CRH Activation of Different Signaling Pathways Results in Differential ...

J C E M

O N L I N E

Hot Topics in Translational Endocrinology—Endocrine Research

CRH Activation of Different Signaling Pathways Results in Differential Calcium Signaling in Human Pregnant Myometrium before and during Labor Xingji You, Lu Gao, Jie Liu, Chen Xu, Chunmin Liu, Yuan Li, Ning Hui, Hang Gu, and Xin Ni Department of Physiology and the Key Laboratory of Molecular Neurobiology of the Ministry of Education (X.Y., L.G., C.X., X.N.), Second Military Medical University, and Department of Obstetrics and Gynecology (J.L., C.L., Y.L., N.H., H.G.), Changhai Hospital, Shanghai 200433, China

Context: Our previous study has demonstrated that CRH has differential effects on human uterine contractility before and after onset of labor. Intracellular Ca2⫹ concentration ([Ca2⫹]i) mobilization plays an important role in the control of uterine contraction. Objective: Our objective was to investigate the effects of CRH on [Ca2⫹]i homeostasis in laboring and nonlaboring myometrial cells and determine subsequent signaling involved in [Ca2⫹]i regulation by CRH. Design: The myometrial tissues were obtained from pregnant women who were undergoing or not undergoing labor at term. [Ca2⫹]i was determined by Ca2⫹ imaging system using the fluorescent dye fura-2-acetoxymethyl ester. Western blot analysis, ELISA, and RIA were used to determine the signaling pathways induced by CRH. Results: CRH induced Ca2⫹ transient in laboring cells, which was blocked by CRH receptor type 1 (CRHR1) antagonist antalarmin. CRHR1 knockdown impaired this effect of CRH. CRH activated Gi protein, decreased cAMP production, and induced phosphorylated phospholipase C-␤3 and inositol-1,4,5-triphosphate production. Phospholipase C and inositol-1,4,5-triphosphate receptor inhibitors blocked the CRH-induced Ca2⫹ transient in laboring cells. CRH did not induce whereas antalarmin induced the Ca2⫹ transient in nonlaboring cells. Knockdown of CRHR1 impaired the effect of antalarmin. CRH acted on CRHR1 to activate Gs in nonlaboring cells. Forskolin blocked antalarmin-induced Ca2⫹ transient. Conclusions: CRH acts on CRHR1 to activate different signaling pathways before and after onset of labor, thereby resulting in differential calcium signaling in response to CRH. The signaling pathways of CRHR1 might serve as a target for the development of new therapeutic strategies for preterm birth. (J Clin Endocrinol Metab 97: E1851–E1861, 2012)

n increasing body of evidence suggests that CRH, a 41-amino-acid peptide hormone, plays a pivotal role in the control of human pregnancy and parturition (1–3). During human pregnancy, the placenta and fetal membranes produce large amounts of CRH, the circulating concentration of which rises exponentially in the third trimester of pregnancy (4 –7). It has been noted that the

A

rise of maternal CRH level occurs earlier and more rapidly in women delivered preterm (7–13), and more slowly in women delivered postterm, than in women delivered at term (7, 10). Because of this, CRH has been proposed to regulate a placental clock that controls a cascade of physiological events leading to parturition (1, 7). Although the precise biological functions of CRH during human preg-

ISSN Print 0021-972X ISSN Online 1945-7197 Printed in U.S.A. Copyright © 2012 by The Endocrine Society doi: 10.1210/jc.2011-3383 Received December 16, 2011. Accepted July 16, 2012. First Published Online August 6, 2012

Abbreviations: AC, Adenylyl cyclase; AM, acetoxymethyl ester; 2APB, 2-aminoethoxydiphenyl borate; [Ca2⫹]i, intracellular Ca2⫹ concentration; CRHR, CRH receptor; GP, G protein; IP3, inositol-1,4,5-triphosphate; PKA, protein kinase A; PLC, phospholipase C; TL, in labor at term; TNL, not in labor at term; SQ22536, 9-(tetrahydro-2-furanyl)-9H-purin-6amine; siRNA, small interfering RNA; UCNII, urocortin II.

J Clin Endocrinol Metab, October 2012, 97(10):E1851–E1861

jcem.endojournals.org

E1851

E1852

You et al.

Calcium Responses Induced by CRH in Myometrium

nancy are not fully understood, many studies have indicated that CRH is involved in the regulation of myometrial contractility during pregnancy (13–18). It has been shown that CRH promotes myometrium quiescence during the most of pregnancy, whereas it facilitates myometrial contractility after the onset of parturition (13, 17, 18). However, the mechanisms by which CRH exerts such dual effects remain to be elucidated. Intracellular Ca2⫹ concentration ([Ca2⫹]i) regulation is a key factor in the modulation of uterine contraction (19, 20). Particularly, the intracellular mechanisms responsible for generation of phasic contractions are thought to rely on the production of repetitive intracellular Ca2⫹ transients (21–23). A number of endogenous factors that modulate uterus contractility mainly affect the [Ca2⫹]i homeostasis, although some factors regulate uterus contractility through calcium-independent pathway. Uterotonins such as oxytocin and prostaglandin F2␣ can bind to G protein-coupled receptors that link to Gq to activate phospholipase C (PLC) and subsequently increases [Ca2⫹]i (24 –26). Many uterine relaxants stimulate G protein (GP)-coupled receptors that link to Gs, which activate adenylyl cyclase (AC) to produce cAMP, and then activate cAMP-dependent protein kinase [protein kinase A (PKA)] (25, 26). PKA can phosphorylate a number of proteins that can cause a decrease in [Ca2⫹]i (27–29). CRH receptor (CRHR) subtypes CRHR1 and CRHR2 belong to the class II GP-coupled receptor superfamily. CRHR can couple with multiple classes of G proteins including Gs, Gq, and Gi in human pregnant myometriium (17, 30, 31). However, studies regarding effects of CRH on [Ca2⫹]i homeostasis in human pregnant myometrium have not been performed. The aims of the present study were to examine whether CRH regulates [Ca2⫹]i homeostasis in human pregnant myometrium, compare CRH actions in myometrial biopsies obtained before and during labor, determine the specific CRHR responsible for CRH actions, and determine the signaling pathway involved in regulation of [Ca2⫹]i by CRH.

