Cyclic AMP regulation of the human glycoprotein hormone a ... - PNAS

Proc. Nati. Acad. Sci. USA Vol. 84, pp. 2198-2202, April 1987 Biochemistry

Cyclic AMP regulation of the human glycoprotein hormone a-subunit gene is mediated by an 18-base-pair element (gene regulation/chorionic gonadotropin/cAMP response element/enhancer)

BERNARD J. SILVER*t, JOSEPH A. BOKARt, JEFFREY B. VIRGINt, ELIZABETH A.

VALLENO§, AMY MILSTEDt,

AND JOHN H. NILSON$¶ Departments of *Pharmacology and *Medicine, School of Medicine, Case Western Reserve University, and tCleveland Veterans Administration, Cleveland, OH 44106

Communicated by Frederick C. Robbins, December 18, 1986

response element functions independently of other promoter regulatory elements.

cAMP regulates transcription of the gene ABSTRACT encoding the a-subunit of human chorionic gonadotropin (hCG) in choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, we inserted fragments from the 5' flanking region of the a-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between positions -146 and -111. In the absence of cAMP, the a-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. We localized this enhancer activity to the same -169/- 100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the a-subunit gene.

PROCEDURES Construction of Vectors. Construction of the expression vector pHaCAT (Fig. 1A) was initiated by isolating a 1500-bp DNA fragment from the genomic clone of the human asubunit gene provided by J. Fiddes (6). This subfragment extends from an EcoRI site in the 5' flanking region (-1500) to the BamHI site (+44) within the 5' untranslated region. HindIII linkers (P-L Biochemicals) were attached, and the fragment was inserted into the HindIII site of pSV0CAT (7). To construct pXSV1CAT (Fig. 1B), we excised the 72-bp repeats of pSV2CAT (7) with Acc I and Sph I and blunted the ends with T4 DNA polymerase. The vector was then ligated in the presence of Xba I linkers, resulting in the replacement of an Sph I site at position 128 in the simian virus 40 (SV40) early promoter region (8) with an Xba I site. The 1500-bp a-subunit fragment, or subfragments generated by Sau I and Rsa I (positions -169 and -99, respectively), was inserted into either the Xba I site at the 5' end or the BamHI site at the 3' end of the chloramphenicol acetyltransferase (CAT) gene. An oligodeoxynucleotide corresponding to the 18-bp sequence between positions -129 and -111 of the a-subunit gene and containing Xba I-compatible ends was synthesized. One to three copies of the element were ligated into the Xba I site of pXSV1CAT. Orientations of all inserts were determined either by restriction mapping or by dideoxy sequencing of supercoiled plasmid (9). Cell Culture and Transfection. BeWo cells were grown in Hams F12(K) medium containing 15% fetal calf serum, penicillin at 50 units/ml, and streptomycin at 50 pkg/ml. For transfection, cells were plated at a density of 3 x 106 cells per 100-mm dish 24 hr prior to the addition of the calcium phosphate-DNA precipitate (7). Ten micrograms of plasmid DNA was transfected per 100-mm dish. The cells were exposed to the precipitated DNA for 18 hr. In an attempt to minimize variation in transfection efficiencies, the transfected cells were subcultured in equal aliquots into 60-mm dishes and were allowed to attach for 24 hr. Either fresh medium or medium containing 1 mM 8-bromo-cAMP (Sigma) was then added. After an additional 16 hr, cells were harvested and lysates were prepared by freeze-thawing (7) because CAT activity in the lysates is maximal at this time (data not shown).

