Crystal Structure of the Homologous-Pairing Domain from ... - Cell Press

Molecular Cell, Vol. 10, 359–371, August, 2002, Copyright 2002 by Cell Press

Crystal Structure of the Homologous-Pairing Domain from the Human Rad52 Recombinase in the Undecameric Form Wataru Kagawa,1,2 Hitoshi Kurumizaka,1,3 Ryuichiro Ishitani,2 Shuya Fukai,2 Osamu Nureki,2 Takehiko Shibata,4 and Shigeyuki Yokoyama1,2,3,5 1 RIKEN Genomic Sciences Center 1-7-22 Suehiro-cho, Tsurumi Yokohama 230-0045 2 Department of Biophysics and Biochemistry Graduate School of Science University of Tokyo 7-3-1 Hongo, Bunkyo-ku Tokyo 113-0033 3 Cellular Signaling Laboratory RIKEN Harima Institute at SPring-8 1-1-1 Kohto, Mikazuki-cho, Sayo Hyogo 679-5148 4 Cellular and Molecular Biology Laboratory RIKEN 2-1 Hirosawa, Wako Saitama 351-0198 Japan

Summary The human Rad52 protein forms a heptameric ring that catalyzes homologous pairing. The N-terminal half of Rad52 is the catalytic domain for homologous pairing, and the ring formed by the domain fragment was reported to be approximately decameric. Splicing variants of Rad52 and a yeast homolog (Rad59) are composed mostly of this domain. In this study, we determined the crystal structure of the homologous-pairing domain of human Rad52 and revealed that the domain forms an undecameric ring. Each monomer has a ␤-␤-␤-␣ fold, which consists of highly conserved amino acid residues among Rad52 homologs. A mutational analysis revealed that the amino acid residues located between the ␤-␤-␤-␣ fold and the characteristic hairpin loop are essential for ssDNA and dsDNA binding. Introduction Homologous pairing is the essential step of homologous recombination, involving searching for and pairing the homologous regions between single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA). The fundamental importance of this reaction is implicated in various cellular processes, such as recombinational repair (Kowalczykowski and Eggleston, 1994; Shinohara and Ogawa, 1995; Thompson and Schild, 2001), chromosome pairing in meiosis (Kleckner, 1996; Roeder, 1997), and break-induced replication (BIR) (Kogoma, 1996; Haber, 1999). Accordingly, the proteins that promote homologous pairing have significant importance for the integrity of the genome. The RecA protein plays a key role in prokaryotic re5

Correspondence: [email protected]

combination by promoting the pairing of two DNA molecules at homologous regions (McEntee et al., 1979; Shibata et al., 1979). In eukaryotes, homologs of RecA have been identified in many organisms, ranging from yeast to human. The yeast and human Rad51 proteins have about 40% sequence homology to RecA and have homologous-pairing activities in vitro that resemble those of the RecA protein (Sung, 1994; Baumann et al., 1996; Gupta et al., 1997). When bound to DNA, RecA and Rad51 form filamentous structures that have a characteristic helical appearance (Dunn et al., 1982; Flory et al., 1984; Ogawa et al., 1993; Benson et al., 1994). The DNA is thought to bind inside of the helical filament structure, where the length of the DNA is extended by about 50% as compared to that of the B form DNA (Flory et al., 1984; Egelman and Stasiak, 1986). This extended DNA structure is believed to be essential for an efficient homology search. Hence, the helical filament that supports the extended DNA is a fundamental structure shared by the class of homologous-pairing enzymes represented by RecA (Story et al., 1992). ssDNA-annealing proteins that lack sequence homology to the RecA protein also play essential roles in promoting the homologous pairing reaction. In particular, the E. coli RecT protein, which functions in a RecAindependent recombination pathway (Clark et al., 1993; Kusano et al., 1994; Muyrers et al., 2000), has homologous-pairing activities in vitro (Noirot and Kolodner, 1998). Analogous to the role of RecT in E. coli, the Rad52 protein, a recombination enzyme conserved among eukaryotic organisms, functions in the initial pairing steps of the Rad51-independent recombination processes (Lundblad and Blackburn, 1993; Rattray and Symington, 1994; Zou and Rothstein, 1997; Malkova et al., 1996). The Rad52 protein catalyzes the pairing between two homologous DNA sequences, as observed by ssDNA annealing (Mortensen et al., 1996; Reddy et al., 1997; Shinohara et al., 1998; Sugiyama et al., 1998) and homologous pairing (Kurumizaka et al., 1999; Kagawa et al., 2001). Furthermore, Rad52 serves as a mediator protein in the Rad51-dependent recombination reaction, where Rad52 is proposed to facilitate the loading of Rad51 onto the recombination site (Sung, 1997; Benson et al., 1998; New et al., 1998; Shinohara and Ogawa, 1998). Therefore, Rad52 plays two distinct roles in homologous pairing. The Rad52 proteins share about 70% sequence homology in their N-terminal halves (corresponding to the first 177 out of 418 amino acid residues of the human Rad52 protein). In contrast, the C-terminal halves of the Rad52 proteins share weak sequence homology and contain the Rad51- and RPA-interaction regions (amino acid residues 291-330 and 221-280, respectively, in the human Rad52 protein) (Shen et al., 1996; Park et al., 1996; Hays et al., 1998; Mer et al., 2000). Genetic studies have shown that deleting the Rad51 and RPA interacting regions of the yeast Rad52 protein partially impairs the recombination activities in vivo (Boundy-Mills and Livingston, 1993). Therefore, the N- and C-terminal halves of Rad52 play distinct roles.

