tImperial Cancer Research Fund, Cancer Immunology Laboratory, and tMolecular Immunology Group, Institute of Molecular Medicine, John Radcliffe Hospital,.
Proc. Natl. Acad. Sci. USA Vol. 93, pp. 236-240, January 1996
Immunology
Expression of a single-chain HLA class I molecule in a human cell line: Presentation of exogenous peptide and processed antigen to cytotoxic T lymphocytes KoJi TOSHITANIt, VERONIQUE BRAUDt, MICHAEL J. BROWNINGt§, NICHOLAS MURRAYt, ANDREW J. MCMICHAELt, WALTER F. BODMERtl
AND
tImperial Cancer Research Fund, Cancer Immunology Laboratory, and tMolecular Immunology Group, Institute of Molecular Medicine, John Radcliffe Hospital, Oxford OX3 9DU, United Kingdom
Contributed by Walter F. Bodmer, October 3, 1995
product between f32m and HLA-A2 and expressed this in the /32m-deficient colorectal carcinoma cell line DLD-1 (4-6). The synthesis of soluble, single-chain H-2 class I molecules consisting of H-2 class I heavy chains linked covalently via a peptide spacer to f32m has been described (7, 8). Both L cell-expressed soluble single-chain Dd (7) and baculovirusexpressed soluble single-chain Kd (8) were shown to bind appropriate known Dd or Kd binding peptides. In addition, the Dd single-chain molecule, when loaded with an appropriate antigenic peptide and immobilized on plastic plates, was shown to stimulate an antigen-specific, Dd-restricted T-cell hybridoma. Furthermore, Mottez et al. (9) demonstrated that a single-chain full-length Kd/132m construct was expressed in COS-1 cells in a form that was reactive with several Kd-specific monoclonal antibodies (mAbs), showing that the construct was expressed in a conformationally correct form. Similarly, mouse f32m was linked to an H-Dd molecule and formed a correctly folded molecule, capable of presenting exogenously added peptides to specific CTLs (10). These experiments suggested that single-chain class I constructs, when expressed in a mammalian cell, should be able to bind endogenously processed peptide antigen in the endoplasmic reticulum and to present them to antigen-specific, MHC-restricted T lymphocytes. If this assumption is true, single-chain class I molecules will be valuable as immunotherapeutic agents. To test this, we synthesized a recombinant single-chain f32m linked through its carboxyl terminus via a short peptide spacer to HLA-A2 (A*0201). After transfection of the 2l2m-deficient colorectal tumor cell line DLD-1 with this gene, serologically recognizable HLA-A2 was detected at the cell surface. An antigenspecific, HLA-A2-restricted CTL line recognized both exogenously added peptide and endogenously processed antigen expressed on DLD-1 transfectants.
ABSTRACT We have synthesized a recombinant gene encoding a single-chain HLA-A2/f32-microglobulin (182m) molecule by linking f32m through its carboxyl terminus via a short peptide spacer to HLA-A2 (A*0201). This gene has been expressed in the 132m-deficient colorectal tumor cell line DLD-1. Transfection of this cell with the single-chain construct was associated with conformationally correct cell surface expression of a class I molecule of appropriate molecular mass. The single-chain HLA class I molecule presented either exogenously added peptide or (after interferon-y treatment) endogenously processed antigen to an influenza A matrixspecific, HLA-A2-restricted cytotoxic T-lymphocyte line. The need for interferon y for the processing and presentation of endogenous antigen suggests that DLD-1 has an antigenprocessing defect that can be up-regulated, a feature that may be found in other carcinomas. Our data indicate that singlechain HLA class I constructs can form functional class I molecules capable of presenting endogenously processed antigens. Such molecules should be of use for functional studies, as well as providing potential anticancer immunotherapeutic agents or vaccines.
