Control of Ferredoxin and Gal/GalNAc Lectin Gene Expression in ...

INFECTION AND IMMUNITY, May 1998, p. 2383–2386 0019-9567/98/$04.0010 Copyright © 1998, American Society for Microbiology

Vol. 66, No. 5

Control of Ferredoxin and Gal/GalNAc Lectin Gene Expression in Entamoeba histolytica by a cis-Acting DNA Sequence CAROL A. GILCHRIST,1 BARBARA J. MANN,1,2

AND

WILLIAM A. PETRI, JR.1,2,3*

1

Departments of Internal Medicine, Microbiology,2 and Pathology,3 University of Virginia, Charlottesville, Virginia 22908 Received 20 November 1997/Returned for modification 6 January 1998/Accepted 26 January 1998

The ferredoxin (fdx) and lectin (hgl5) promoters of Entamoeba histolytica contain the DNA sequence motif TATTCTATT (URE3). Previously we showed that mutation of the URE3 motif in the hgl5 lectin promoter results in an increase in promoter reporter activity. Mutation of this motif in the fdx promoter led to a 40-to-50% decrease in fdx promoter activity as measured by reporter gene activity and abundance of mRNA. E. histolytica nuclear proteins exhibited sequence-specific binding to the URE3 motif in electrophoretic mobility shift assays. These results support the regulation of both ferredoxin and lectin promoters by a nuclear protein(s) which recognizes the URE3 motif. The protozoan Entamoeba histolytica is a major cause of morbidity and mortality worldwide. There are an estimated 50 million cases of invasive amebiasis annually. The most common clinical presentation of E. histolytica infection is amebic dysentery, but amebic abscesses in liver, lung, and brain also occur. Annual mortality in 1994 was estimated to be between 40,000 and 110,000. The factors that promote invasive rather than commensal infection are not understood (24). Clonal lines derived from a single isolate of E. histolytica exhibit different levels of virulence (17). In addition, external factors alter the virulence of trophozoite cultures (1, 2, 8, 11, 13, 15). This difference in virulence is thought to be effected at least partly through altered expression of E. histolytica genes. The study of transcriptional regulation of E. histolytica genes is therefore important for understanding the virulent phenotype. Little is known about the regulation and control of gene expression in this pathogen. The recent development of transfection systems for E. histolytica, however, allows in vivo analysis of promoter function (16, 19). Ferredoxin is the primary electron acceptor in the oxidation of pyruvate to acetyl coenzyme A, functioning as a cofactor for the amebic fermentation enzyme pyruvate-ferredoxin oxidoreductase. These electrons are used in the reduction of oxygen by this facultative anaerobe, and therefore this reaction is important for the survival of E. histolytica in an oxygen-rich environment such as the one encountered in the host circulatory system. The 59 sequences of the ferredoxin gene (fdx) (10) contain the motif TATTCTATT. This sequence is also present in the 59 sequence of the lectin genes hgl3 (5, 20) and hgl5 (22) and in those of alkyl-hydroperoxidase reductase (4). We previously demonstrated that the mutation of this motif (URE3) in the hgl5 promoter increased reporter gene expression (21). To ascertain whether URE3 had a role in controlling the expression of other E. histolytica genes, we examined its function within the fdx promoter. Like that in hgl5, the URE3 within fdx was located close to the site of transcription initiation at 260 to 251. The fdx 59 regulatory sequences (2510 to 133), fused

to the luciferase structural gene (9), were cloned into the plasmid pJST2.1 (23) to create the expression vector pFerrLucTP. The fdx promoter was mutated by replacement of the URE3 sequence TTATTCTATT with a sequence containing an EcoRI restriction site (underlined) TTAGAATTCA to generate plasmid pFerrMutTP. This mutated sequence was identical to the sequence which replaced URE3 within the hgl5 promoter (21). Reporter gene luciferase activities (19) and mRNA levels were compared after stable transfection (23) of trophozoites with the above-mentioned plasmids containing the wild-type and URE3-mutated fdx promoters. The amounts of luc and neo mRNA were quantitated by determination of the amount of the radioactive probe hybridized to a Northern blot prepared by standard methods (3). This blot was exposed to a phosphorimage screen overnight. The screen was then scanned with the PhosphorImager (Molecular Dynamics 425) and analyzed with ImageQuant software (Molecular Dynamics, Sunnyvale, Calif.). Amebae in logarithmic growth were seeded at a concentration of 0.2 3 104 per ml and grown for 45 h. The amebae were harvested at a concentration of approximately 5 3 104 to 7 3 104 per ml. Growth-arrested amebae were seeded at 0.6 3 104 per ml and grown in normal medium for 33 h before the medium was replaced with prewarmed TYI-S-33 without serum. The amebae were then left 12 more h at 37°C to growth arrest. Mutation of URE3 in the fdx promoter resulted in a 40% decrease in reporter gene activity in exponentially growing but not growth-arrested amebae (Fig. 1A). A 50% decrease in steady-state reporter gene mRNA levels was also observed upon mutation of URE3 (Fig. 1B). These data indicate that in contrast to its role in the hgl5 promoter as a negative regulatory element (21), the URE3 motif acted as a positive regulator of fdx promoter activity. Given that mutation of URE3 in both the fdx and hgl5 promoters affected reporter gene activity, we wished to determine whether an E. histolytica nuclear protein or proteins exhibited sequence-specific binding to URE3. Nuclear extracts were prepared by a modification of the method described by Esther Orozco, CINVESTAV, Mexico City, Mexico (17a): amebae (4 3 107) were collected in growth medium, washed once in phosphate-buffered saline, and then collected by a 10-s spin at 7,000 3 g. The amebae were resuspended in 4 volumes of 10 mM HEPES-KOH (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 0.2% Nonidet P-40, 0.5 mM phenylmethylsulfonyl fluoride,