Molecular Cell 360

Table 1. Crystallographic Statistics Data Collection Native ␭ (1.020 A˚) SeMet1 ␭1 (1.020 A˚, remote) ␭2 (0.9795 A˚, peak) ␭3 (0.9790 A˚, edge) SeMet2 ␭1 (1.020 A˚, remote) ␭2 (0.9795 A˚, peak) ␭3 (0.9790 A˚, edge)

Reflections Completeness Rsym I/␴(I) Resolution (A˚) (measured/unique) (%; overall/outer shell) (%; overall/outer shell) (overall/outer shell) 50.0-2.85

1,378,830/63,100

99.7/99.5

7.3/40.4

12.0/5.4

50.0-3.5 50.0-3.5 50.0-3.5

395,091/34,343 382,482/34,459 379,204/34,360

99.1/99.0 99.1/98.6 99.0/98.4

9.0/23.0 9.7/24.6 9.6/27.6

12.0/8.7 11.3/7.7 10.4/6.5

50.0-3.5 50.0-3.5 50.0-3.5

376,218/34,278 382,039/34,299 385,055/34,300

99.3/99.2 99.3/99.2 99.1/98.9

9.1/21.1 9.8/22.4 9.3/25.2

11.8/9.5 11.3/8.5 10.5/7.1

Phasing Overall figure of merit (50-3.5 A˚, acent/cent) SeMet1 0.543/0.512 SeMet2 0.538/0.501 Overall figure of merit (after phase combination, NCS averaging, and solvent flattening) 0.847 Refinement Resolution (A˚) 1 R-factor (overall/outer shell) 2 Rfree (overall/outer shell) total number of reflections used R.m.s. deviations Bond lengths (A˚) Bond angles (⬚) 1 2

50.0-2.85 23.0/33.6 29.7/40.9 61,963 0.008 1.25

R-factor ⫽ ⌺hkl|Fobs ⫺ Fcalc|/⌺hkl|Fobs|, where |Fobs| ⬎ 2␴. Rfree ⫽ ⌺hkl⌺T|Fobs ⫺ Fcalc|/⌺hkl⌺T|Fobs|, where the test set T includes 10% of the data.

The alternative splicing variants of the human Rad52 protein have been found to contain mostly the conserved N-terminal half (Kito et al., 1999). Yeasts addition-

ally carry the Rad59 protein (S. cerevisiae Rad59 consists of 238 amino acid residues, K. lactis Rad59 consists of 209 amino acid residues), which has signifi-

Figure 1. The Structure of Rad521-212 (A) Ribbon diagram of the undecameric ring of Rad521-212, viewed down the central channel from the top of the domed cap (Figure 2A). The eleven monomers, each colored differently, have a rotational symmetry axis that runs down the center of the ring. The diameter of the ring is about 120 A˚, and that of the central hole is about 25 A˚ at the narrowest point and 50 A˚ at the widest point. (B) A Rad521-212 monomer in (A) is viewed from the rotational 11-fold axis. The domed cap region is colored in blue and magenta, and the stem region is colored in gray. (C) The Rad521-212 monomer in (B) is viewed from the left.

Structure of the Human Rad52 Recombinase 361

Figure 2. The Side View and the Bottom View of the Mushroom-like Structure of the Undecameric Rad521-212 Ring (A and C) The domed cap region is colored in blue and magenta, and the stem region is colored in gray. (B and D) The solvent-accessible surface, colored according to the local electrostatic potential from ⫺12 kBT⫺1 (red) to ⫹12 kBT⫺1 (blue).

cant homology to the N-terminal half of Rad52 and overlapping functions with Rad52 (Bai and Symington, 1996; Petukhova et al., 1999; van den Bosch et al., 2001b). Therefore, two distinct types of Rad52 homologs, the longer and shorter types, exist in eukaryotic species. Others and ourselves have previously shown that the N-terminal domain of Rad52, which nearly corresponds to the shorter type, has the same DNA binding and homologous-pairing activities as those of the longer type of Rad52 (Ranatunga et al., 2001; Kagawa et al., 2001). Furthermore, in the presence of ssDNA, the fulllength Rad52 and the N-terminal domain both form filamentous complexes, with different appearances from the helical structures observed for the RecA-DNA and Rad51-DNA filaments (Kagawa et al., 2001). The Rad52 filaments are proposed to contain either stacked rings or rings arranged in a side-by-side manner (Kagawa et al., 2001).

From a structural point of view, Rad52 represents a class of multimeric ring-forming proteins, which includes RecT, the ␤ protein from bacteriophage ␭, and the erf protein from bacteriophage P22, despite the low sequence homology among these proteins (Thresher et al., 1995; Shinohara et al., 1998; Van Dyck et al., 1998; Passy et al., 1999; Stasiak et al., 2000). The longer type of Rad52 has been shown to form a heptameric ring by electron microscopy (EM) (Stasiak et al., 2000). On the other hand, the ring of the shorter type of Rad52 appears to exist in a larger oligomerization state, consisting of about ten monomers, as revealed by scanning transmission electron microscopy (STEM) and dynamic light scattering (DLS) (Ranatunga et al., 2001). Interestingly, the diameters of the longer and shorter types are similar, despite the difference in the oligomerization states. In the present study, we determined the crystal structure of the homologous-pairing domain of the human

Molecular Cell 362


Rad52 protein (amino acid residues 1-212, Rad521-212) and revealed that the shorter type of the Rad52 ring is an undecamer. A mutational analysis revealed that a positively charged site on the Rad521-212 monomer is essential for binding to ssDNA and dsDNA. The ring structure arranges the catalytic sites close to each other. Results and Discussion Structure Determination of Rad521-212 We previously reported the limited proteolysis of the human Rad52 protein, which suggested that a structurally stable domain is embedded within Rad521-237 (Kagawa et al., 2001). Based on this finding, a series of C-terminally truncated Rad52 mutants were tested for homologous-pairing activity and were screened for crystallization to obtain diffraction-quality crystals of the stable, homologous-pairing domain of Rad52. Of the truncated Rad52 mutants, the Rad52 fragment containing the N-terminal 212 amino acid residues (Rad521-212) maintained the wild-type level of homologous-pairing activity (Figure 6B) and yielded the best diffraction-quality crystals, allowing a structural determination at 2.85 A˚ resolution. The crystal structure of the human Rad521-212 protein was solved by the multi-wavelength anomalous dispersion (MAD) method, using crystals of the selenomethionine-substituted Rad521-212 (Table 1). Except for the N-terminal 24 amino acid residues and the C-terminal four amino acid residues, all of the amino acid residues were readily interpretable, indicating that amino acid residues 25-208 constitute the stable N-terminal domain of Rad52. The crystal structure of Rad521-212 reveals a closed ring consisting of eleven monomers, with a rotational axis running down the center of the ring (Figure 1A). The structure shows that the shorter type of Rad52 is an undecameric ring. The overall structure of the undecameric ring resembles a mushroom, consisting of a “stem” and a “domed cap” with a flat top (Figures 2A and 2C). Nearly half of the total monomer surface area is buried at the monomer-monomer interface (5706 A˚2 out of 12,817 A˚2 ). The Rad521-212 ring is 120 A˚ in diameter and 65 A˚ in height. The Stem Amino acid residues 79-156 of the Rad521-212 monomer make up the stem region of the ␤-␤-␤-␣ fold (Figure 3). This segment maps on the most highly conserved amino acid sequence of Rad521-212 (Figure 3A), suggesting that other Rad52 homologs, including Rad59, have this essential fold. In Rad521-212, eleven ␤-␤-␤-␣ folds associate with one another into a ring to form the stem (Figure 1A). The top portions of the ␤ sheets (residues 84-88, 111-115, and 119-122) from the ␤-␤-␤-␣ folds are aligned