Human chorionic gonadotropin (hCG) is a heterodimeric glycoprotein hormone expressed in the placenta. Both the a-subunit and the P-subunit are required for biological activity (1). While a physiological regulator of hCG production has not been identified, the synthesis of both subunits can be stimulated by cAMP in placental explants and in human choriocarcinoma cells (2, 3). Recent reports from several laboratories have shown that cAMP regulates expression of the chorionic gonadotropin a- and ,-subunit genes, at least in part, at the level of transcription (refs. 4 and 5; A.M., R. Cox, and J.H.N., unpublished data). In the human a-subunit gene, the first 140 base pairs (bp) of 5' flanking sequence are sufficient to confer cAMP regulation to a heterologous gene after transfection and transient expression in choriocarcinoma cells (4). This suggests that a cAMP response element lies within this region. In the present study, we have constructed several expression vectors and have used a transient expression assay to localize this element to an 18-bp sequence that is repeated between positions -146 and -111 in the 5' flanking region of the a-subunit gene. A single copy ofthis cAMP response element is sufficient to confer the same degree of cAMP regulation as a 1500-bp fragment containing the a-subunit promoter. This

Abbreviations: SV40, simian virus 40; LTR, long terminal repeat; hCG, human chorionic gonadotropin; CAT, chloramphenicol acetyltransferase; CRE, cAMP response element. §Present address: Department of Molecular Biology, Princeton University, Princeton, NJ 08544. $To whom reprint requests should be addressed.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 2198

Biochemistry: Silver et al.

Proc. Natl. Acad. Sci. USA 84 (1987)

A

So (- 169)

2199

CAT Assays. Protein content of the cell lysates was determined by the Bradford method (Bio-Rad). Variable amounts of protein were incubated with 0.1 ILCi of [14C]chloramphenicol (40 mCi/mmol, New England Nuclear; 1 Ci = 37 GBq), 1.5 mM acetyl-CoA (Sigma), and 138 mM Tris HCl, pH 7.9, for 2 hr at 370C. For cAMP regulation studies, CAT activity was determined as a function of time to ensure that measurements were made in the linear range of the assay. The reaction mixtures were extracted with ethyl acetate and analyzed by thin-layer chromatography (7). Hirt Fractionation. Equal numbers of transfected BeWo cells were removed from culture dishes by treatment with trypsin, washed in sodium phosphate-buffered saline containing 2 mM MgCl2 and 0.1 mM EDTA, and suspended in buffer containing 10 mM Tris HCl at pH 7.4, 10 mM NaCl, 5 mM MgCl2, and 1 mM dithiothreitol (10). After the cells were disrupted in a Dounce homogenizer, the nuclei were separated from cytoplasmic components by centrifugation through sucrose (11) and lysed as described by Hirt (12). Purified plasmid DNA was digested with BamnHI and HindIII and analyzed by Southern blot hybridization (13) using a radiolabeled fragment of the CAT gene.

R (-99) H (+44)

B H

ORI

RESULTS

B

FIG. 1. Construction of vectors. (A) pHaCAT. The thick line and solid box represent the 5' flanking region and first exon, respectively, of the human a-subunit gene. The numbered positions are those of the a-subunit gene. (B) pXSV1CAT. The thick line represents the SV40 early promoter region from position 128 to 5171 (8). It contains the 3' portion (21 bp) of one of the 72-bp repeats remaining after digesting pSV2CAT with Acc I and Sph I. The Xba I site is therefore 198 bp upstream of the junction between the SV40 and CAT sequences. In both constructs the thin line represents pBR322 sequence. t and An represent SV40 splicing and polyadenylylation signals, respectively. The arrows refer to the early transcriptional start sites. ORI, pBR322 origin of replication; AMPR, ampicillin resistance gene; H, HindIII; Sa, Sau I; R, Rsa I; B, BamHI; X, Xba I; A, Acc I; S, Sph I.