Materials and Methods Reagents CRH, antalarmin, astressin 2B, 2-aminoethoxydiphenyl borate (2APB), 9-(tetrahydro-2-furanyl)-9H-purin-6-amine (SQ22536), deoxyribonuclease I, oxytocin, forskolin, H89, U73122, and anti-␤-actin monoantibody were purchased from Sigma-Aldrich (St. Louis, MO). Urocortin II (UCNII) was obtained from Bachem California Inc. (Torrance, CA). Fura-2/acetoxymethyl ester (AM) was provided by Molecular Probes (Eugene, OR), and DMEM and collagenase type II were obtained from Invitrogen (Carlsbad, CA). GP antagonist-2A and phos-


phorylated PLC-␤ (Ser 537) antibody were purchased from Enzo Life Sciences (Waterloo, Australia) and Santa Cruz Biotechnology (Santa Cruz, CA), respectively.

Tissue collection Biopsies of human myometrium were obtained from pregnant women undergoing elective cesarean section [not in labor at term (TNL)] and emergency cesarean section [in labor at term (TL)] at term (37– 42 wk). None of the women included in this study had evidence of underlying disease (e.g. hypertension, diabetes, preeclampsia, intrauterine growth restriction, etc.). Biopsies were excised from the middle portion of upper edge of the incision line in the lower uterine segment. Ethical approval was obtained from the specialty committee on ethics of biomedicine research, Second Military Medical University, Shanghai, China. Written informed consent was obtained from all patients.

Myometrial cell cultures Myometrial cells were isolated by enzymatic dispersion as described previously (32). Briefly, myometrial pieces were incubated with DMEM containing 1 mg/ml collagenase type II and 1 mg/ml deoxyribonuclease I at 37 C for 45 min. After filtration, the cell suspension was centrifuged at 600 ⫻ g for 10 min, and the cell pellet was resuspended in DMEM containing 10% fetal calf serum, penicillin (100 U/ml) and streptomycin (100 mg/ml). The cells were then plated into 25-cm2 flasks and kept at 37 C in a 5% CO2/95% air, humidified atmosphere until confluent (⬃2 wk). The purity of myocyte cultures was assessed by immunocytochemistry using ␣-actin monoclonal antibody (Sigma-Aldrich). All experiments were performed with myometrial cells of passage 1.

Measurement of [Ca2ⴙ]i Myometrial smooth muscle cells were loaded with 5 ␮M fura2/AM for 60 min at 37 C in HEPES-buffered Krebs solution [in mM: 140 NaCl, 5.0 KCl, 1.0 MgCl2, 2.0 CaCl2, 6.0 glucose, and 10 HEPES (pH 7.4)]. Loaded cells were washed and placed in a custom-designed perfusion chamber for 20 min at room temperature in the dark to ensure complete deesterification of the dye. Then, chambers were mounted on the stage of an Olympus inverted microscope equipped with a CCD camera. Cells were then treated with increasing concentrations of CRH, antalarmin, astressin 2B, or UCNII. In some cases, antagonists antalarmin and astressin 2B or inhibitors U73122 and 2APB were administrated 1 min ahead of CRH to test whether they block the effect of CRH. Fura-2 fluorescence imaging (emission ⫽ 510 nm), after alternate excitation at 340 and 380 nm, was acquired and analyzed using the Metafluor imaging software (Universal Imaging Corp., Downingtown, PA). [Ca2⫹]i was calculated according to the following equation: [Ca2⫹]i ⫽ Kd [(R ⫺ Rmin)/(Rmax ⫺ R)] ⫻ [Sf2/Sb2]. The values for the minimum ratio (Rmin), maximum ratio (Rmax), minimum 380 fluorescence (Sf2), and maximum 380 fluorescence (Sb2) were determined from calibrations of fura-2 for individual cells. Kd, the apparent dissociation constant for fura-2, is 224 nM. At the end of each experiment, cells were treated with 0.1% Triton X-100 and 5 mM EGTA to determine Rmax and Rmin, respectively.

Western blotting analysis Cells were harvested in the presence of lysis buffer comprising 60 mM Tris-HCl, 2% sodium dodecyl sulfate, 10% sucrose, 2


mM phenylmethylsulfonyl fluoride (Merck, Darmstadt, Germany), 1 mM sodium orthovanadate (Sigma-Aldrich), and 10 ␮g/ml aprotinin (Bayer, Leverkusen, Germany). Myometrial cell proteins (50 mg) were denatured and separated by 10% SDSPAGE and subsequently transferred to nitrocellulose membranes by electroblotting. After transfer, membranes were incubated in blocking buffer and then with specific antibodies phosphorylated PLC-␤ (Ser 537) or anti-␤-actin overnight at 4 C. Membranes were then washed and incubated with a secondary horseradish peroxidase-conjugated antibody and immunoreactive proteins visualized using enhanced chemiluminescence (Santa Cruz Biotechnology). The intensities of light-emitting bands were detected and quantified using Sygene Bio Image system (Synoptics Ltd., Cambridge, UK).