The HLA (human) and H-2 (mouse) class I major histocompatibility complex (MHC) molecules are cell surface glycoproteins composed of heterodimers of a highly polymorphic 45-kDa transmembrane chain associated noncovalently with the monomorphic 12-kDa f2-microglobulin (032m). These heterodimers present endogenously derived peptides to specific antigen receptors on cytotoxic T lymphocytes (CTLs) (1). This mechanism of T-cell recognition, where T cells recognize intracellular determinants, has broadened the range of potential targets for the immune system in cancer and has revolutionized views on tumor immunity and the potential for tumor immunotherapy and vaccination (2). Variations in HLA expression, including complete loss of HLA-A, -B, and -C expression or loss of expression of a single allele, have been interpreted as tumor escape from T-cell immune attack, leading to selection for reduced or absent HLA-A, -B, and -C expression (3). Cell lines derived from tumors may include, in particular, lack of HLA-A, -B, and -C expression, due to f32m gene mutations (4). These cells presumably express one or more tumor-specific or associated determinants that have been recognized by immune T cells. If such cell lines could be made to express a single HLA determinant, they could become valuable reagents for studying tumor immunity and possibly even as immunogens, since allo-specific reactivity could be avoided by matching for a single HLA class I antigen. With this rationale in mind, we have constructed a single-chain fusion
MATERIALS AND METHODS Plasmid Construction. The recombinant single-chain 132m/ HLA-A2 molecule (,B2m15-A2) was designed to connect the carboxyl terminus of human f32m to the amino terminus of the al domain of HLA-A2 via a 15-amino acid peptide spacer (GGGGS)3 (Fig. 1). The 32m gene was amplified from a cDNA library of the JY cell line (11) with 5' primer P1 (Table 1), which incorporated a Sal I restriction site followed by the 5' end of the f32m leader sequence, and 3' primer P2, which incorporated the 3' terminus of the f32m coding region and 39 bases encoding the 5' portion of the peptide spacer. The P1 /P2 Abbreviations: 12m, 132-microglobulin; CTL, cytotoxic T-lymphocyte; IFN-,y, interferon y; mAb, monoclonal antibody; MHC, major histocompatibility complex; pfu, plaque-forming units; E:T, effector to target; BCI, B cell line. §Present address: Department of Microbiology and Immunology, University of Leicester, Medical Sciences Building, University Road, Leicester LEI 9HN, United Kingdom. ITo whom reprint requests should be addressed.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
236
Immunology: Toshitani et al. p2mcDNA
SaI I
HAA2 ccDNA
S
SPACER
IP2~~~~~~~~~.
4
o
f2m15-A2 FIG. 1. Construction of the recombinant single-chain ,B2m15-A2 gene. SOE PCR, splicing overlap extension PCR.
PCR product (,32m-SP) was cloned into pUC-19 (pUC-,32mSP). The HLA-A*0201 gene was initially amplified from a cDNA clone [a gift from Cheryl Quinn (Institute of Molecular Medicine, Oxford)], isolated as described (12), using 5' primer P3 and 3' primer P5. P3 encoded an 18-bp overlap with the 3' end of P2, a further 6 bases encoding the 3' portion of the spacer, and the 5' region of the second exon of HLA-A*0201. P5 encoded the 3' coding region of the heavy-chain gene. The P3/P5 PCR product was then used as a template in a second round PCR using 5' primer P7 and 3' primer P4, which extended the 5' overlap with the 3' region of (,B2m-SP) to 51 bases and incorporated a HindlIl restriction site 3' of the heavy-chain gene, respectively. Cloned pUC-,B2m-SP plasmid DNA and the P7/P4 heavy-chain gene product were then mixed in a splicing overlap extension PCR (7) and amplified using 5' primer P1 and 3' primer P4 to give a single construct incorporating leader-f32m-spacer-HLA-A2 coding sequences flanked by 5' Sal I and 3' HindIII restriction sites (,B2m15-A2). P1/P2, P3/P5, and P7/P4 PCR were carried out over 30 cycles of 95°C for 90 sec, 60°C for 1 min, and 72°C for 2 min. The final overlap PCR consisted of a single cycle of 95°C for 90 sec, 50°C for 1 min, and 72°C for 150 sec without primers to facilitate annealing of the ,B2m-SP and HLA-A*0201 fragments, followed by 45 cycles of 95°C for 90 sec, 65°C for 1 min, and 72°C for 160 sec in