side by side along the inner walls of the channel, forming a ␤ barrel-like structure. The sheets are connected by intermolecular hydrogen bonds between the backbone CO of His86 and the backbone NH of Glu122, between the backbone CO of Asp117 and the backbone NH of Phe26, and between the backbone NH of His86 and the backbone CO of Tyr120. Furthermore, Tyr81 in the L5 loop fits into the hydrophobic pocket (Tyr31, Tyr36, Ile39, Leu43, Leu115, and Phe158) formed by the neighboring monomer. Interestingly, ␤-␤-␤-␣ folds are present in a number of RNA and DNA binding proteins, such as RuvC, MuA transposase, RNase H, retroviral integrase, and Xlrbpa (Ariyoshi et al., 1994; Rice and Mizuuchi, 1995; Yang and Steitz, 1995; Ryter and Schultz, 1998). However, clear differences exist between these folds and the Rad521-212 ␤-␤-␤-␣ fold. The ␤ strands and the ␣ helix in the Rad521-212 ␤-␤-␤-␣ fold are about twice as long, and the surface is predominantly hydrophobic. The Domed Cap Amino acid residues flanking both ends of the ␤-␤-␤-␣ segment in the Rad521-212 sequence constitute the domed cap region with a flat top (Figure 3A). The N-terminal parts (colored in blue) and the C-terminal parts (colored in magenta) make up different portions of the domed cap (Figures 2A and 2C). In the Rad521212 monomer, two helices, ␣1 and ␣2, in the N-terminal part make hydrophobic contacts with the top portion of the ␤-␤-␤-␣ fold in the stem region. As a result, the segment between the two helices (L2, ␤1, L3, ␤2, and L4; residues 45-67) is fixed. In this segment, residues 52-66 (␤1, L3, and ␤2; Figure 3B) form a characteristic “lobe” (hairpin loop), which protrudes underneath the domed cap from each monomer (Figure 2A). On the other hand, the C-terminal part (L9, ␣4, L10, and ␣5; residues 157-205) stretches onto the neighboring monomer. The L10 loop interacts with the L2 loop of the neighboring monomer by hydrogen bonding between the backbone NH of Lys192 and the backbone CO of Arg46 and between the backbone CO of Lys192 and the backbone NH of Gly48. The importance of this region is supported by the insolubility of the Rad52 mutants lacking both L10 and ␣5 (Rad521-177 and Rad521-182). Furthermore, the mutants with L10 but lacking ␣5 (Rad521-192 and Rad521-202) were soluble but did not yield diffractionquality crystals. The ␣5 helix fits between two ␣1 helices from the neighboring monomers, and this alternating arrangement of ␣1 and ␣5 creates the entire top portion of the domed cap. A surface potential mapping of the Rad521-212 ring (Figures 2B and 2D) reveals a clear separation of the positively and negatively charged surfaces. The negative charges are concentrated at the top of the domed cap,

Figure 3. The Secondary Structure of the Rad521-212 Monomer (A) The conserved sequences of the N-terminal regions of Rad52 from human, mouse (Muris et al., 1994), chicken (Bezzubova et al., 1993), and yeast (Adzuma et al., 1984; Milne and Weaver, 1993; Ostermann et al., 1993; van den Bosch et al., 2001a), and also from Rad59 (Bai and Symington, 1996; van den Bosch et al., 2001b) are aligned with the secondary structure elements of Rad521-212. Conserved amino acid residues among these proteins are colored in orange. The secondary structure elements in the stem region are colored in gray and those in the N- and C-terminal parts of the domed cap region are colored in blue and in magenta, respectively. (B) Abbreviated topology diagram showing the fold of the Rad521-212 monomer. Rods and arrows indicate ␣ helices and ␤ strands, respectively.

Molecular Cell 364


near the channel of the ring. In contrast, most of the bottom half of the ring is positively charged. In particular, the region between the stem and the characteristic lobe (hairpin loop) in the Rad521-212 monomer is the most positively charged. This region is aligned outside of the ring and forms a positively charged surface (Figure 4A). Importantly, the central channel of the Rad521-212 ring does not contain any basic amino acid residues (Figure 2D). These observations suggest that Rad52 binds DNA along the outside of the ring, rather than within the central channel of Rad52. The DNA Binding Site To locate the precise ssDNA and dsDNA binding sites, we substituted alanine for the basic and aromatic residues that are located on the positively charged surface on the Rad521-212 monomer but are free of any interactions (Arg55, Tyr65, Tyr104, Lys141, Asp145, Lys152, Arg153, Arg156, Lys169, Arg173, Lys177, and Arg180) (Figures 4A and 4B). As shown in Figure 5A, ssDNA binding was affected significantly by mutations on the lobe (Arg55 and Tyr65), between the stem and the lobe (Lys152, Arg153, and Arg156), and moderately by one on ␣4 (Lys169) (Figure 4B). All of the other mutations, located on the bottom of the stem (Tyr104), on the stem surface (K141A and E145A), and on ␣4, which is at the outer edge of the domed cap (R173A, K177A, and R180A), had little or no effect on the ssDNA binding activity of Rad521-212 (Figures 4B and 5A). The mutant Rad521-212 proteins were then tested for their dsDNA binding abilities, using superhelical dsDNA as the substrate (Figure 5B). We compared the migration distances of Rad52-dsDNA complexes, which depend on the number of protein molecules bound to the dsDNA. The Y65A, R153A, R156A, and K169A mutants were moderately defective in dsDNA binding (Figure 5B). The R55A and K152A mutants were defective in binding ssDNA (Figures 5C and 5D), whereas these mutants were nearly proficient in dsDNA binding (Figures 5E and 5F). By contrast, the Y65A, R153A, and R156A mutants were moderately defective in both ssDNA and dsDNA binding activities (Figures 5C–5F). These results suggest that Arg55, Tyr65, Lys152, Arg153, and Arg156 are all essential for DNA binding. However, among these residues, Arg55 and Lys152 are required for ssDNA binding, while Tyr65, Arg153, and Arg156 are essential for both ssDNA and dsDNA binding. Thus, the ssDNA and dsDNA binding residues are clustered within the positively charged patch of a monomer (Figures 4C and 4D); however, the binding sites are not the same. Interestingly, a yeast Rad52 mutant, which was defective in intrachromosomal inverted repeat recombination, has an amino acid substitution at Arg70, corresponding to the Arg55 in the human Rad52 protein (Bai et al., 1999). Therefore,