* Corresponding author. Mailing address: Rm. 2115, MR4 Bldg., University of Virginia Health Sciences Center, Charlottesville, VA 22908. Phone: (804) 924-5621. Fax: (804) 924-0075. E-mail: wap3g @virginia.edu. 2383

2384

NOTES

INFECT. IMMUN.

FIG. 1. Mutation of URE3 motif decreases fdx promoter activity. (A) Luciferase reporter gene activity in amebae transfected with wild-type or URE3-mutated fdx promoters in growth-arrested and exponentially growing trophozoites (x# 6 standard error, n 5 3 where n is the number of independent experiments, each of which was done in triplicate). (B) luc and neo mRNA in exponentially growing amebae transfected with wild-type or URE3-mutated fdx promoters. (The image was generated with the PhosphorImager [Molecular Dynamics model 425] in conjunction with the Adobe Photoshop 3 software program.)

and 0.5 mM dithiothreitol and left to swell for 10 min on ice. After the mixture was vortexed for 10 s, the nuclei were collected by centrifugation for 10 min at 1,100 3 g. The nuclei were then suspended in a solution of 150 ml of 20 mM HEPESKOH (pH 7.9), 0.42 M NaCl, 1 mM EDTA, 1 mM EGTA, 0.5 mM phenylmethylsulfonyl fluoride, and 0.5 mM dithiothreitol. The nuclei were then incubated at 4°C for 30 min and spun for 20 min at 4°C at 10,000 3 g. The supernatant containing the nuclear extract was aliquoted and flash frozen in liquid N2 and stored at 270°C. Electrophoretic mobility shift assays were performed with the double-stranded oligonucleotides listed in Table 1. The oligonucleotides were labeled with [a-32P]dATP with the Klenow fragment of DNA polymerase I and purified from unincorporated nucleotide by a NucTrap column (Stratagene, La Jolla, Calif.). The radiolabeled probe was further purified by a polyacrylamide gel extraction procedure (7). The protein-DNA interaction occurred in band shift buffer (10 mM Tris-HCl [pH 7.9], 50 mM NaCl, 1 mM EDTA, 0.05% nonfat milk powder [Carnation], 3% glycerol, 0.05 mg of bromophenol blue) to which 0.2 mg of poly(dIdC), 10 fmol of DNA probe, and 2 mg of nuclear extract were added (14). The reaction mixture was allowed to incubate at room temperature (20°C) for 1 h prior to electrophoresis on a nondenaturing polyacrylamide gel for 2 to 3 h (6). The gel was then fixed and dried, and the signal from the protein-DNA complex was quantitated after exposure of the gel to a phosphorimage screen as described previously. A major and two minor protein-DNA complexes were observed when the nuclear extract was interacted with the fdx URE3 oligonucleotide (Fig. 2A). All three DNA-protein complexes were competed with self (the fdx URE3) but not with hgl5 MUT or the unrelated oligonucleotide. Only the major fdx URE3 DNA-protein complex was specifically competed by the addition of cold hgl5 URE3. In a converse experiment, we also

assayed the hgl5 URE3 oligonucleotide (Table 1) by electrophoretic mobility shift. One major and several minor nuclear protein-DNA complexes were formed with hgl5 URE3 (Fig. 2B). Only the major (most prominent) band was competed by excess unlabeled hgl5 URE3 but not by the unrelated oligonucleotide or hgl5 MUT. The formation of the major hgl5 DNAprotein complex could be depleted by the addition of the fdx URE3 competitor but at a higher molar excess than that required to achieve competition by itself. The major gel shift band was not observed when the hgl5 MUT oligonucleotide was assayed by electrophoretic mobility shift (data not shown). The cross competition for the nuclear protein binding by fdx URE3 and hgl URE3 is consistent with the recognition of both URE3 motifs by the same nuclear protein or proteins. The surrounding sequences of the fdx and hgl5 promoters may have an impact on the equilibrium or strength of the URE3 DNAprotein binding reactions, as competition by the homologous URE3 oligonucleotide was greater than that by the heteroloTABLE 1. Oligonucleotides used in electrophoretic mobility shift analyses Oligonucleotide or promoter

