Send Orders for Reprints to
[email protected] Protein & Peptide Letters, 2014, 21, 0000-0000
1
Construction, Expression and Characterization of a Single Chain Variable Fragment Antibody Against Human Myostatin Bingbing Wu1,2,#, Taoyan Yuan1,#, Ruili Qi1, Jun He1, Imran R. Rajput1, Weifen Li1, Yan Fu1 and Dong Niu1,* 1
College of Animal Sciences, Zhejiang University, No. 388 Yuhangtang Road, 310058 Hangzhou, P.R. China; 2School of Medicine, Zhejiang University, No. 388 Yuhangtang Road, 310058 Hangzhou, P.R. China Abstract: Myostatin plays negative roles in muscle development. To block the inhibitory effects of myostatin on myogenesis, a 759 bp single chain variable fragment antibody (scFv) against myostatin was constructed and expressed in Escherichia coli. ELISA detection showed that the scFv could bind to myostatin, and change of the scFv N-terminal peptides decreased its binding affinity. MTT assay and cell morphology demonstrated that the cell number and viability of the C2C12 myoblast were enhanced by the scFv. Meanwhile, the scFv significantly inhibited the myostatin-induced expression of cyclin-dependent kinase inhibitor p21 and Smad binding element-luciferase activity. H2O2 increased the expression of Muscle RING Finger 1 (MuRF1) and Muscle Atrophy F-box (MAFbx) in myoblasts as well as myostatin and MuRF1 in myotubes, and the scFv significantly decreased the H2O2-elevated expression of these genes. Conclusively, the scFv we developed could antagonize the inhibitory effects of myostatin on myogenesis through Smad pathway and regulation of p21, MuRF1 and MAFbx gene expression. The scFv may have application in the therapy of muscular dystrophy and improvement of animal meat production.
Keywords: Myostatin, single chain variable fragment antibody, myoblast proliferation, muscle atrophy, Smad pathway. INTRODUCTION Myostatin, also known as GDF8, is an extracellular cytokine mainly secreted from skeletal muscles. Myostatin belongs to the TGF-beta super-family, playing a negative role in the regulation of myogenesis [1, 2]. Natural mutation in the myostatin gene results in the skeletal muscle hypertrophy in mice [1] and cattle [2]. Blockade of myostatin would stimulate growth of dystrophic muscle [3]. The Smad pathway is involved in TGF- signal transduction, myostatin was proven to function mainly through this pathway [4]. And the cyclin-dependent kinase inhibitor, p21, was also reported to be involved in myostatin-mediated inhibition of myogenesis [5]. Myostatin could be induced in many stress, inflammatory and disease conditions such as H2O2 [6] and TNF-alpha [3]. H2O2 could induce muscle atrophy through regulation of Muscle Atrophy F-box (MAFbx) and Muscle RING Finger 1 (MuRF1). MAFbx and MuRF1 are two of the most important E3 ubiquitin ligases involved in the progress of skeletal muscle atrophy [7], and myostatin was also reported to be involved in this progress [3, 8]. Increased myostatin level would induce muscle cachexia and atrophy, ultimately great loss of body weight, which would worsen the disease condition and life quality, even increase the mortality rate [9]. Many techniques have been developed to intervene myostatin signaling such as RNAi [10] and immunoneutralization [11]. While antibodies used in immunization *Address correspondence to this author at the College of Animal Sciences, Zhejiang University, No. 388 Yuhangtang Road, 310058 Hangzhou, P.R. China; Tel/Fax: +86-571-89055973; E-mail:
[email protected] # These authors contributed equally to this work. 0929-8665/14 $58.00+.00