cAMP Regulation of a Chimeric a-Subunit-CAT Gene. We subcloned a 1500-bp fragment from the hCG a-subunit gene in the HindIII site of pSVOCAT, a mammalian expression vector (Fig. LA), to determine if it contained the necessary sequence information to confer cAMP regulation to a heterologous gene. After transfection into choriocarcinoma cells (BeWo), expression of the CAT gene increased approximately 4-fold when the transfected cells were treated with 1 mM 8-Br-cAMP for 16 hr (Fig. 2). This response is similar to that observed by Darnell and Boime after transfectiod of a similar construct into JAr cells, another choriocarcinoma cell line (4). As a negative control, RSVCAT, containing the long terminal repeat (LTR) from Rous sarcoma virus linked to the CAT gene (14), showed no response to cAMP. This suggests that the effect of cAMP depends on the presence of the appropriate promoter element and does not reflect stabilization of CAT mRNA. RELATIVE CAT ACTIVITY

INDUCTION RATIO

2 3 4 5 6 7 8 9 10

pHaCAT

3.4+/- 0.3(9)

-(-1500)

(+44)

RSVCAT --------Xbo

TATA

1.2 +/- 0.2 (9) Born

0.7+/- 0.1 (4)

pXSVlCAT

5.3*/- 2.4(3) 4.9*/- 0.7 (4)

(-1500)

(+44)

(+44)

(-1500)

(-1500)

(.44)

(+44)

(-1500)

4.5+/- 0.2(4) 3 4 +/- 0.2'(4)

FIG. 2. Effect of the 5' flanking region of the a-subunit gene on the cAMP regulation of a heterologous promoter. The 5' flanking region of the a-subunit gene (black box) was inserted into the HindIII site of pSVOCAT or into the Xba I and BamHI restriction sites of pXSV1CAT. In RSVCAT the hatched box represents the 3' LTR. The SV40 early promoter region in pXSV1CAT (thick line) is diagrammed in detail, showing the early transcriptional start sites (arrows), the 21-bp repeats (stippled box), and the remaining portion of the 72-bp repeat (open box). The relative CAT activity of each construct was calculated by comparing the percent conversion of [14C]chloramphenicol to its acetylated forms in cAMP-treated samples (solid bars) to untreated controls (open bars). The thin lines represent the SEM. Mean induction ratios (±SEM) are shown on the right, and the number of separate experiments with each vector is in parentheses. In the absence of cAMP, the average CAT activities of pHaCAT, RSVCAT, and pXSV1CAT were as follows: 0.47 + 0.14, 1.28 + 0.41, and 0.0012 ± 0.0003 percent conversion per pg of protein per hr, respectively. These average basal activities are based on a minimum of seven transfections.

2200



Regulation of a Heterologous Promoter by the 5' Flanking Region of the a-Subunit Gene. To further characterize the cAMP response element in the human a-subunit gene, we subcloned the 5' flanking region (-1500/+44) in the Xba I site of pXSV1CAT, a modified vector containing the SV40 early promoter but no enhancer (Fig. 1B). The proximal 5' flanking region from the a-subunit gene conferred cAMP induction of CAT expression in either a 5' or 3' position and in either transcriptional orientation relative to the SV40 early promoter-CAT transcription unit (Fig. 2). This segment of DNA therefore contains a sequence that acts as an inducible response element, mediating cAMP induction of a heterologous promoter. Effect of cAMP on Transfection Efficiency. In a transient expression assay, increases in CAT activity after cAMP treatment could result from changes in the rate of transcription of the CAT gene or by changes in transfection efficiency. Consequently, we performed Hirt fractionations (12) on nuclei isolated from transfected cells to measure the relative amount of plasmid DNA that had gained entry into the nucleus. Digestion of the purified DNA with BamHI and HindIII released an internal 1632-bp fragment of the CAT gene, which was analyzed by Southern blot hybridization (Fig. 3). The hybridization signals representing transfected DNA from control and cAMP-treated cells are nearly identical, suggesting that transfection efficiency is not affected by cAMP and that it is relatively constant from one vector to another. Localization of the cAMP Response Element in the aSubunit Gene. Restriction fragments representing subfragments of the 5' flanking region (-169/+44, -169/-100, -99/+44) were inserted into pXSV1CAT. Results of the transient expression assays indicated that the response element is located within the -169/-100 fragment (Fig. 4), indicating that this 69-bp sequence functions independently of either the downstream promoter elements or sequences further upstream in the 5' flanking region. Furthermore, the extent of cAMP induction was even greater than that observed with the -1500/+44 fragment.