Sequencea

hgl5 URE3.................. TGTTCCAAAAAGATATATTCTATT GAAAATAAAAGAAG hgl5 MUT ................... TGTTCCAAAAAGATTAGAATTCAA GAAAATAAAAGAAG fdx URE3 ................... ACTAACTAAATTTCTTATTCTATT TAAATCACAAACAA Olig-1b ......................... AGAAAGCGTAATAGCTCA hgl5 promoter....... . . .GTTCCAAAAAAGATATATTCTATT GAAAATAAAAGAAG. . . fdx promoter......... . . .ACTAACTAAATTTCTTATTCTATT TAAATCACAAACAA. . . a The URE3 motif is indicated in bold-faced type, and underlining indicates sequence similarity. b Olig-1, unrelated oligonucleotide.

VOL. 66, 1998

NOTES

2385

FIG. 2. Electrophoretic mobility shift analysis of the URE3 motif in fdx and hgl5. Electrophoretic mobility shift assays were performed with Klenow-radiolabeled fdx URE3 (A) and hgl5 URE3 (B) double-stranded DNA. Increasing concentrations (53, 103, and 203 [A] or 53, 253, and 503 [B]) of unlabeled fdx URE3, hgl5 URE3, hgl5 MUT, or an unrelated oligonucleotide (Olig-1) were added as competitors to the binding reactions as indicated. See Table 1 for sequences of the oligonucleotides. (The image was generated with the PhosphorImager [Molecular Dynamics model 425] in conjunction with the Adobe Photoshop 3 software program.)

gous URE3 oligonucleotide. However, these results could also be due to the binding of two different proteins with different affinities for the URE3 sequence in the contexts of hgl5 and fdx promoters. In summary, mutation of the URE3 motif in both fdx and hgl5 altered reporter gene activity. The electrophoresis mobility shift assays demonstrated recognition of the URE3 motif by an E. histolytica nuclear protein(s). The fact that the mutation of URE3 had opposite effects in different promoter contexts might seem unusual; however, there are a considerable number of precedents. The binding of transcription factor E2F, for instance, can affect promoter activity positively or negatively depending whether unphosphorylated pocket proteins are present (12, 18). Identification of the protein or proteins which bind to URE3 will be important for understanding its function in transcriptional regulation. Future studies on URE3-mediated regulation will allow clarification of the role of the proteins which bind to URE3 in both trophozoite growth and host invasion. We thank Esther Orozco and Janet Yee for advice on preparing nuclear extracts and Tim Bender, Alison F. Richardson, Lisa Palmer, and David Auble for helpful discussions. This work was supported by NIH grant AI 37941. W.A.P. is a Burroughs Wellcome Fund Scholar in Molecular Parasitology. REFERENCES 1. Bhol, K. C., R. M. Mukherjee, M. Banerjee, T. K. Maitra, and K. N. Jalan. 1991. Enhancement of virulence of Entamoeba histolytica by in vitro liver treatment. Ann. Trop. Med. Parasitol. 85:341–344. 2. Bracha, R., and D. Mirelman. 1984. Virulence of Entamoeba histolytica trophozoites. Effects of bacteria, microaerobic conditions and metronidizole. J. Exp. Med. 160:353–368. 3. Brown, T., and K. Mackey. 1997. Analysis of RNA by Northern and slot blot hybridization, p. 4.9.1–4.9.13. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, K. Struhl, L. M. Albright, D. M. Coen, and A. Varki (ed.), Current protocols in molecular biology, vol. 1. John Wiley & Sons, Inc., New York, N.Y. 4. Bruchhaus, I., and E. Tannich. 1993. Analysis of the genomic sequence encoding the 29-kDa cysteine-rich protein of Entamoeba histolytica. Trop. Med. Parasitol. 44:116–118. 5. Bub, H., C. Z. Lioutas, S. Dobinsky, R. Nickel, and E. Tannich. 1995. Anal-