are mostly mouse or rabbit-origin, their large molecular weight, poor tissue penetration and high immunogenicity would greatly limit their applications [12]. And the single chain antibody has smaller dimensions and can be easily selected, produced and manipulated through standard molecular techniques. Here we first reported the construction, expression and characterization of a single chain variable fragment antibody (scFv) specifically against human myostatin. Due to the 100% identity among the mature amino acid sequences of myostatin of different species like human, mouse, rat, pig, dog and chicken [4], the constructed scFv would have wide potential applications in the therapy of muscular dystrophy and improvement of animal meat production. MATERIALS AND METHODS Codon Optimization and Assembly of the Single Chain Variable Fragment Antibody (scFv) Against Myostatin The amino acid sequence of the scFv against the Nterminal peptide fragment of mature myostatin was derived from the heavy chain (VH) and light chain (VL) of a monoclonal antibody against human myostatin [13]. The heavy chain was fused to the light chain by a linker (Gly4Ser)4 creating ‘VH-linker-VL’, which was named as the original scFv (supplementary Table S1) and the sequence was deposited in GenBank (accession No.: JQ818147). After getting the fulllength amino acid sequence of the scFv, the corresponding nucleotide acid sequence was designed by codon optimization according to the E. coli favored codons, GC content and stability of mRNA secondary structures [14]. The optimized © 2014 Bentham Science Publishers
2 Protein & Peptide Letters, 2014, Vol. 21, No. 1
DNA sequence was named as the optimized scFv (supplementary Table S1) (registered ID in GenBank: JQ818148). The optimized sequence was compared with the original one in terms of sequence identity, GC content, CAI value (Codon Adaptation Index) and mRNA secondary structure. The CAI value was calculated by a web server, OPTIMIZER [15], and mRNA secondary structure was analyzed by two physicsbased models (RNA structure software [16] and Vienna RNA web server [17]) and a conditional log-linear model (CONTRAfold) [18]. The optimized nucleotide sequence was assembled through the PCR-based two-step DNA synthesis. The schematic diagram of DNA assembly was shown in Fig. (1A). Firstly, 21 oligonucleotides (named as P1, P2….P21, respectively) were designed to cover the entire DNA sequence of the scFv. Each oligonucleotide is about 50-60 bp in length with 20 bp overlap with the adjacent ones. Two DNA fragments were synthesized by the splicing overlap extension (SOE) PCR technique. The oligonucleotides of P1 to P10 generated the first DNA fragment named F1-10, and the oligonucleotides of P9 to P20 produced the second fragment named F9-20. The two DNA fragments were combined together through the overlap part by PCR using the P1 and P21 as primers generating the whole-length sequence of the scFv. The pfu DNA polymerase (Sangon Biotech) was used to conduct all the PCR reactions. The PCR cycling protocol was 3 min at 94°C for pre-denaturation, 30 cycles of 30 s at 94°C for denaturation, 30 s at 55°C for annealing, and 60 s at 68°C for extension. The resultant whole-length DNA product of the scFv was purified, cloned and sequenced according to the standard techniques. Oligonucleotides used in DNA synthesis were shown in supplementary Table S2. Protein Expression and Purification of the scFv Against Myostatin A recombinant plasmid named pET-scFv was constructed and expressed in E. coli BL21 DE3 (Novagen) through standard molecular techniques. The positive colonies were selected and cultured in Luria-Bertani (LB) broth containing 50 μg/ml kanamycin and 1 mM isopropyl--Dthiogalactopyranoside (IPTG). The cultures were agitated at 200 rpm at 18°C for 36 h for solubly expressing the scFv protein. Recombinant soluble scFvs were purified as follows. Cells were harvested by centrifugation at 5000 rpm for 20 min and resuspended in 20 ml pBS buffer (138.0 mM NaCl, 2.7 mM KCl, 10 mM Phosphate buffer (pH 7.2)), then the mixtures were ice-jacketed and sonicated. Samples were then centrifuged at 4°C at 15,000 g for 15 min, and the supernatants were directly purified with the Ni–NTA agarose (Qiagen) according to the manufacturer’s instruction. The endotoxin was removed by washing with Triton X-114 during Ni–NTA affinity purification according to our previous report [19]. Western Blot Detection of the scFv Against Myostatin Recombinant protein samples were analyzed by sodium dodecyl sulphate-polyacrylamidgel electrophoresis (SDSPAGE). Western blot analysis was conducted using a mouse anti-His antibody (1:5000 dilution, the scFv was co-
Wu et al.
