviruses: Gene expression, replication, and evolution. Microbiol Rev 1994;58:491– 562. 2. Strauss JH, Strauss EG, and Kuhn RJ: Budding of alphaviruses. Trends Microbiol 1955;3:346– 350. 3. Schlesinger S, and Schlesinger MJ: Togaviridae: The viruses and their replication. In: Fields Virology, 3rd ed. Fields BN, Knipe DM, and Howley PM (Eds.). Raven Publishers, Philadelphia, 1996, pp. 843–898. 4. Johnston RE, and Peters CJ: Alphaviruses. In: Fields Virology , 3rd ed. Fields BN, Knipe DM, and Howley PM (Eds.). Raven Publishers, Philadelphia, 1996, pp. 843–898. 5. Boere WAM, Benaissa-Trou w BJ, Harmsen M, Kraaijeveld CA, and Snippe H: Neutralizing and non-neutralizing monoclonal antibodies to the E 2 glycoprotein of semiliki forest virus can protect mice from lethal encephalitis. J Gen Virol 1983;64:1405– 1408. 6. Mathew s JH, and Roehrig JT: Determination of the protective epitopes on the glycoproteins of venezuelan equine encephalomyeli tis virus by passive transfer of monoclonal antibodies. J Immunol 1982;129:2763– 2767. 7. Yamamoto K: Properties of monospecific antibodies to the glycoprotein of western equine encephalitis virus. Microbiol Immunol 1986;30:343– 351. 8. Griffin D, Levine B, Tyor W, Ubol S, and Despres P: The role of antibody in recovery from alphavirus encephalitis. Immunol Rev 1997;159:155– 161. 9. Wright A, Shin S-U, and Morrison SL: Genetically engineered antibodies. Crit Rev Immunol 1992;12:125– 168. 10. Hayden MS, Gilliland LK, and Ledbetter JA: Antibody engineering. Curr Opin Immunol 1997;9:201– 212. 11. Verma R, Boleti E, and George AJT: Antibody engineering: Comparison of bacterial, yeast, insect, and mammalian expression systems. J Immunol Methods 1998;216:165– 181. 12. Winter G, and Milstein C: Man-made antibodies. Nature 1991;349:293– 299. 13. Pantoliano MW , Bird RE, Johnson S, Asel ED, Dodd SW, Wood JF, and Hardman KD: Conformationa l stability, folding, and ligand-binding affinity of single-chain Fv immunoglobulin fragments expressed in Escherichia coli. Biochemistry 1991;30:10117– 10125. 14. Jiang W, Bonnert TP, Venugopal K, and Gould EA: A single chain antibody fragment expressed in bacteria neutralizes tick-borne flaviviruses. Virology 1994;200:21– 28. 15. Mason P, Berinstein A, Baxt B, Parsells R, Kang A, and Rieder E: Cloning and expression of a single-chain antibody fragment specific for foot-and-mouth disease virus. Virology 1996;224: 548–554. 16. Lamarre A, Yu MW N, Chagnon F, and Talbot PJ: A recombinant single chain antibody neutralizes coronavirus infectivity but only slightly delays lethal infection of mice. Eur J Immunol 1997;27:3447– 3455. 17. Raag R, and Whitlow M: Single-chain Fvs. FASEB J 1995;9: 73–80. 18. Alvi AZ, Stadnyk LL, Nagata LP, Fulton RE, Bader DE, Roehrig JT, and Suresh MR: Development of a functional monoclonal single-chain variable fragment antibody against venezuelan equine encephalitis virus. Hybridoma 1999;18:413– 421. 19. Xu B, Kriangkum J, Nagata LP, Fulton RE, and Suresh MR: Generation and characterization of a single chain Fv specific against western equine encephalitis virus. Hybridoma 1999;18:315– 323.