the DNA binding mediated by Arg55 is likely to play a critical role in recombination. Ternary Complex Formation and Homologous Pairing We previously reported that the homologous pairing mediated by Rad52 is critically dependent on the order of DNA substrate addition (Kagawa et al., 2001). To test whether Rad52, ssDNA, and dsDNA form a ternary complex, 32P-labeled ssDNA and superhelical dsDNA were sequentially added to the reaction mixture containing Rad521-212. The resulting complexes were fixed with glutaraldehyde and were resolved by agarose gel electrophoresis. When ssDNA was added before dsDNA, ternary complexes with slower migration were detected above the Rad521-212-ssDNA complex (Figure 6A, lanes 6–10). However, when dsDNA was added before ssDNA, the formation of the ternary complexes was drastically impaired (Figure 6A, lanes 11–15). The dependency on the order of DNA substrate addition is also observed in the homologous pairing promoted by Rad521-212 (Figure 6B). These results indicate that the order of DNA substrate binding by Rad52 is critical for the efficient formation of the ternary complex, which is the intermediate of the homologous-pairing reaction. The interference of ssDNA binding by the prior dsDNA binding is consistent with the present structural and mutational analyses, showing that both the ssDNA and dsDNA binding sites are colocalized. The ssDNA may be sterically hindered from accessing its binding site when dsDNA is bound first by Rad52. The temperature factors of the amino acid residues in the lobe are higher than those of the stem residues, indicating that the lobe is rather flexible. The average distance between the stem and the lobe calculated from the crystal structure (about 10 A˚ at the widest point) could accommodate ssDNA but not dsDNA. Hence, this flexibility displayed by the lobe may play a role in accommodating the dsDNA. The Two Ring Forms of Rad52 Previous biophysical studies have shown that the fulllength Rad52 protein exists as a heptameric ring (Stasiak et al., 2000), while the isolated N-terminal domain of Rad52 forms a decamer or an undecamer (Ranatunga et al., 2001; Kagawa et al., 2001). To confirm this difference in the oligomerization state of Rad52 in solution, we performed analytical ultracentrifugation studies on the full-length Rad52 protein and Rad521-212. Consistent with the previous scanning transmission electron microscopy (STEM) and dynamic light scattering (DLS) analyses, the sedimentation equilibrium studies yielded an average molecular mass of the full-length Rad52 protein corresponding to a heptamer (Mr: 320,600 Da; Mr of monomer: 46,450 Da), and that of Rad521-212 corre-

Figure 4. The DNA Binding Groove of Rad52 (A) Stereo representation of a close-up view of the DNA binding groove. (B) Amino acid residues of Rad521-212 that were replaced with alanine for DNA binding studies. (C) Residues that affected the ssDNA binding and the dsDNA binding most severely are colored in gold and sky blue, respectively, and are mapped on the Rad521-212 ring, viewed from below. A Rad521-212 monomer is colored in magenta. (D) Stereo representation of the 2|Fo| - |Fc| electron density map of the labeled DNA binding residues shown in (C), contoured at 1.0 ␴.

Molecular Cell 366


Figure 6. Sedimentation Equilibrium of the Full-Length Rad52 (A) and Rad521-212 (B) Proteins For the molecular weight analysis, data were fit to an ideal, single component model. A model of the Rad52 heptameric ring, viewed from the top (C) and from an angle (D). The space between the top portions of the ␤ sheet in the stem could accommodate two ␤ strands (colored in red).

sponding to an undecamer (Mr: 260,800 Da; Mr of monomer: 23,682 Da) (Figures 6A and 6B). These results confirm the existence of two ring forms, a heptamer of

Rad52 and an undecamer of the N-terminal, homologous-pairing domain of Rad52. We then tried to model the heptameric ring form on

Figure 5. DNA Binding, Ternary Complex Formation, and D Loop Formation by Rad521-212 All assays were analyzed by 1% agarose gel electrophoresis. (A) ssDNA binding by Rad521-212 and its point mutants was analyzed by incubating 0.5, 1, 1.5, or 2 ␮M of the proteins with a 50-mer ssDNA (1 ␮M). (B) dsDNA binding by Rad521-212 and its point mutants was analyzed by incubating 0.5, 1, or 1.5 ␮M of the proteins with a negatively supercoiled plasmid DNA (15 ␮M, 3218 bp). Graphical representations of the ssDNA and dsDNA binding by the R55A and Y65A mutants (C and E) and by the K152A, R153A, and R156A mutants (D and F). Ternary complex (G) and D loop (H) formation by Rad521-212. The indicated amounts of Rad521-212 were preincubated with a 50-mer ssDNA (1 ␮M) for 6 min, followed by the addition of a superhelical dsDNA (15 ␮M, 3218 bp) to initiate the reaction. The order of the DNA substrate addition is switched in lanes 11–15 (G) and in lanes 6–10 (H).