RNA interferences The human CRHR1 small interfering RNA (siRNA) plasmid was constructed using the pRNAT-U6.1/Neo vector (Jinsite Biotechnology Corp., Nanjin, China) as described previously (32). The target sequence of human CRHR1-specific siRNA was 5⬘-GGATCCCGGTGCACTACCATGTCGCAT TCAAGAGATGCGACATGGTAGTGCACCTTTTTTCCAA AAGCTT-3⬘. Control siRNA plasmid was supplied by Jinsite Biotechnology, coding a hairpin siRNA without homology to any known human mRNA sequences in the NCBI RefSeq database. Human myometrial cells were separately transfected with pRNAT-U6.1/Neo-CRHR1 and pRNAT-U6.1/Neo-Control vector using Lipofectamine LTX (Invitrogen, Grand Island, NY) according to the manufacturer’s manual. For knockdown of the CRHR2 gene, sequence-specific siRNA targeting human CRHR2 (sense 5⬘-GGAAUGUGAUUCACUGG AATT-3⬘ and antisense 5⬘-UUCCAGUGAAUCACAUUCCTT-3⬘) wasused.ThesiRNAsense5⬘-UUCUCCGAACGUGUCACGUTT3⬘ and antisense 5⬘-ACGUGACACGUUCGGAGAATT-3⬘ was used as a control. The cultured myometrial cells were transfected with CRHR2 siRNA and negative control siRNA using Lipofectamine 2000 (Invitrogen) for 24 h, cells then washed and treated with increasing concentration of CRH in absence and presence of antalarmin.

Measurement of activated Gs and Gi protein levels The levels of activated, GTP-bound Gs and Gi proteins were measured using commercial Gs and Gi activation assay kits (NewEast Biosciences, Malvern, PA). Myometrial cells were treated with increasing concentrations of CRH for 5 min and then scraped off the plate in the presence of lysis buffer. The cell lysate was centrifuged for 10 sec at 12,000 ⫻ g, and the supernatant was immunoprecipitated with anti-active Gs or Gi monoclonal antibody and the protein A/G beads. After incubating at 4 C for 1 h, the beads were washed three times (10 min each) in lysis buffer. Bound proteins were analyzed by Western blot with anti-Gs or anti-Gi monoclonal antibody. To control sampling errors, the total Gs or Gi protein was also detected.

cAMP assay Myometrial cells were treated with increasing concentrations of CRH for 10 min and then scraped off the plate in the presence of 50 mM sodium acetate (pH 4.75). Lysates were boiled at 95 C for 10 min and then quickly sonicated in an ice bath. The supernatants were collected by centrifuge and used for cAMP assay


E1853

according to the protocol of a commercial 125I RIA kit (Huaying Biotechnology Research Institute, Peking, China).

Inositol-1,4,5-triphosphate (IP3) assay Myometrial cells were treated with increasing concentrations of CRH for 10 min, and then culture media were discarded and replaced by PBS. After repeated freezing of the cells three times, the supernatants were collected by centrifuge (3000 ⫻ g for 20 min). IP3 content in supernatants was assayed using the IP3 ELISA kits (R&D Systems, Minneapolis, MN).

Statistical analysis Data are presented as mean ⫾ SEM. In some cases, for illustrative purposes, the results are presented as the mean percent control ⫾ SEM. Control cultures were conducted in the absence of exogenous reagents. Individual comparison was made by a one-way ANOVA followed by a Student-Newman-Keuls test. A P value ⬍0.05 was considered significant.

Results CRH acts on CRHR1 to initial a transient rise in [Ca2ⴙ]i in TL myometrial cells Basal [Ca2⫹]i was 314.7 ⫾ 44.9 nM in TL myometrial cells exposed to 50 mM Ca2⫹. Application of CRH into cells initiated a transient increase in [Ca2⫹]i. The peak of [Ca2⫹]i was reached at 30 sec after administration of CRH (Supplemental Fig. 1, published on The Endocrine Society’s Journals Online web site at http://jcem.endojournals. org). Administration of increasing concentration of CRH (10⫺10–10⫺7 M) caused a dose-dependent increase in [Ca2⫹]i. The maximal effect was occurred at 10⫺7 M CRH, with more than two times basal levels (Fig. 1A). To elucidate which subtype of CRHR is responsible for CRH-induced calcium transient, the specific CRHR antagonists were used at first. Application of the CRHR1 antagonist antalarmin completely blocked the CRH-induced transient rise in [Ca2⫹]i, whereas application of CRHR2 antagonist astressin 2B did not affect the CRHinduced calcium transient (Fig. 1B). The siRNA approach was then applied to confirm the effect of CRHR1. Transfection of CRHR1 siRNA plasmid into cultured myometrial cells resulted in an approximately 83% decrease in CRHR1 expression (Fig. 1C). The CRH-induced transient peak of [Ca2⫹]i did not occur in the cells transfected with CRHR1 siRNA plasmid, whereas a transient peak of [Ca2⫹]i induced by CRH remained in cells transfected with control siRNA plasmid (Fig. 1D). To investigate whether CRHR2 activation affects [Ca2⫹]i, the effects of the CRHR2 exclusive agonist UCNII and antagonist astressin 2B on [Ca2⫹]i were examined, respectively. It was found that neither UCNII

E1854

You et al.



FIG. 1. CRH acts on CRHR1 to induce a Ca2⫹ transient in TL myometrial cells. Cells were treated with the indicated concentration of CRH and UCNII in the presence or absence of CRHR antagonists. [Ca2⫹]i was determined by Ca2⫹ imaging system using the fluorescent dye fura-2/AM. A, CRH induces a Ca2⫹ transient; left panel, representative trace shows Ca2⫹ transient induced by increasing concentration of CRH (10⫺10–10⫺7 M); right panel, summary histograms showing the effects of CRH (10⫺10–10⫺7 M) on [Ca2⫹]i in TL myometrial cells (n ⫽ 6 cultures). B, Effect of CRHR antagonists on CRH-induced calcium transient; left panel, representative trace showing the changes in [Ca2⫹]i induced by 10⫺8 M CRH in the presence of CRHR1 antagonist antalarmin or CRHR2 antagonist astressin 2B; right panel, summary histograms showing the effects of CRH (10⫺8 M) on [Ca2⫹]i in the presence of CRHR1 antagonist antalarmin (Anta) or CRHR2 antagonist astressin 2B (As2b) (n ⫽ 3 cultures). C, Representative bands shows CRH-R1 protein expression in myometrial cells transfected with CRHR1 siRNA plasmid or control siRNA plasmid. D, Effect of CRH on [Ca2⫹]i in cells transfected with CRHR1 siRNA plasmid and control siRNA plasmid; left panel, representative trace shows the changes in [Ca2⫹]i in response to CRH (10⫺8 M) in TL myometrial cells transfected with control siRNA plasmid and CRHR1 siRNA plasmid; right panel, summary histogram of CRH effect on [Ca2⫹]i in TL myometrial cells transfected with CRHR1 siRNA plasmid or control siRNA plasmid (n ⫽ 4 cultures). E, Effect of UCNII and CRHR2 antagonist astressin 2B on [Ca2⫹]i in TL myometrium cells; left panel, representative traces shows the effect of UCNII (10⫺10–10⫺7 M) and astressin 2B (10⫺10–10⫺7 M) on [Ca2⫹]i; right panel, summary histogram shows the effect of UCNII and astressin 2B on [Ca2⫹]i. Data are expressed as mean ⫾ SEM. *, P ⬍ 0.05; **, P ⬍ 0.01 compared with vehicle control. OT, Oxytocin.