Closer inspection of this DNA sequence revealed an 18-bp element, directly repeated between positions -146 and -111, which is homologous to other recently described cAMP response elements (Fig. 4, Table 1). To determine whether one or both copies of this element were important for cAMP regulation, we constructed a mutant of pHaCAT in which one copy of the 18-bp element was deleted by digestion with Aat II. The response of this mutant vector to cAMP was the same as that of pHaCAT (data not shown). This suggests that other portions of the 5' flanking region contain a cAMP response element, or that a single copy of the 18-bp sequence is sufficient for cAMP induction. Therefore, we synthesized an oligodeoxynucleotide representing the 18-bp element and inserted one, two, and three copies into the Xba I site of pXSV1CAT to test whether a single element could confer the same degree of cAMP regulation to a heterologous promoter as the 1500-bp fragment. Results from these transfections indicate that a single copy of the 18-bp element is sufficient to confer nearly full cAMP induction to the SV40-CAT fusion gene (Figs. 2 and 4). Hence, we will refer to this element as a cAMP response element or "CRE." The addition of a second copy of the CRE increases induction 2-fold even though the two copies are in opposite orientations, suggesting that the CRE can work in either orientation. A third copy does not contribute further to the cAMP response. Together, these data indicate that the sequence requirements identified for cAMP induction reside in a single 18-bp element. SAU I

AAT 11

CCTAAGGTTGAAACAAGATAAGATCAAATTGACGTCATGGTAA -160

-129

-146 RSAI

AATII

AAATTGACGTCATGGTAATrACACCAAGTACCCrrCAAICATTG

-128

-90

-100

-111

GATGGAATTTCCTGTrGATCCCAGGGCTrAGATGCAGGTGGAAACACT -80

-70

-50

-60

-40

ClrGC7UGiATAAAAGCAGGTGAGGACTrCA1TAACrGCAGTTACrGAGA -30

-20

-10

-1

+10

ACICATAAGACGAAGCrAAAATCCrCTICG +20

+30

Xbo

+40

TATA

RELATIVE CAT ACTIVITY 2 345 6789011K)

- +

- +

2

t

(-169)

(444)

(+44)

(-169)

140.9

, I,

4L :L .- ' :SI :U,:.........:b.':

-

FIG. 3. Analysis of transfected DNA by Hirt fractionation. Nuclear DNA was isolated from equal numbers of BeWo cells transfected with one of the following constructs: pHaCAT, pXSV1CAT, or pXSV1CAT that contains 1500 bp of a 5'-flanking sequence in the reverse orientation, 3' to the CAT gene (3'+44/ -1500; see Fig. 2). The arrow indicates the BamHI-HindIII internal CAT fragment, common to all of the a-CAT constructs. The + and - refer to DNA harvested from cells transfected with pHaCAT and either treated or not treated with 8-Br-cAMP, respectively. A known amount (0.1 ,ug) of pSV2CAT was digested with BamHI and HindIII and included on the same Southern blot to provide a concentration and size standard for CAT DNA.

@

INDUCTION RATIO

8.7+/- 2.8(5) 9.5+/- .0 (3)

- +

- 11.6/- 3.0(3)

(-169) (-0)

2.3 -_ 2.0-

12131415

9.3+/- 0.8(4)

(-OO) (-169)

(-99)

(444)

(+44)

(-99)

-4

.1+/-0.2 (3) 1.6+/-0.7(7) 3.5 +/ 0.8 (3) 10.5'+/-O8(3) 8.3+/-0.7(3)

FIG. 4. Localization ofthe cAMP response element. The top shows the DNA sequence of a portion of the 5' flanking region ofthe a-subunit gene. The proximal 1500 bp ofthis region was subcloned in M13mp8 (15) and sequenced by the chain termination method of Sanger et al. (16). The CAAT and TATA homologies are underlined and the 18-bp direct repeat is shown in bold letters. Three restriction fragments from the 5' flanking region were subcloned in the Xba I site of pXSV1CAT and are shown with their coordinates in the lower left. The smaller arrows represent the 18-bp synthetic oligodeoxynucleotide. The orientation of each of the synthetic elements was established by nucleotide sequencing. The relative CAT activity of each construct and the induction ratio were calculated as described in the legend to Fig. 2.