expressed with a His tag) as the primary antibody and a horseradish peroxidase (HRP)-labeled rabbit anti-mouse IgG (1:5000 dilution) as the secondary antibody. The detailed procedure was referred to Wu et al. [19]. ELISA Detection of the Binding Affinity of the scFv to Myostatin The binding affinity of the scFv to myostatin (R&D Systems) was detected by ELISA. Briefly, a 96-well microtiter plate was coated with 0.4 μg/ml myostatin in TBS. After incubation, wash and blocking, 200 μl of different dilutions (0.4-8 μg/ml) of the scFv were applied to different wells and incubated for 1 h at 4°C. A mouse anti-His primary antibody (1:5000 dilution) and a HRP-labeled rabbit anti-mouse secondary antibody (1:8000 dilution) were used to detect the myostatin-bound scFv, and the tetramethyl benzidine (TMB) was used to develop the ELISA results. The binding affinities of different scFv N-terminal fusions to myostatin were detected by the same ELISA procedure using same molar amount of each fusion (2 μM) and sufficient amount of myostatin (2.5 μg/ml). Cell Culture Murine C2C12 skeletal myoblasts (ATCC, USA) were adjusted to 5105/ml, and grown in high glucose Dulbecco’s Modified Eagle’s Medium (DMEM) (Thermo) supplemented with 10% FBS (Gibco), 100 U/ml penicillin and 100 mg/ml streptomycin (Sigma-Aldrich) in 24-well plate. The cells were maintained at 37°C in a humidified atmosphere of 5% CO2 until 70% confluence. Myotubes were induced as follows: after being grown to about 70% confluence in 10% FBS, the C2C12 myoblasts were cultured for another 96 h in DMEM supplemented with 2% horse serum (Hyclone), 100 U/ml penicillin and 100 mg/ml streptomycin. Cell Viability Detection and Cell Morphology Cell viability was determined by 3-(4,5-Dimethylthiazol2-yl)-2,5- diphenyltetrazolium bromide (MTT) assay. Cells were divided into different groups and treated with myostatin or scFv or their combination for 24 h. For cell morphology detection, cells were treated with 8 μg/ml scFv, and photographed with a fluorescence microscope to examine the cell morphology at the 24th and 36th hour of culture. Quantitative Real-time PCR Real-time PCR assay was conducted to determine the relative levels of the p21, MAFbx, MuRF1 and myostatin mRNA expression. Mouse gene-specific primers were as follows: -actin (F: cgttgacatccgtaaagacc, R: aacagtccgcctagaagcac), p21 (F: cctggtgatgtccgacctg, R: ccatgagcgcatcgcaatc), MAFbx (F: cagcttcgtgagcgacctc, R: ggcagtcgagaagtccagtc), MuRF1 (F: ggagaagcagctcatttgcc, R: cctcctgaagacaccgttgtg), and myostatin (F: agtggatctaaatgagggcagt, R: gtttccaggcgcagcttac). Total RNAs were isolated with Trizol (TaKaRa) from the C2C12 myoblasts and myotubes with different treatments. Reverse transcription was conducted using reverse transcription kit (TaKaRa). PCR reactions were performed using SYBR green PCR master mix (TaKaRa) on the ABI 7300 Real-Time PCR system (Applied
scFv Against Human Myostatin
Biosystems). Real-time PCR cycling profiles consisted of an initial denaturation of 95°C for 10 min, followed by 40 cycles consisting of 95°C for 15 s and 60°C for 30 s. The gene expression values were presented and statistically analyzed in the form of 2-CT with the -actin gene as the internal control. Luciferase Reporter Assay To examine whether myostatin functions through the classical Smad pathway, a Smad binding element (SBE)luciferase plasmid [20] was co-transfected into the C2C12 myoblasts by Lipofecter (Beyotime) together with a plasmid containing -galactosidase as the internal control after cells reached 75% confluence. 