E1855

FIG. 2. CRHR1 antagonist antalarmin induces a transient rise of [Ca2⫹]i in TNL myometrium cells. A, Effects of CRH (10⫺10–10⫺7 M) on [Ca2⫹]i in TNL myometrial cells; left panel, representative trace shows that CRH (10⫺10–10⫺7 M) has no effect on the calcium transient induced by [Ca2⫹]i and oxytocin (OT, 10⫺7 M) in TNL cells; right panel, summary histogram of CRH effect on [Ca2⫹]i (n ⫽ 4 cultures). B, Effects of antalarmin (Anta, 10⫺10–10⫺7 M) on [Ca2⫹]i in TNL myometrial cells; left panel, representative trace shows the effects of antalarmin on [Ca2⫹]i in TNL myometrial cells; right panel, summary histogram of antalarmin effect (n ⫽ 4 cultures). C, Changes in [Ca2⫹]i in response to antalarmin (10⫺8 M) in TNL myometrial cells transfected with control siRNA plasmid and CRHR1 siRNA plasmid; left panel, representative trace shows [Ca2⫹]i in response to antalarmin (10⫺8 M) in cells transfected with CRHR1 siRNA plasmid and control siRNA plasmid; right panel, summary histogram of antalarmin effects in TNL myometrial cells transfected with CRHR1 siRNA plasmid or control siRNA plasmid (n ⫽ 4 cultures). D, Effect of UCN II and CRHR2 antagonist astressin 2B (As2b) on [Ca2⫹]i in TNL myometrium cells; left panel, representative traces shows the effect of UCNII (10⫺10–10⫺7 M) and astressin 2B (10⫺10–10⫺7 M) on [Ca2⫹]i; right panel, summary histogram shows the effect of UCNII and astressin 2B on [Ca2⫹]i (n ⫽ 4). Data are expressed as mean ⫾ SEM. *, P ⬍ 0.05; **, P ⬍ 0.01 compared with vehicle control.

E1856

You et al.



FIG. 3. CRH stimulates Gi and Gq signaling pathways in TL myometrium cells. Cells were treated with CRH at the indicated concentration in absence or presence of antalarmin (Anta) or astressin 2B (As2b). Levels of GTP-bound Gi protein, GTP-bound Gs protein, and phosphorylated PLC␤3 (pPLC␤3) protein were analyzed as described in Materials and Methods. Concentrations of intracellular cAMP and IP3 were analyzed by RIA and ELISA, respectively. A and B, Effects of CRH on GTP-bound Gi protein (A) and GTP-bound Gs protein (B). Representative protein bands of GTPbound Gi protein and Gs protein are on the top of histograms (n ⫽ 3 cultures). C, Effect of CRH on cAMP production in TL cells (n ⫽ 4 cultures). D, Effect of CRH on phosphorylated PLC␤3 (pPLC␤3). Representative protein bands of pPLC␤3 are on the top of histograms (n ⫽ 3 cultures). E, Effect of CRH on intracellular IP3 concentration (n ⫽ 3 cultures). F, Effect of inhibitory peptide of Gq protein GP antagonist-2A on CRH-induced IP3 production. Cells were transfected with a small inhibitory peptide of Gq protein GP antagonist-2A or negative control peptide for 2 h and treated with CRH at the indicated doses for 10 min, and then levels of intracellular IP3 were analyzed by ELISA (n ⫽ 3 cultures). Data are expressed as mean ⫾ SEM. *, P ⬍ 0.05; **, P ⬍ 0.01 vs. vehicle control.

(10⫺10–10⫺7 M) nor astressin 2B (10⫺10–10⫺7 M) affected [Ca2⫹]i (Fig. 1E). Blockage of CRHR1 initiates a transient rise in [Ca2ⴙ]i in TNL myometrial cells Basal [Ca2⫹]i was 165.1 ⫾ 52.32 nM in TNL myometrial cells exposed to 50 mM Ca2⫹. There was a significant difference in basal [Ca2⫹]i between TL and TNL groups (P ⬍ 0.01, n ⫽ 10). Administration of increasing concentrations of CRH (10⫺10–10⫺7 M) did not affect [Ca2⫹]i in TNL cells (Fig. 2A). Oxytocin could induce a transient increase in [Ca2⫹]i in these cells (Fig. 2A). As shown in Fig 2B, application of CRHR1 antagonist antalarmin induced a transient increase in [Ca2⫹]i in a dose-dependent manner. The stimulatory effect of antalarmin on [Ca2⫹]i did not occur in CRHR1 knockdown cells (Fig. 2C). Administration of either CRHR2 antagonist astressin 2B or CRHR2 agonist UCNII did not affect the [Ca2⫹]i in TNL myometrial cells (Fig. 2D).