Molecular Cell 368

the basis of the present structure of the undecameric ring form. When seven Rad521-212 monomers are spaced out into a ring with the same diameter as the undecameric ring of Rad521-212 (120 A˚) (Figure 6C), the distance between the ␤-␤-␤-␣ folds is increased by about 10 A˚. In the undecameric ring, three specific intermolecular hydrogen bonds are observed at the monomer-monomer interface that forms a ␤ barrel. If the monomermonomer interfaces in the heptameric form are composed of a ␤ barrel structure, then the distance between the ␤ sheets at the interface predicted from our model could accommodate two ␤ strands (Figure 6D). Our domain mapping of Rad52 by limited proteolysis suggests that the region up to the amino acid residue Ser346 contains a stably folded domain (Kagawa et al., 2001). The formation of ␤ strands around Gln221-Val222 and Val343 is suggested from secondary structure predictions of the Rad52 proteins. In addition, a segment of the N-terminal region (Val23 to Phe26), which is disordered in the crystal structure, is also predicted to form a ␤ strand. The N and the C termini of Rad521-212 are located near the monomer-monomer interface in the heptamer model (Figures 6C and 6D), suggesting that two of these putative ␤ strands may constitute the monomer-monomer interface of the heptameric Rad52. The heptameric and the undecameric ring forms could represent the oligomerization states displayed by the Rad52 homologs. While Rad52 exists as the heptamer, other Rad52 homologs, such as Rad59 and the Rad52 splicing variants, which correspond to the conserved N-terminal half of Rad52, may exist as the undecamers. Both ring forms are capable of promoting homologous pairing, as evidenced from the similar homologous-pairing activities of Rad52 and the isolated homologous-pairing domain of Rad52 (Kagawa et al., 2001). Therefore, the Rad52-dependent homologous pairing is mediated by the N-terminal amino acid residues (1-212), and the mechanism could be similar between the two ring forms. The C-terminal region of Rad52, which plays essential roles in the interactions with Rad51 and RPA, may be located near the DNA binding sites. The DNA binding sites on the monomers are more widely spaced in the modeled heptameric ring than in the undecameric ring. Therefore, the heptameric ring form of Rad52 might be more suitable for the transfer of DNA to Rad51 than the undecameric ring form. On the other hand, the Rad52 undecameric ring form found in the present study may be suited to perform homologous pairing without other factors. Experimental Procedures Purification of Rad52 The full-length and eleven C-terminally truncated forms of the human Rad52 protein (Rad521-247, Rad521-237, Rad521-227, Rad521-222, Rad521-217, Rad521-212, Rad521-207, Rad521-202, Rad521-192, Rad521-182, and Rad521-177) were overexpressed in the JM109(DE3) E. coli strain as hexahistidine-tagged recombinants, using the pET-15b expression system (Novagen). A plasmid containing the E. coli tRNAArg3 and tRNAArg4 genes, which recognize the CGG and AGA/AGG codons, respectively, was included to express these low-abundance tRNAs. Except for Rad521-182 and Rad521-177, which were completely insoluble, the other ten proteins were successfully purified in a three-step procedure (Ni-NTA agarose purification, hexahistidine-tag cleavage, and Heparin Sepharose purification) as described (Kagawa et al., 2001). For biochemical assays, the Rad52 proteins were dialyzed against

a buffer (pH 7.5) containing 20 mM Tris, 0.2 M KCl, 0.5 mM EDTA, 2 mM 2-mercaptoethanol, and 10% glycerol. For crystallization, Rad52 fractions from the Heparin Sepharose column were dialyzed against a buffer (pH 7.0) containing 10 mM Bis-Tris propane, 0.2 M KCl, 0.1 mM EDTA, and 2 mM 2-mercaptoethanol, and were concentrated to 3–3.5 mg/ml with a Centricon-30 concentrator (Millipore). Selenomethionine-substituted Rad521-212 was overexpressed in the B834(DE3) E. coli strain and was purified as described above. The pET-15b expression vectors for the twelve Rad521-212 point mutants (R55A, Y65A, Y104A, K141A, E145A, K152A, R153A, R156A, K169A, R173A, K177A, and R180A) were constructed using the QuikChange kit (Stratagene). All of the mutants were purified following the three-step procedure mentioned above.

Crystallization and Data Collection To facilitate the growth of Rad521-212 crystals, Rad521-212 (3-3.5 mg/ml) was mixed with an 8-mer ssDNA (GTTGGTTG) at a 14:1-11:1 molar ratio of protein to ssDNA on ice and was incubated overnight at 4⬚C. The following day, the Rad521-212 crystals were grown by the hanging drop method at 20⬚C. The hanging drop was formed by mixing 1 ␮l of a solution containing 12% polyethylene glycol (PEG) 5000 monomethyl ether (MME), 80 mM ammonium sulfate, 20 mM betaine monohydrate or urea, and 40 mM sodium cacodylate (pH 6.2) with 2 ␮l of the Rad521-212-ssDNA mixture. The reservoir solution contained 15% PEG 5000 MME, 0.1 M ammonium sulfate, and 50 mM sodium cacodylate (pH 6.2). Crystals typically appeared within 12 hr to 1 day and reached the maximum size (0.1 mm ⫻ 0.2 mm ⫻ 0.3 mm) within 3 days. The Rad521-212 crystals were briefly suspended in reservoir solution that was diluted 3-fold with water, prior to cryo-protection. The crystals were then dialyzed against a cryo-protectant containing 15% ethylene glycol, 5% PEG 5000 MME, 33 mM ammonium sulfate, and 17 mM sodium cacodylate (pH 6.2) for 30 min, followed by another 30 min dialysis with the same solution, except with 30% ethylene glycol. The Rad521-212 crystals were flash frozen in a stream of N2 gas (100 K). Data sets of both the native and selenomethionine derivative crystals were collected at the RIKEN beamline I (BL45XU) at the 8 GeV Super Photon ring (SPring-8) in Harima, Japan. The data were reduced by the DENZO and SCALEPACK programs (Otwinoski and Minor, 1997). In both the native and selenomethionine-substituted Rad521-212 crystals (space group P43212; a ⫽ b ⫽ 145.6 A˚, c ⫽ 247.5 A˚), one Rad521-212 ring was present in the asymmetric unit cell.

Structure Determination and Refinement For structural determination, three data sets from three different crystals, one native and two selenomethionine derivatives, were used. The selenium site at Met78 was initially found by the direct method program, SnB (Weeks and Miller, 1999). The initial phases from the two selenomethionine data sets were separately determined at 3.5 A˚ resolution using the SHARP program (La Fortelle and Bricogne, 1997), and the electron density maps were solvent flattened by the SOLOMON program (CCP4, 1994). The two phases were then combined using the program SIGMAA. Further density modification of the resulting map was performed, which involved solvent flattening and 11-fold non-crystallographic symmetry (NCS) averaging, using the DM program (Cowtan, 1994). Until the complete main chain tracing was possible, iterative rounds of model building with the O program (Jones et al., 1991) and energy minimization refinement and simulated annealing with the CNS program (Brunger et al., 1998) were performed. The selenium site at Met66 was visible in the electron density map, while the selenium sites at Met1 and Met212 were disordered and were excluded from the final model. All refinements up to this point included 11-fold NCS restraints with the weight set at 300 kcal mol⫺1 A˚⫺2. The final rounds of refinement were done with the combination of energy minimization refinement and group B factor refinement, where the weight of NCS was gradually reduced from 300 to 50 kcal mol⫺1 A˚⫺2. The final model contains 15,961 atoms of the Rad521-212 undecamer and 82 water molecules. The Ramachandran plot of the final structure showed 88.6% of the residues in the most favorable regions and 11.4% of the residues in the additionally allowed regions. Graphic figures were created using the RIBBONS (Carson, 1991) and SPOCK programs.