24 hours after transfection, cells were treated with myostatin alone or together with the scFv. Cell lysates were collected 12 hours after the treatment. The luciferase and -galactosidase activities were determined according to the manufacturer’s instruction (Beyotime). Relative luciferase unit (RLU) was calculated as the ratio of the luciferase activity to the corresponding -galactosidase activity. Statistical Analysis The statistical package SPSS (Version 16.0) was used for statistical analysis, and all data were expressed as the Mean ± SD. The One-Way ANOVA was used to test differences between groups. Values with different letters denote significant difference between groups. RESULTS AND DISCUSSION Codon Optimization of the Single Chain Antibody Against Myostatin The original and optimized sequences of the scFv were shown in supplementary Table S1. Their sequence similarity was 75%. As for the optimized sequence, its GC content ranged from 55.6% to 55.9%, which was consistent with the genomic GC content of E. coli, and its CAI (Codon Adaptation Index) values ranged from 0.394 to 0.716, close to those of E. coli highly expressed genes [21]. These data implied that the optimized sequence was suitable for being expressed in E. coli. The minimum free energies of RNA structure predicted from the original and the optimized sequence were -299.9 and -292.6 kcal/mol by RNAstructure software, or -316.51 and -300.70 kcal/mol by Vienna RNA web server. Both methods predicted an increase in the minimum free energy for the optimized mRNA structure, indicating a less stable structure of the optimized mRNA. The mRNA secondary structure prediction showed that the structure of the optimized sequence seemed much fluffier with more loop and less stick structures compared with the original one (supplementary Fig. S1), which would facilitate the translation from mRNA to protein in E. coli. Construction, Expression and Purification of the scFv Against Myostatin After two rounds of SOE PCR (Fig. 1A), two separate products of 378 bp and 472 bp sharing 91 bp overlapped
Protein & Peptide Letters, 2014, Vol. 21, No. 1
3
sequences generated a 759 bp whole-length scFv (Fig. 1B). The scFv sequence was further confirmed by DNA sequencing. 0.417 mg purified scFv was obtained from 2.41 g wet recombinant bacteria after culture for 36 h. SDS-PAGE and Western blot results (Figs. 1C and 1D) indicated that the expressed scFv protein was about 30 kDa, which was consistent with the result calculated by the Compute pI/Mw program from the Bioinformatics Resource Portal ExPASy of Swiss Institute of Bioinformatics (http://web.expasy.org/compute_pi/). Binding Affinity of the Recombinant scFv to Myostatin The binding affinity of the scFv to myostatin was tested by ELISA. The results (Fig. 2A) showed that the scFv could dose-dependently bind to myostatin until the saturation was reached. The EC50 (median effective concentration) of the scFv was about 1.6 μg/ml when reacting to 100 μl of 0.4 μg/ml myostatin. Generally, recombinant protein is produced in the insoluble inclusion bodies of E. coli, and the purified protein would subsequently undergo denaturation and refolding [19]. However, this procedure seemed not suitable for the scFv production, as the refolded scFv did not have the ability to bind to myostatin based on ELISA detection (data not shown). Thus, strategies of low temperature and long induction time for bacterial growth were taken so that the scFv could be solubly expressed in the cytoplasm of E. coli. And our results showed that the purified soluble scFv had the myostatin-binding ability, implying that a functional scFv against myostatin was successfully obtained. In order to test the effect of the scFv N terminal fusion on its binding ability to myostatin, different constructs (pET-1, pET-2, pET-3) of the scFv were developed. The pET-1 had a signal peptide sequence, pelB leader, fused to the N terminal of the scFv, the pET-2 had a small peptide sequence from the pET-30a (+) vector fused to the scFv N terminal, and the pET-3 had no sequence fused to the N terminal of the scFv. ELISA was conducted to detect the affinity of the scFv fusions to myostatin. The results (Fig. 2B) showed that all the three scFv fusions had significant increase in myostatin binding compared with the BSA control (P