13

RECOMBINANT ScFv ANTIBODY AGAINST WEE 20. Guirakhoo F, Catalan J, Monath T, and Weltzin R: Cloning, expression and functional activities of a single chain antibody fragment directed to fusion protein of respiratory syncytial virus. Immunotechnology 1996;2:219– 228. 21. Muller BH, Lafay F, Demangel C, Perrin P, Tordo N, Flamand A, Lafaye P, and Guesdon JL: Phage-displayed and soluble mouse scFv fragments neutralize rabies virus. J Virol Methods 1997; 67:221– 233. 22. Lewis AP, Lemon SM, Barber KA, Murphy P, Parry NR, Peakman TC, Sims MJ, Worden J, and Crowe JS: Rescue, expression, and analysis of a neutralizing human anti-hepatitis A virus monoclonal antibody. J Immunol 1993;151:2829– 2838. 23. Mah D, Masri S, Mah M, and Jager S: Canada West Biosciences, Calgary, Alberta, Canada, unpublished data. 24. Nagata LP, Alvi AZ, and Ludwig G: Defence Research Establishment Suffield, Medicine Hat, Alberta, Canada, unpublished data. 25. Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680– 685. 26. Towbin H, Staehelin T, and Gordon J: Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 1979;9: 4350– 4354. 27. Rice SA, Long MC, Lam V, and Spencer CA: RNA polymerase II is aberrantly phosphorylated and localized to viral replication compartments following herpes simplex virus infection. J Virol 1994;68:988– 1001. 28. Tang PM, Foltz LA, Mahoney WC, and Schueler PA: A high affinity digoxin-binding protein displayed on M13 is functionally identical to the native protein. J Biol Chem 1995;270:7829– 7835. 29. Ellison JW, Berson BJ, and Hood LE: The nucleotide sequence of a human immunoglobulin C g 1 gene. Nucleic Acids Res 1982; 10:4071– 4079. 30. Ellison J, and Hood L: Linkage and sequence homology of two human immunoglobulin gamma heavy chain constant region genes. Proc Natl Acad Sci USA 1982;79:1984– 1988. 31. Paterson T, Innes J, McMillan L, Downing I, and Carter MC: Variation in IgG1 heavy chain allotype does not contribute to differences in biological activity of two human anti-Rhesus (D) monoclonal antibodies. Immunotechno logy 1998;4:37– 47. 32. Turner M: Antibodies and their receptors. In: Immunology , 5th ed. Roitt I, Brostoff J, and Male D (Eds.). Mosby, London, 1998, pp. 71–82. 33. Walport M: Complement. In: Immunology, 5th ed. Roitt I, Brostoff J, and Male D (Eds.). Mosby, London, 1998, pp. 43–59. 34. Tan LK, Shopes RJ, Oi VT, and Morrison SL: Influence of the hinge region on complement activation, C1q binding, and segmental flexibility in chimeric human immunoglobulins . Proc Natl Acad Sci USA 1990;87:162– 166. 35. Tao MH, Canfield SM, and Morrison SL: The differential ability of human IgG1 and IgG4 to activate complement is determined by the COOH-terminal sequence of the CH2 domain. J Exp Med 1991;173:1025– 1028. 36. Shopes B, Weetall M, Holowka D, and Baird B: Recombinant human IgG1-murine IgE chimeric Ig. Construction, expression, and binding to human Fc gamma receptors. J Immunol 1990;145: 3842– 3848. 37. Canfield SM, and Morrison SL: The binding affinity of human IgG for its high affinity Fc receptor is determined by multiple amino acids in the CH2 domain and is modulated by the hinge region. J Exp Med 1991;173:1483– 1491. 38. Jin BR, Ryu CJ, Park SS, Namgung U, Hong HJ, and Han MH: Cloning, expression, and characterization of murine-human chimeric antibody with specificity for pre-S2 surface antigen of hepatitis B virus. Mol Immunol 1993;30:1647– 1654. 39. Roguska MA, Pedersen JT, Keddy CA, Henry AH, Searle SJ, Lam-

40.

41.

42. 43. 44.

45. 46.

47.

48.

49.

50.

51.

52.

53.

bert JM, Goldmacher VS, Blattler WA, Rees AR, and Guild BC: Humanization of murine monoclonal antibodies through viable domain resurfacing. Proc Natl Acad Sci USA 1994;91:969– 973. Vaughan TJ, Williams AJ, Pritchard K, Osbourn JK, Pope AR, Earnshaw JC, McCafferty J, Hodits RA, Wilton J, and Johnson KS: Human antibodies with sub-nanomolar affinities isolated from a large non-immunize d phage display library. Nat Biotechnol 1996;14:309– 314. Crameri A, Cwirla S, and Stemmer WPC: Construction and evolution of antibody-phage libraries by DNA shuffling. Nat Med 1996;2:100– 102. Vaughan TJ, Osbourn JK, and Tempest PR: Human antibodies by design. Nat Biotechnol 1998;16:535– 539. Edelman GM, and Gall WE: The antibody problem. Annu Rev Biochem 1969;38:415– 466. Hu S, Shively L, Raubitschek A, Sherman M, Williams LE, Wong JY, Shively JE, and Wu AM: Minibody: A novel engineered anticarcinoembry onic antigen antibody fragment (single-chain FvCH3) which exhibits rapid, high-level targeting of xenografts. Cancer Res 1996;56:3055– 3061. Coloma MJ, and Morrison SL: Design and production of novel tetravalent bispecific antibodies. Nat Biotechnol 1997;15:159– 163. McGregor DP, Molloy PE, Cunningham C, and Harris WJ: Spontaneous assembly of bivalent single chain antibody fragments in Escherichia coli. Mol Immunol 1994;31:219– 226. Gilliland LK, Norris NA, Marquardt H, Tsu TT, Hayden MS, Neubauer MG, Yelton DE, Mittler RS, and Ledbetter JA: Rapid and reliable cloning of antibody variable regions and generation of recombinant single chain antibody fragments. Tissue Antigens 1996;47:1– 20. Tao MH, and Morrison SL: Studies of aglycosylated chimeric mouse-human IgG. Role of carbohydrate in the structure and effector functions mediated by the human IgG constant region. J Immunol 1989;143:2595– 2601. Shaw DR, Khazaeli MB, and LoBuglio AF: Mouse/human chimeric antibodies to a tumor-associa ted antigen: Biologic activity of the four human IgG subclasses. J Natl Cancer Inst 1988;80:1553– 1559. Wright A, and Morrison SL: Effect of glycosylation on antibody function: Implications for genetic engineering. Trends Biotechnol 1997;15:26– 32. Jefferis R and Lund J: Glycosylation of antibody molecules: structural and functional significance. Chem Immunol 1997;65: 111–128. Hsieh P, Rosner MR, and Robbins PW: Selective cleavage by endob -acetylglucosam inidase 1g at individual glycosylation sites of Sindbis virion envelope glycoproteins. J Biol Chem 1983;259: 2555– 2561. Cao Y, and Suresh MR: Bispecific antibodies as novel bioconjugates. Bioconjug Chem 1998;9:635– 644.

Address reprint requests to: Les P. Nagata Medical Countermeasu res Section Defence Research Establishment Suffield P.O. Box 4000, Station Main Medicine Hat, Alberta Canada, T1A 8K6 E-mail: les.nagata@dres .dnd.ca Received for publication October 6, 1999. Accepted for publication Decem ber 2, 1999.