Assay for DNA Binding All reaction mixtures contained final concentrations of 50 mM Hepes-KOH (pH 7.5), 50 mM KCl, 1 mM MgCl2, 0.1 mg/ml BSA, 1 mM 2-mercaptoethanol, and 2% glycerol. For the ssDNA binding assay, one volume of the 32P-labeled SAT-1 ssDNA (10 ␮M; 5⬘ ATTT CATGCTAGACAGAAGAATTCTCAGTAACTTCTTTGTGCTGTGTGTA 3⬘) was mixed with nine volumes of the nonlabeled SAT-1 ssDNA (10 ␮M) to dilute the 32P label 10-fold. The indicated amounts of Rad521-212 proteins were incubated with 1 ␮M of SAT-1 ssDNA for 6 min at 37⬚C. Rad521-212-ssDNA complexes were then fixed with 0.2% glutaraldehyde for 20 min. Complexes were resolved by 1% agarose gel electrophoresis in 0.5⫻ TBE buffer at 3.3 V/cm for 2.5 hr, and were visualized by autoradiography of the dried gel. Products and reactants were quantified using a Fuji BAS2500 image analyzer. For the dsDNA binding assay, 15 ␮M of pGsat4 dsDNA (3218 bp) was incubated with the indicated amounts of Rad521-212 proteins for 6 min at 37⬚C. Complexes were resolved by 1% agarose gel electrophoresis in 0.5⫻ TBE buffer at 3.3 V/cm for 2.5 hr and were visualized by ethidium bromide staining. All DNA concentrations are expressed in moles of nucleotides. Assay for Ternary Complex and D Loop Formation The reaction mixture and the DNA substrates used for ternary complex and D loop formation were essentially identical to those used in the DNA binding assays, to facilitate comparisons of the results. For the ternary complex formation assay, the 32P-labeled SAT-1 ssDNA was mixed with nonlabeled SAT-1 ssDNA, as described above. For the D loop formation assay, the 32P-labeled SAT-1 ssDNA was directly used. Both assays were started by incubating the indicated amounts of Rad521-212 and 1 ␮M of SAT-1 ssDNA for 6 min at 37⬚C. The pGsat4 dsDNA (15 ␮M) was then added, and the incubation was continued for 12 min. To observe the ternary complexes, glutaraldehyde was added to a final concentration of 0.2%, and the reactions were incubated for 20 min. To observe the D loops, 1 ␮l of 5% SDS followed by 1 ␮l of 6 mg/ml proteinase K were added, and the reactions were incubated for 15 min. Both products were resolved by 1% agarose gel electrophoresis in 0.5⫻ TBE buffer at 3.3 V/cm for 2.5 hr. The complexes were visualized by autoradiography of the dried gel. Analytical Ultracentrifugation Sedimentation equilibrium experiments were performed in a Beckman Optima XL-I instrument. The full-length Rad52 and Rad521-212 proteins were spun in two separate 6-sector centerpieces, using a Beckman An-60Ti rotor. Both proteins were dialyzed against a buffer (pH 7.5) containing 50 mM Tris, 0.2 M KCl, 0.5 mM EDTA, 2 mM 2-mercaptoethanol, and 10% glycerol. Prior to centrifugation, dynamic light scattering analyses on both samples were performed (at 20⬚C), and judged to be uniform. Protein concentrations of the full-length Rad52 protein and Rad521-212 loaded into the cell were 0.2 mg/ml and 0.5 mg/ml, respectively. Equilibrium distributions were analyzed after 17 hr of centrifugation at 10,000 rpm and at 20⬚C. For the molecular weight analysis, partial specific volume and solution density values of 0.74 cm3/g and 1.05 g/cm3, respectively, were used. Acknowledgments We thank A. Kagawa and K. Eda for help with protein preparations, S. Sekine and K. Kurimoto for help with collecting diffraction data, Y. Kawano, T. Kumasaka, M. Yamamoto, and N. Kamiya for technical assistance at the BL45XU beamline at SPring-8, S.-Y. Park and H. Yamaguchi for help with the structure determination and refinement, K. Satou and Y. Matsuo for the structural comparison of HsRad521-212, Y. Isogai for technical assistance with the analytical ultracentrifugation, and T. Kinebuchi, R. Rothstein, and L. Symington for helpful discussions and critical reading of the manuscript. This work was supported by the Bioarchitect Research Program (RIKEN), CREST of JST (Japan Science and Technology), and by the Ministry of Education, Sports, Culture, Science, and Technology of Japan. Received: February 1, 2002 Revised: June 3, 2002