CRH activates Gq and Gi proteins as well as downstream signaling pathways in TL myometrial cells through CRHR1 Previous studies have indicated that CRHR could couple to multiple G␣ proteins including Gs, Gi, and Gq/11 and then go on to induce changes in AC activity and activation of PLC-␤3 (33, 34). We tested whether CRH activates Gs, Gi, and Gq/11 as well as their downstream signaling pathways. CRH (10⫺9–10⫺6 M) treatment resulted in a dosedependent increase in GTP-bound Gi protein but not GTP-bound Gs protein (Fig. 3, A and B). CRH was shown to decrease cAMP content in TL cells in a dosedependent manner. This effect was blocked by CRHR1 antagonist antalarmin but not CRHR2 antagonist astressin 2B (Fig. 3C). Because there is no commercial kit of Gq activation available, we examined the activation of PLC-␤3 and IP3, a production of PIP2 (phosphatidylinositol 4,5-bisphosphate) hydrolysis by PLC-␤3. As shown in Fig. 3, D and E, CRH treat-



E1857

antagonist as well as CRHR2 agonist. CRHR1 antagonist antalarmin decreased cAMP production in a dose-dependent manner, which was reversed by addition of CRH (Supplemental Fig 2B). The exclusive CRHR2 agonist UCNII showed an inhibitory effect on cAMP production in a dose-dependent manner (Supplemental Fig. 2C). To verify that CRHR1 activates the Gs-AC-cAMP signaling pathway, the effects of CRH on GTP-bound G␣s protein and cAMP production were examined in CRHR2 knockdown cells. Transfection of CRHR2 siRNA into cultured myometrial cells resulted in about 73% decrease in CRHR2 expression (Supplemental Fig. 3). CRH treatment stimulated GTP-bound Gs protein in a dose-dependent manner. The concentration of cAMP was significantly increased by CRH, which was FIG. 4. The roles of PLC-IP3 signaling pathway in the CRH-induced Ca2⫹ transient in TL blocked by antalarmin (Fig. 5, C and D). myometrium cells. Cells were treated with the indicated concentrations of CRH in presence or 2⫹ We also test whether CRH activates absence of PLC inhibitor U73122 or IP3 receptor antagonist 2APB. [Ca ]i was determined by a Ca2⫹ imaging system using the fluorescent dye fura-2/AM. A and C, Representative traces the PLC-IP3 signaling pathway in TNL showing the changes in [Ca2⫹]i in response to CRH (10⫺8 M) in presence of U73122(10⫺5 M) myometrial cells. Treatment of TNL or 2APB (10⫺5 M). B and D, Summary histogram showing the effects of U73122 and 2APB on cells with increasing concentration of 2⫹ CRH-induced Ca transient in TL myometrium cells. Data are expressed as mean ⫾ SEM. **, CRH resulted in an increase in the level P ⬍ 0.01 compared with vehicle control; n ⫽ 4 cultures. of phosphorylated PLC-␤3, but it did not affect the IP3 production in these ment showed to stimulate phosphorylated PLC-␤3, the cells (Fig. 5, E and F). active PLC-␤3, in a dose-dependent manner. CRH inAC activator forskolin and inhibitor SQ22536 were creased IP3 production, which was blocked by antalarmin used to examine the role of the AC-cAMP signaling pathbut not by astressin 2B. way in CRH regulation of [Ca2⫹]i homeostasis in TNL A small inhibitory peptide of Gq protein, GP antagomyometrial cells. As shown in Fig. 5, G and H, application nist-2A was used to examine whether CRH-induced IP3 of AC inhibitor SQ22536 mimicked the effect of antaproduction is dependent on Gq activation. Transfection of 2⫹ GP antagonist-2A into TL cells totally blocked the CRH- larmin, i.e. induced a transient increase in [Ca ]i. AC activator forskolin blocked antalarmin induced a traninduced IP3 production (Fig. 3F). 2⫹ Application of PLC inhibitor U73122 totally blocked sient rise of [Ca ]i. the CRH-induced transient increase in [Ca2⫹]i. Administration of IP3 receptor antagonist 2APB also blocked the CRH-induced calcium transient (Fig. 4).

Discussion

CRH acts on CRHR1to activate the Gs-AC-cAMP signaling pathway in TNL myometrial cells Treatment of the TNL myometrial cells with increasing concentration of CRH (10⫺9–10⫺6 M) caused an increase in GTP-bound Gs protein in a dose-dependent manner (Fig. 5A), but it did not affect the level of GTP-bound Gi protein (Fig. 5B). CRH treatment did not affect the cAMP concentration in cells (Supplemental Fig. 2A). To elucidate the role of CRHR1 in the regulation of cAMP production in TNL cells, we examined the effects of CRHR1

In this study, we demonstrated, for the first time, that CRH induced a transient rise in [Ca2⫹]i in TL myometrium, which was mediated by CRHR1. Blockage of CRHR1 with antalarmin resulted in a transient rise in [Ca2⫹]i in TNL myometrium. CRH activated Gq and Gi and then stimulated IP3 production through CRHR1, leading to an increase in [Ca2⫹]i in TL myometrium. In TNL myometrium, CRH acted on CRHR1 to activate the Gs-AC-cAMP signaling pathway and then inhibited IP3 production, leading to stabilization of [Ca2⫹]i.

E1858

You et al.