ysis of the 170-kDa lectin promoter of Entamoeba histolytica. Mol. Biochem. Parasitol. 72:1–10. 6. Buratowski, S., and L. A. Chodosh. 1997. Mobility shift DNA-binding assay using gel electrophoresis, p. 12.2.1–12.2.11. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, K. Struhl, L. M. Albright, D. M. Coen, and A. Varki (ed.), Current protocols in molecular biology, vol. 2. John Wiley & Sons, Inc., New York, N.Y. 7. Chory, J., and A. S. Baldwin, Jr. 1997. Resolution and recovery of small DNA fragments, p. 2.7.1–2.7.8. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, K. Struhl, L. M. Albright, D. M. Coen, and A. Varki (ed.), Current protocols in molecular biology, vol. 1. John Wiley & Sons, New York, N.Y. 8. Das, S. R., and S. Goshal. 1976. Restoration of virulence to rat of axenically grown Entamoeba histolytica by cholesterol and hamster liver passage. Ann. Trop. Med. Parasitol. 70:439–443. 9. Gilchrist, C. A., H. L. Streets, J. P. Ackers, and R. Hall. 1995. Transient expression of luciferase in Entamoeba histolytica driven by the ferredoxin gene 59 and 39 regions. Mol. Biochem. Parasitol. 74:1–10. 10. Huber, M., L. Garfinkel, C. Gitler, D. Mirelman, M. Revel, and S. Rozenblatt. 1988. Nucleotide sequence analysis of an Entamoeba histolytica ferredoxin gene. Mol. Biochem. Parasitol. 31:27–34. 11. Khan, M. A., P. C. Sen, and B. Mishra. 1990. Enhancement of virulence of Entamoeba histolytica by histamine in vitro. Indian J. Exp. Biol. 28:376–377. 12. Lam, E. W.-F., and N. B. La Thangue. 1994. DP and E2F proteins: coordinating transcription with cell cycle progression. Curr. Opin. Cell Biol. 6:859– 866. 13. Lushbaugh, W. B., A. B. Kaitalla, C. B. Loadholt, and F. E. Pittman. 1978. Effect of hamster liver passage on the virulence of axenically cultivated Entamoeba histolytica. Am. J. Trop. Med. Hyg. 27:248–254. 14. Miglarese, M. R., A. F. Richardson, N. Aziz, and T. P. Bender. 1996. Differential regulation of c-Myb-induced transcription activation by a phosphorylation site in the negative regulatory domain. J. Biol. Chem. 271:22697–22705. 15. Mirelman, D., R. Bracha, A. Chayen, A. Aust-Kettis, and L. S. Diamond. 1986. Entamoeba histolytica: effect of growth conditions and bacterial culture associates on isozyme patterns and virulence. Exp. Parasitol. 62:142–148. 16. Nickel, R., and E. Tannich. 1994. Transfection and transient expression of chloramphenicol acetyltransferase in the protozoan parasite Entamoeba histolytica. Proc. Natl. Acad. Sci. USA 91:7095–7098. 17. Orozco, E., M. E. Suarez, and T. Sanchez. 1985. Differences in adhesion, phagocytosis and virulence of clones from Entamoeba histolytica, strain HM1:IMSS. Int. J. Parasitol. 15:655–660. 17a.Orozco, E. Personal communication. 18. Picksley, S. M., and D. P. Lane. 1994. p53 and Rb: their cellular roles. Curr. Opin. Cell Biol. 6:853–858. 19. Purdy, J. E., B. J. Mann, L. T. Pho, and W. A. Petri, Jr. 1994. Transient transfection of the enteric parasite Entamoeba histolytica and expression of firefly luciferase. Proc. Natl. Acad. Sci. USA 91:7099–7103.

2386

NOTES

20. Purdy, J. E., B. J. Mann, E. C. Shugart, and W. A. Petri, Jr. 1993. Analysis of the gene family encoding the Entamoeba histolytica galactose-specific adhesion 170-kDa subunit. Mol. Biochem. Parasitol. 62:53–60. 21. Purdy, J. E., L. T. Pho, B. J. Mann, and W. A. J. Petri. 1996. Upstream regulatory elements controlling expression of the Entamoeba histolytica lectin. Mol. Biochem. Parasitol. 78:91–103. 22. Ramakrishnan, G., B. D. Ragland, J. E. Purdy, and B. J. Mann. 1996. Physical mapping and expression of gene families encoding the N-acetyl

Editor: P. J. Sansonetti

INFECT. IMMUN. D-galactosamine adherence lectin of Entamoeba histolytica. Mol. Microbiol. 19:91–100. 23. Vines, R., J. E. Purdy, B. D. Ragland, J. Samuelson, B. J. Mann, and W. A. Petri, Jr. 1995. Stable transfection of Entamoeba histolytica. Mol. Biochem. Parasitol. 71:265–267. 24. Walsh, J. A. 1988. Prevalence of Entamoeba histolytica infection, p. 93–105. In J. I. Ravdin (ed.), Amebiasis: human infection by Entamoeba histolytica. John Wiley and Sons, New York, N.Y.