References Adzuma, K., Ogawa, T., and Ogawa, H. (1984). Primary structure of the RAD52 gene in Saccharomyces cerevisiae. Mol. Cell. Biol. 4, 2735–2744. Ariyoshi, M., Vassylyev, D.G., Iwasaki, H., Nakamura, H., Shinagawa, H., and Morikawa, K. (1994). Atomic structure of the RuvC resolvase: a Holliday junction-specific endonuclease from E. coli. Cell 78, 1063– 1072. Bai, Y., and Symington, L.S. (1996). A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae. Genes Dev. 10, 2025–2037. Bai, Y., Davis, A.P., and Symington, L.S. (1999). A novel allele of RAD52 that causes severe DNA repair and recombination deficiencies only in the absence of RAD51 or RAD59. Genetics 153, 1117– 1130. Baumann, P., Benson, F.E., and West, S.C. (1996). Human Rad51 protein promotes ATP-dependent homologous pairing and strand transfer reactions in vitro. Cell 87, 757–766. Benson, F.E., Stasiak, A., and West, S.C. (1994). Purification and characterization of the human Rad51 protein, an analogue of E. coli RecA. EMBO J. 13, 5764–5771. Benson, F.E., Baumann, P., and West, S.C. (1998). Synergistic actions of Rad51 and Rad52 in recombination and DNA repair. Nature 391, 401–404. Bezzubova, O., Schmidt, H., Ostermann, K., Heyer, W.-D., and Buerstedde, J.-M. (1993). Identification of chicken RAD52 homologue suggests conservation of the RAD52 recombination pathway throughout the evolution of higher eukaryotes. Nucleic Acids Res. 21, 5945–5949. Boundy-Mills, K.L., and Livingston, D.M. (1993). A Saccharomyces cerevisiae RAD52 allele expressing a C-terminal truncation protein: activities and intragenic complementation of missense mutations. Genetics 133, 39–49. Brunger, A.T., Adams, P.D., Clore, G.M., DeLano, W.L., Gros, P., Grosse-Kunstleve, R.W., Jiang, J.-S., Kuszewski, J., Nilges, M., Pannu, N.S., et al. (1998). Crystallography and NMR system: a new software suite for macromolecular structure determination. Acta Crystallogr. D 54, 904–925. Carson, M. (1991). Ribbons 2.0. J. App. Crystallogr. 24, 958–961. CCP4 (Collaborative Computing Project 4) (1994). The CCP4 suite: programs for X-ray crystallography. Acta Crystallogr. D 50, 760–763. Clark, A.J., Sharma, V., Brenowitz, S., Chu, C.C., Sandler, S., Satin, L., Templin, A., Berger, I., and Cohen, A. (1993). Genetic and molecular analyses of the C-terminal region of the recE gene from the Rac prophage of Escherichia coli K-12 reveal the recT gene. J. Bacteriol. 175, 7673–7682. Cowtan, K. (1994). DM: an automated procedure for phase improvement by density modification. CCP4/ESF-EACBM Newsletter on Protein Crystallography, 34–38. Dunn, K., Chrysogelos, S., and Griffith, J. (1982). Electron microscopic visualization of recA-DNA filaments: evidence for a cyclic extension of duplex DNA. Cell 28, 757–765. Egelman, E.H., and Stasiak, A. (1986). Structure of helical RecA-DNA complexes. Complexes formed in the presence of ATP-gamma-S or ATP. J. Mol. Biol. 191, 677–697. Flory, J., Tsang, S.S., and Muniyappa, K. (1984). Isolation and visualization of active presynaptic filaments of recA protein and singlestranded DNA. Proc. Natl. Acad. Sci. USA 81, 7026–7030. Gupta, R.C., Bazemore, L.R., Golub, E.I., and Radding, C.M. (1997). Activities of human recombination protein Rad51. Proc. Natl. Acad. Sci. USA 94, 463–468. Haber, J.E. (1999). DNA recombination: the replication connection. Trends Biochem. Sci. 24, 271–275. Hays, S.L., Firmenich, A.A., Massey, P., Banerjee, R., and Berg, P. (1998). Studies of the interaction between RAD52 protein and the yeast single-stranded DNA binding protein RPA. Mol. Cell. Biol. 18, 4400–4406. Jones, T.A., Zou, J.-Y., Cowan, S.W., and Kjeldgaard, M. (1991).

Molecular Cell 370

Improved methods for building protein models in electron density maps and the location of errors in these models. Acta Crystallogr. A 47, 110–119. Kagawa, W., Kurumizaka, H., Ikawa, S., Yokoyama, S., and Shibata, T. (2001). Homologous pairing promoted by the human Rad52 protein. J. Biol. Chem. 276, 35201–35208. Kito, K., Wada, H., Yeh, E.T.H., and Kamitani, T. (1999). Identification of novel isoforms of human RAD52. Biochim. Biophys. Acta 1489, 303–314. Kleckner, N. (1996). Meiosis: how could it work? Proc. Natl. Acad. Sci. USA 93, 8167–8174. Kogoma, T. (1996). Recombination by replication. Cell 85, 625–627. Kowalczykowski, S.C., and Eggleston, A.K. (1994). Homologous pairing and DNA strand-exchange proteins. Annu. Rev. Biochem. 63, 991–1043. Kurumizaka, H., Aihara, H., Kagawa, W., Shibata, T., and Yokoyama, S. (1999). Human Rad51 amino acid residues required for Rad52 binding. J. Mol. Biol. 291, 537–548. Kusano, K., Takahashi, N.K., Yoshikura, H., and Kobayashi, I. (1994). Involvement of RecE exonuclease and RecT annealing protein in DNA double-strand break repair by homologous recombination. Gene 138, 17–25. La Fortelle, E., and Bricogne, G. (1997). Maximum-likelihood heavyatom parameter refinement for multiple isomorphous replacement and multiwavelength anomalous diffraction methods. Methods Enzymol. 276, 472–494.

Park, M.S., Ludwig, D.L., Stigger, E., and Lee, S.-H. (1996). Physical interaction between human RAD52 and RPA is required for homologous recombination in mammalian cells. J. Biol. Chem. 271, 18996– 19000. Passy, S.I., Xiong, Y., Zhufang, L., Radding, C.M., and Egelman, E.H. (1999). Rings and filaments of ␤ protein from bacteriophage ␭ suggest a superfamily of recombination proteins. Proc. Natl. Acad. Sci. USA 96, 4279–4284. Petukhova, G., Stratton, S.A., and Sung, P. (1999). Single strand DNA binding and annealing activities in the yeast recombination factor Rad59. J. Biol. Chem. 274, 33839–33842. Ranatunga, W., Jackson, D., Lloyd, J.A., Forget, A.L., Knight, K.L., and Borgstahl, G.E. (2001). Human Rad52 exhibits two modes of self-association. J. Biol. Chem. 276, 15876–15880. Rattray, A.J., and Symington, L.S. (1994). Use of a chromosomal inverted repeat to demonstrate that the RAD51 and RAD52 genes of Saccharomyces cerevisiae have different roles in mitotic recombination. Genetics 138, 587–595. Reddy, G., Golub, E.I., and Radding, C.M. (1997). Human Rad52 protein promotes single-strand DNA annealing followed by branch migration. Mutat. Res. 377, 53–59. Rice, P., and Mizuuchi, K. (1995). Structure of the bacteriophage Mu transposase core: a common structural motif for DNA transposition and retroviral integration. Cell 82, 209–220. Roeder, G.S. (1997). Meiotic chromosomes: it takes two to tango. Genes Dev. 11, 2600–2621.

Lundblad, V., and Blackburn, E.H. (1993). An alternative pathway for yeast telomere maintenance rescues est1-senescence. Cell 73, 347–360.

Ryter, J.M., and Schultz, S.C. (1998). Molecular basis of doublestranded RNA-protein interactions: structure of a dsRNA-binding domain complexed with dsRNA. EMBO J. 17, 7505–7513.