FIG. 5. CRH stimulates Gs-AC signaling pathway in TNL myometrium cells. A and B, Effects of CRH on GTP-bound Gs and Gi protein in TNL cells. Cells were treated with CRH at the indicated concentrations. Levels of GTP-bound Gs and Gi protein were determined as described in Materials and Methods (n ⫽ 3 cultures). Representative protein bands of GTP-bound Gs protein are on the top of histograms. C and D, Effects of CRH on the expression of GTP-bound Gs protein and cAMP production in TNL cells transfected with CRHR2 siRNA. Cells were transfected with CRHR2 siRNA as described in Materials and Methods. Cells were then treated with CRH at the indicated concentration for 5 min. Levels of GTP-bound Gs protein and the concentration of intracellular cAMP were determined (n ⫽ 3 cultures). Representative protein bands of GTP-bound Gs protein are on the top of histograms. E and F, Effect of CRH on phosphorylated PLC-␤ and IP3 production in TNL myometrium cells. Cells were treated with CRH at the indicated doses. The levels of phosphorylated PLC-␤3 (pPLC␤3) protein (E) and intracellular IP3 (F) were analyzed by Western blotting and ELISA, respectively. Representative protein bands of pPLC␤3 were on the top of histograms (n ⫽ 3 cultures). G, AC activator induces a calcium transient in TNL myometrium cells; left panel, representative trace showing that SQ22536 (10⫺5 M) induced a transient rise of [Ca2⫹]i; right panel, summary histogram of SQ22536 effect in TNL myometrium cells (n ⫽ 4 cultures). H, Effect of AC activator forskolin on antalarmin (Anta)-induced calcium transient; left panel, representative trace showing the changes in [Ca2⫹]i in response to antalarmin (10⫺8 M) in absence or presence of forskolin (10⫺5 M); right panel, summary histogram shows the effect of forskolin on antalarmin-induced Ca2⫹ transient in TNL myometrium cells (n ⫽ 4 cultures). Data are expressed as mean ⫾ SEM. *, P ⬍ 0.05, ** P ⬍ 0.01 compared with vehicle control.

The present study demonstrated that CRH had a differential effect on calcium signaling; i.e. it induced a calcium transient in TL but not in TNL myometrium. In addition, CRH induced only a calcium transient but not repetitive transient peaks of [Ca2⫹]i in TL myometrium. Consistent with these findings, the experiments of contractility demonstrated that CRH inhibited the spontaneous contractions in TNL but not TL myometrium (14), and it augmented oxytocin-induced phasic contractions in TL but not TNL myometrium (Supplemental Fig. 4). Human pregnant myometrial cells have been found to express CRH and its related peptides UCNI, UCNII, and UCNIII (31, 32, 35). CRH and UCNI can bind to both CRHR1 and CRHR2 (36), whereas UCNII and UCNIII exclusively bind CRHR2 (37, 38). The present study demonstrated that blockage of CRHR1 by antalarmin could induce a transient rise [Ca2⫹]i in TNL myometrium. Thus, it suggests that activation of CRHR1 by endogenous ligands such as CRH and UCNI might be important to maintain

the stabilization of [Ca2⫹]i in TNL myometrium. It seems that CRHR2 is not involved in regulation of [Ca2⫹]i homeostasis in both TNL and TL myometrium because both the specific CRHR2 agonist and antagonist did not affect [Ca2⫹]i. A previous study has indicated that CRHR2 is involved in the control of myometrial contractility by stimulation of myosin light chain (MLC20) phosphorylation (35). More recently, we have demonstrated that activation of the AC-cAMP-PKA signaling pathway inhibits phosphorylated PLC-␤3 (Ser 537), leading to a decrease in IP3 production and [Ca2⫹]i in vascular smooth muscle cells (39). Some studies have indicated that there is cross talk between the PKA and PLC signaling pathways in myometrial smooth muscle cells (27–29). Yue et al. (28) have demonstrated that PKA phosphorylates PLC-␤3 (Ser 1105) but not PLC-␤1 in myometrial cells, resulting in the inhibition of PLC-␤3 and a decrease in phosphatidylinositide turnover. Grammatopoulos (40) and Sanborn et al. (25) pro-


posed that regulation of CRHR1 signaling in myometrium might be through a self-regulatory mechanism in which cAMP-PKA causes an alteration in Gq-PLC-IP3 signaling via phosphorylating PLC-␤3 or through phosphorylation of Ser 301 in the third intracellular loop of CRHR1. In the present study, we demonstrated that CRH stimulated phosphorylated PLC-␤3 (Ser 537) but did not induce an increase in IP3 production in TNL myometrium. Although we did not determine whether PLC-␤3 (Ser 1105) is phosphorylated upon CRH treatment, we found that AC and PKA inhibitors increased IP3 production regardless of CRH treatment in TNL cells (Supplemental Fig 5). Thus, it is possible that CRH activation of the Gs-cAMP-PKA signaling pathway inhibits PLC-␤3, and an increase in IP3 production therefore does not occur. However, whether the AC-cAMP-PKA signaling pathway inhibits PLC-IP3 signaling in TNL myometrium remains to be verified. Previous studies have indicated that CRHR can activate multiple G proteins including Gs, Gi, Gq, Go, and Gz in myometrium (17, 31, 34). The present study also demonstrated that CRHR1 could link to multiple G proteins in human pregnant myometrium. In TL myometrium, CRHR1 induces Gq and Gi signaling pathways, whereas in TNL myometrium, it links Gs protein. CRH has higher affinity to CRHR1 than to CRHR2. However, we found that addition of exogenous CRH did not increase cAMP production in cultured TNL cells. Because human myometrial cells are able to synthesize and secrete CRH (32), our data that CRHR1 antagonist antalarmin decreased cAMP content suggest that CRHR1 activated by endog-


E1859

enous CRH might stimulate the AC-cAMP signaling pathway in TNL myometrium. In addition, we also found that CRHR2 agonist UCNII decreased cAMP production, which suggests that CRHR2 activation inhibits AC-cAMP signaling. Addition of exogenous CRH could act on CRHR2 besides bind CRHR1, which may lead to no significant change in cAMP production upon CRH treatment. Nevertheless, the detailed signaling pathway involved in CRHR2 activation should be defined in additional studies. Previous studies have implicated that the pattern of GP activation by CRHR appears to be altered as pregnancy progresses toward labor (17, 31, 34). The present study provided the direct evidence that CRHR1 links to different G proteins and activates different signaling pathways in TNL and TL myometrium. We propose that, before onset of parturition, CRHR1 mainly activates the Gs-AC-cAMP signaling pathway to promote quiescence of the uterus; after onset of labor, CRHR1 links to Gq and Gi proteins, which results in activation of PLC-IP3-Ca2⫹ signaling, thereby facilitating the contractions (Fig. 6). Throughout most of pregnancy, the myometrium remains in a relatively quiescent state, but it develops highly organized and powerful contractions with the onset of labor (2). The intracellular mechanisms underlying the transition of myometrium from a relative quiescence to a contractile state are not fully understood. The present study indicates that an alteration in intracellular signaling pathway of GP-coupled receptors is one of the intracellular mechanisms controlling the transition of the quiescent