2201

Table 1. Oligodeoxynucleotides that confer cAMP responsiveness Coordinates Sequence Gene A AAT TGA CGT CAT GGT AA hCG a-subunit -128/-111 G TAG GGC CTO CGT CAG CTG CAG CCC GCC GG Proenkephalin -100/-71 GA TCC AAA GGC CGG CCC TTA CGT CAG AGG CGA GCC TCC AGG TCC AGC PEPCK -108/-62 Somatostatin -60/-29 C TGG GGG CGC CTC CTT GGC TGA CGT CAG AGA GAG AG C TGA CGT CAG "Core" Each sequence corresponds to the listed coordinates in the 5' flanking region ofits respective gene. Each has the capability of conferring cAMP induction upon a heterologous promoter. The sequences have been aligned for maximum homology around a "core" element, 10 nucleotides in length, which alone is not sufficient for cAMP responsiveness (17). hCG a-subunit (this report); proenkephalin, human proenkephalin (18); PEPCK, rat phosphoenolpyruvate carboxykinase (19); and somatostatin, rat somatostatin (17).

Identification of an Additional Promoter-Regulatory Element. The 5' flanking region of the human a-subunit gene also contains sequences that function as a constitutive enhancer, because the basal expression of several of the pXSV1-based constructs is increased 10- to 100-fold over that of pXSV1CAT (Table 2). Enhancer activity can be localized to a fragment, -169/-100, that contains both copies of the CRE. In contrast, one or two copies of the CRE have little effect on the expression of CAT in the absence of cAMP (see 18X1 and 18X2 in Table 2), further emphasizing its specialized role as an inducible response element. Thus, while the sequences immediately surrounding the 18-bp direct repeat are not required for cAMP regulation, they do appear to be necessary for full activity of the constitutive enhancer.

DISCUSSION We have demonstrated that the 5' flanking sequence of the human a-subunit gene contains at least two promoterregulatory elements: an enhancer that augments basal expression and an 18-bp element that confers responsiveness to cAMP. The cellular enhancer, contained within the sequence from -169 to -100, is closely associated with the CRE (-146 to -111) and stimulates basal transcriptional activity by 10to 100-fold. Despite the close association of these two elements, the CRE alone has very little constitutive enhancer activity (see 18X1 in Table 2). Dissection of other hormonally regulated promoter regions has revealed discrete subdomains Table 2. Enhancer activities of the a-pXSVlCAT fusion genes in the absence of cAMP Fold enhancement No. Plasmid above pXSV1CAT exps. pXSVlCAT 3 112 ±72 5'-1500/+44 4 24 ± s 5'+44/-1500 4 86 ± 14 3'-1500/+44 4 128 ± 22 3'+44/-1500 3 39 ± 12 -169/+44 3 10 ± 1i +44/-169 4 27 ± 7 -169/-100 17 ± 21 3 -100/-169 3 2.8 ± 0.3 3 2.8 ± 0.4 3 1.2 ± 0.4 0.4 3 1.8 3 5.8 ± 0.8 18X3 The fold enhancement is based on data only from experiments that included both pXSV1CAT and the designated plasmid in order to compare activities within a given transfection. The fold enhancement was calculated by dividing the basal CAT activity of each construct by that of pXSV1CAT. Results are mean ± SEM. Members of each pair of values joined by braces are not significantly different from each other at a P value of