Malkova, A., Ivanov, E.L., and Haber, J.E. (1996). Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication. Proc. Natl. Acad. Sci. USA 93, 7131–7136.

Shen, Z., Cloud, K.G., Chen, D.J., and Park, M.S. (1996). Specific interactions between the human RAD51 and RAD52 proteins. J. Biol. Chem. 271, 148–152.

McEntee, K., Weinstock, G.M., and Lehman, I.R. (1979). Initiation of general recombination catalyzed in vitro by the recA protein of Escherichia coli. Proc. Natl. Acad. Sci. USA 76, 2615–2619. Mer, G., Bochkarev, A., Gupta, R., Bochkareva, E., Frappier, L., Ingles, C.J., Edwards, A.M., and Chazin, W.J. (2000). Structural basis for the recognition of DNA repair proteins UNG2, XPA, and RAD52 by replication factor RPA. Cell 103, 449–456. Milne, G.T., and Weaver, D.T. (1993). Dominant negative alleles of RAD52 reveal a DNA repair/recombination complex including Rad51 and Rad52. Genes Dev. 7, 1755–1765. Mortensen, U.H., Bendixen, C., Sunjevaric, I., and Rothstein, R. (1996). DNA strand annealing is promoted by the yeast Rad52 protein. Proc. Natl. Acad. Sci. USA 93, 10729–10734. Muris, D.F.R., Bezzubova, O., Buerstedde, J.-M., Vreeken, K., Balajee, A.S., Osgood, C.J., Troelstra, C., Hoeijmakers, J.H.J., Ostermann, K., Schmidt, H., et al. (1994). Cloning of human and mouse genes homologous to RAD52, a yeast gene involved in DNA repair and recombination. Mutat. Res. 315, 295–305. Muyrers, J.P.P., Zhang, Y., Buchholz, F., and Stewart, A.F. (2000). RecE/RecT and Redalpha/Redbeta initiate double-stranded break repair by specifically interacting with their respective partners. Genes Dev. 14, 1971–1982. New, J.H., Sugiyama, T., Zaitseva, E., and Kowalczykowski, S.C. (1998). Rad52 protein stimulates DNA strand exchange by Rad51 and replication protein A. Nature 391, 407–410. Noirot, P., and Kolodner, R.D. (1998). DNA strand invasion promoted by Escherichia coli RecT protein. J. Biol. Chem. 273, 12274–12280. Ogawa, T., Yu, X., Shinohara, A., and Egelman, E.H. (1993). Similarity of the yeast RAD51 filament to the bacterial RecA filament. Science 259, 1896–1899. Ostermann, K., Lorentz, A., and Schmidt, H. (1993). The fission yeast rad22 gene, having a function in mating-type switching and repair of DNA damages, encodes a protein homolog to Rad52 Saccharomyces cerevisiae. Nucleic Acids Res. 21, 5940–5944. Otwinoski, Z., and Minor, W. (1997). Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 276, 307–326.

Shibata, T., DasGupta, C., Cunningham, R.P., and Radding, C.M. (1979). Purified Escherichia coli recA protein catalyzes homologous pairing of superhelical DNA and single-stranded fragments. Proc. Natl. Acad. Sci. USA 76, 1638–1642. Shinohara, A., and Ogawa, T. (1995). Homologous recombination and the roles of double-strand breaks. Trends Biochem. Sci. 20, 387–391. Shinohara, A., and Ogawa, T. (1998). Stimulation by Rad52 of yeast Rad51-mediated recombination. Nature 391, 404–407. Shinohara, A., Shinohara, M., Ohta, T., Matsuda, S., and Ogawa, T. (1998). Rad52 forms ring structures and co-operates with RPA in single-strand DNA annealing. Genes Cells 3, 145–156. Stasiak, A.Z., Larquet, E., Stasiak, A., Muller, S., Engel, A., Van Dyck, E., West, S.C. and Egelman E.H. (2000). The human Rad52 protein exists as a heptameric ring. Curr. Biol. 10, 337–340. Story, R.M., Weber, I.T., and Steitz, T.A. (1992). The structure of the E. coli recA protein monomer and polymer. Nature 355, 318–325. Sugiyama, T., New, J.H., and Kowalczykowski, S.C. (1998). DNA annealing by RAD52 protein is stimulated by specific interaction with the complex of replication protein A and single-stranded DNA. Proc. Natl. Acad. Sci. USA 95, 6049–6054. Sung, P. (1994). Catalysis of ATP-dependent homologous DNA pairing and strand exchange by yeast RAD51 protein. Science 265, 1241–1243. Sung, P. (1997). Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. J. Biol. Chem. 272, 28194–28197. Thompson, L.H., and Schild, D. (2001). Homologous recombinational repair of DNA ensures mammalian chromosome stability. Mutat. Res. 477, 131–153. Thresher, R.J., Makhov, A.M., Hall, S.D., Kolodner, R., and Griffith, J.D. (1995). Electron microscopic visualization of RecT protein and its complexes with DNA. J. Mol. Biol. 254, 364–371. van den Bosch, M., Vreeken, K., Zonneveld, J.B.M., Brandsma, J.A., Lombaerts, M., Murray, J.M., Lohman, P.H.M., and Pastink, A. (2001a). Characterization of RAD52 homologs in the fission yeast Schizosaccharomyces pombe. Mutat. Res. 461, 311–323.


van den Bosch, M., Zonneveld, J.B., Lohman, P.H., and Pastink, A. (2001b). Isolation and characterization of the RAD59 homologue of Kluyveromyces lactis. Curr. Genet. 39, 305–310. Van Dyck, E., Hajibagheri, N.M., Stasiak, A., and West, S.C. (1998). Visualisation of human Rad52 protein and its complexes with hRad51 and DNA. J. Mol. Biol. 284, 1027–1038. Weeks, C.M., and Miller, R. (1999). The design and implementation of SnB v2.0. J. Appl. Crystallogr. 32, 120–124. Yang, W., and Steitz, T.A. (1995). A. Recombining the structures of HIV integrase, RuvC, and RNaseH. Structure 3, 131–134. Zou, H., and Rothstein, R. (1997). Holliday junctions accumulate in replication mutants via a RecA homolog-independent mechanism. Cell 90, 87–96. Accession Numbers The atomic coordinates of the Rad521-212 undecameric ring have been deposited in the RCSB Protein Data Bank with the accession code 1KN0.