FIG. 6. Scheme illustrating the proposed mechanism of CRH regulation of [Ca2⫹]i homeostasis in human pregnant myometrium before and during labor. Before onset of labor, CRHR1 primarily couples to Gs protein. When CRH binds to CRHR1, it stimulates the AC-cAMP-PKA signaling pathway, which inhibits PLC activity and IP3 production, thereby inhibiting Ca2⫹ release from sarcoplasmic reticulum (SR). After onset of labor, CRHR1 couples to G␣q and G␣i proteins. When CRH binds to CRHR1, it induces Gi and Gq signaling and then activates PLC activity, leading to generation of IP3 and diacylglycerol (DAG). IP3 then mobilizes Ca2⫹ release from the sarcoplasmic reticulum. PM, Plasma membrane.

E1860

You et al.


myometrial smooth muscle of pregnancy toward a state of coordinated contractility after the onset of labor. Targeting the signaling pathway of uteroactive factors would be the future approach for developing new tocolytic drugs. In conclusion, CRH acts on CRHR1 to induce different calcium signaling in nonlaboring and laboring human myometrium. Myometrial CRHR1 activates different G proteins before and after onset of labor. Before onset of labor, it activates the Gs-Ac-cAMP signaling to keep [Ca2⫹]i at a lower level, thereby promoting uterine quiescence. After onset of labor, CRHR1 activates Gq and Gi signaling pathways to increase [Ca2⫹]i, thereby facilitating uterine contractions.

Acknowledgments We thank the nursing and medical staff of the delivery suite and the patients in Changhai Hospital for their participation. Address all correspondence and requests for reprints to: Xin Ni, M.D., Ph.D., Department of Physiology, Second Military Medical University, 800 Xiangyin Road, Shanghai 200433, P.R. China. E-mail: [email protected]. This work was supported by the National Natural Science Foundation of China (30811120433 and 31101067) and Science and Technology Commission of Shanghai Municipals (09XD1405600). Disclosure Summary: The authors have nothing to disclose.

References 1. Smith R 2007 Parturition. N Engl J Med 356:271–283 2. Challis JRG, Matthews SG, Gibb W, Lye SJ 2000 Endocrine and paracrine regulation of birth at term and preterm. Endocr Rev 21: 514 –550 3. McLean M, Smith R 2001 Corticotrophin-releasing hormone and human parturition. Reproduction 121:493–501 4. Goland RS, Wardlaw SL, Blum M, Tropper PJ, Stark RI 1988 Biologically active corticotropin-releasing hormone in maternal and fetal plasma during pregnancy. Am J Obstet Gynecol 159:884 – 890 5. Sasaki A, Shinkawa O, Margioris AN, Liotta AS, Sato S, Murakami O, Go M, Shimizu Y, Hanew K, Yoshinaga K 1987 Immunoreactive corticotropin-releasing hormone in human plasma during pregnancy, labor, and delivery. J Clin Endocrinol Metab 64:224 –229 6. Goland RS, Wardlaw SL, Stark RI, Brown Jr LS, Frantz AG 1986 High levels of corticotropin-releasing hormone immunoactivity in maternal and fetal plasma during pregnancy. J Clin Endocrinol Metab 63:1199 –1203 7. McLean M, Bisits A, Davies J, Woods R, Lowry P, Smith R 1995 A placental clock controlling the length of human pregnancy. Nat Med 1:460 – 463 8. Warren WB, Patrick SL, Goland RS 1992 Elevated maternal plasma corticotropin-releasing hormone levels in pregnancies complicated by preterm labor. Am J Obstet Gynecol 166:1198 –1204; discussion 1204 –1207 9. Tropper PJ, Warren WB, Jozak SM, Conwell IM, Stark RI, Goland RS 1992 Corticotropin releasing hormone concentrations in umbilical cord blood of preterm fetuses. J Dev Physiol 18:81– 85 10. Makrigiannakis A, Semmler M, Briese V, Eckerle H, Minas V, My-

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.


lonas I, Friese K, Jeschke U 2007 Maternal serum corticotropinreleasing hormone and ACTH levels as predictive markers of premature labor. Int J Gynaecol Obstet 97:115–119 Leung TN, Chung TK, Madsen G, McLean M, Chang AM, Smith R 1999 Elevated mid-trimester maternal corticotrophin-releasing hormone levels in pregnancies that delivered before 34 weeks. Br J Obstet Gynaecol 106:1041–1046 Wadhwa PD, Porto M, Garite TJ, Chicz-DeMet A, Sandman CA 1998 Maternal corticotropin-releasing hormone levels in the early third trimester predict length of gestation in human pregnancy. Am J Obstet Gynecol 179:1079 –1085 Guendelman S, Kosa JL, Pearl M, Graham S, Kharrazi M 2008 Exploring the relationship of second-trimester corticotropin releasing hormone, chronic stress and preterm delivery. J Matern Fetal Neonatal Med 21:788 –795 Zhang LM, Wang YK, Hui N, Sha JY, Chen X, Guan R, Dai L, Gao L, Yuan WJ, Ni X 2008 Corticotropin-releasing hormone acts on CRH-R1 to inhibit the spontaneous contractility of non-labouring human myometrium at term. Life Sci 83:620 – 624 Simpkin JC, Kermani F, Palmer AM, Campa JS, Tribe RM, Linton EA, Poston L 1999 Effects of corticotrophin releasing hormone on contractile activity of myometrium from pregnant women. Br J Obstet Gynaecol 106:439 – 445 Tyson EK, Smith R, Read M 2009 Evidence that corticotropinreleasing hormone modulates myometrial contractility during human pregnancy. Endocrinology 150:5617–5625 Hillhouse EW, Grammatopoulos DK 2001 Control of intracellular signalling by corticotropin-releasing hormone in human myometrium. Frontiers of hormone research 27:66 –74 Aggelidou E, Hillhouse EW, Grammatopoulos DK 2002 Up-regulation of nitric oxide synthase and modulation of the guanylate cyclase activity by corticotropin-releasing hormone but not urocortin II or urocortin III in cultured human pregnant myometrial cells. Proc Natl Acad Sci USA 99:3300 –3305 Wray S, Jones K, Kupittayanant S, Li Y, Matthew A, Monir-Bishty E, Noble K, Pierce SJ, Quenby S, Shmygol AV 2003 Calcium signaling and uterine contractility. J Soc Gynecol Investig 10:252–264 Aguilar HN, Mitchell BF 2010 Physiological pathways and molecular mechanisms regulating uterine contractility. Hum Reprod Update 16:725–744 Fu X, Liu YJ, Ciray N, Olovsson M, Ulmsten U, Gylfe E 2000 Oxytocin-induced oscillations of cytoplasmic Ca2⫹ in human myometrial cells. Acta Obstet Gynecol Scand 79:174 –179 Barhoumi R, Awooda I, Mouneimne Y, Safe S, Burghardt RC 2006 Effects of benzo-a-pyrene on oxytocin-induced Ca2⫹ oscillations in myometrial cells. Toxicol Lett 165:133–141 Sanderson MJ, Bai Y, Perez-Zoghbi J 2010 Ca2⫹ oscillations regulate contraction of intrapulmonary smooth muscle cells. Adv Exp Med Biol 661:77–96 Fuchs AR 1995 Plasma, membrane receptors regulating myometrial contractility and their hormonal modulation. Semin Perinatol 19: 15–30 Sanborn BM, Ku CY, Shlykov S, Babich L 2005 Molecular signaling through G-protein-coupled receptors and the control of intracellular calcium in myometrium. J Soc Gynecol Investig 12:479 – 487 Sanborn BM 2001 Hormones and calcium: mechanisms controlling uterine smooth muscle contractile activity. The Litchfield Lecture. Exp Physiol 86:223–237 Dodge KL, Sanborn BM 1998 Evidence for inhibition by protein kinase A of receptor/G␣q /phospholipase C (PLC) coupling by a mechanism not involving PLC␤2. Endocrinology 139:2265–2271 Yue C, Dodge KL, Weber G, Sanborn BM 1998 Phosphorylation of serine 1105 by protein kinase A inhibits phospholipase C␤3 stimulation by G␣q. J Biol Chem 273:18023–18027 Yuan W, Lopez Bernal A 2007 Cyclic AMP signalling pathways in the regulation of uterine relaxation. BMC Pregnancy Childbirth 7(Suppl 1):S10 Grammatopoulos D, Milton NG, Hillhouse EW 1994 The human


31.

32.

33.

34.

35.

myometrial CRH receptor: G proteins and second messengers. Mol Cell Endocrinol 99:245–250 Grammatopoulos DK 2007 The role of CRH receptors and their agonists in myometrial contractility and quiescence during pregnancy and labour. Front Biosci 12:561–571 Xu C, Gao L, You X, Dai L, Li Y, Gu H, Slater DM, Olson DM, Ni X 2011 CRH acts on CRH-R1 and -R2 to differentially modulate the expression of large-conductance calcium-activated potassium channels in human pregnant myometrium. Endocrinology 152:4406 – 4417 Karteris E, Grammatopoulos D, Randeva H, Hillhouse EW 2000 Signal transduction characteristics of the corticotropin-releasing hormone receptors in the feto-placental unit. J Clin Endocrinol Metab 85:1989 –1996 Hillhouse EW, Grammatopoulos DK 2006 The molecular mechanisms underlying the regulation of the biological activity of corticotropin-releasing hormone receptors: implications for physiology and pathophysiology. Endocr Rev 27:260 –286 Karteris E, Hillhouse EW, Grammatopoulos D 2004 Urocortin II is expressed in human pregnant myometrial cells and regulates myosin light chain phosphorylation: potential role of the type-2 corticotro-


36.

37.

38.

39.

40.

E1861

pin-releasing hormone receptor in the control of myometrial contractility. Endocrinology 145:890 –900 Vaughan J, Donaldson C, Bittencourt J, Perrin MH, Lewis K, Sutton S, Chan R, Turnbull AV, Lovejoy D, Rivier C, et al 1995 Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropin-releasing factor. Nature 378:287–292 Lewis K, Li C, Perrin MH, Blount A, Kunitake K, Donaldson C, Vaughan J, Reyes TM, Gulyas J, Fischer W, Bilezikjian L, Rivier J, Sawchenko PE, Vale WW 2001 Identification of urocortin III, an additional member of the corticotropin-releasing factor (CRF) family with high affinity for the CRF2 receptor. Proc Natl Acad Sci USA 98:7570 –7575 Reyes TM, Lewis K, Perrin MH, Kunitake KS, Vaughan J, Arias CA, Hogenesch JB, Gulyas J, Rivier J, Vale WW, Sawchenko PE 2001 Urocortin II: a member of the corticotropin-releasing factor (CRF) neuropeptide family that is selectively bound by type 2 CRF receptors. Proc Natl Acad Sci USA 98:2843–2848 Wang S, Zhu X, Cong B, You X, Wang Y, Wang W, Ni X 2012 Estrogenic action on arterial smooth muscle: permissive for maintenance of CRHR2 expression. Endocrinology 153:1915–1924 Grammatopoulos DK 2012 Insights into mechanisms of corticotropin-releasing hormone receptor signal transduction. Br J Pharmacol 166:85–97