the presence of primers P1 and P4. All PCR were performed in 50 ,tl using the conditions described by Browning et al. (6). The final PCR product (P1/P4) was ligated into pUC-19 using the Sal I and Hindlll cloning sites (pUC-,32m15A2). A full-length construct of the desired sequence was obtained by combining three independently derived segments without PCR-induced mutations and was confirmed by the Sanger method (13), using primers P8-P19 (Table 1). The f32m15-A2 sequence was subcloned using pBluescript and finally cloned into the pcDNAI-neo expression vector (British Biotechnology, Oxford) (pcDNA-,B2m15-A2). To make a transfectant containing 32m only, the 932m gene was amplified by PCR from the cDNA from the JY cell line library using 5' primer P1 and 3' primer P6 (encoding the 3' terminus of the /32m coding sequence). The PCR product was subcloned into pBluescript for sequencing and cloned into pcDNA1-neo vector (pcDNA-132m). Stable Transfection. The cell line DLD-1 (5) has been shown to have the genotype HLA-A2, -A9 (6) but does not express surface HLA-A, -B, -C due to mutations in both alleles of f32m
Proc. Natl. Acad. Sci. USA 93 (1996)
237
(4). DLD-1 was maintained in Dulbecco's modified Eagle's minimum medium supplemented with 10% fetal calf serum, 2 mM glutamine, 100 units of penicillin per ml, and 100 ,ug of streptomycin per ml. DLD-1 cells (107) were transfected with either pcDNA-,32m15-A2 (10 ,ug), pcDNA-,B2m (10 ,ug), or pcDNA1-neo (10 jig), which had previously been linearized by digestion with Sfi I, and coated with lipopolyamine (Transfectam; SEPRACOR, Strasbourg, France) for 48 hr. Selection of cells containing stably integrated DNA was accomplished in medium containing Geneticin (G418) at 600-1800 jig/ml for 2-3 weeks. Detection of the integrated ,B2m15-A2 construct and the f32m gene was performed by PCR using primers P8/P15 and P1/P9, respectively. Flow Cytometry. DLD-1 transfectants were analyzed by flow cytometry using the following mAbs: W6/32 (specific for 132m-associated HLA class I) (14), BB7.2 (specific for HLA-A2 and -A69) (15), NSF TM901 (specific for HLA-A1 and -A9) (16), and BBM.1 (specific for ,32m; kindly given by J. G. Bodmer, Imperial Cancer Research Fund, London) (17). DLD-1 transfectants were cultured in medium with or without interferon y (IFN-,y) (500 units/ml; Boehringer Mannheim) for 3 days. Cytofluorographic experiments were performed using a standard protocol and analyzed on a FACScan (Becton Dickinson). Labeling, Immunoprecipitation, and SDS/PAGE Analyses. For metabolic labeling, 5 x 107-108 transfected DLD-1 cells or 2 x 106 cells from the B cell line (BCl) PG were incubated for 16 hr with [35S]methionine at 0.2 mCi/ml (1 mCi = 37 MBq) at 37°C. Cell surface labeling was performed by the lactoperoxidase/glucose oxidase-catalyzed reaction. Ten million DLD-1 transfectant cells or 2 x 106 cells from the BCl PG were labeled with 0.5 mCi of Na125I using a previously reported protocol (18). Immunoprecipitation of MHC class I molecules from 35S- or 125I-labeled cells was performed as described (19) and analyzed by SDS/PAGE followed by autoradiography. CTL Assays. An influenza A matrix-specific, HLA-A2restricted human CTL line was generated as described (20) from the blood of donor PG. CTL activities were measured in a standard 5-hr 51Cr release assay. Target cells were labeled with 100 ,uCi of 51Cr (Amersham) for 1 hr at 37°C and then incubated with various concentrations of the matrix peptide (GILGFVFTL; residues 58-66) (21) for 1 hr. Other target cells were infected with recombinant vaccinia viruses encoding either the matrix 1 protein (Mi-Vac) (22) or the nucleoprotein (NP-Vac) (23) at 10 plaque forming units (pfu) per cell for 90 min, washed, and incubated for 18 hr in culture medium before labeling (20). For the assay, 5 x 103 targets cells per well were incubated for 5 hr with either CTLs at various effector-totarget (E:T) ratios, medium alone (spontaneous release), or 5% Triton X-100 (maximum release). Chromium release was measured by harvesting 20 ,ul of supernatant and then determining the radioactivity using a n-plate counter (LKB). The percentage of specific lysis was calculated as [(release by
CTLs) - (spontaneous release)] x 100/[(maximum release) - (spontaneous release)].
RESULTS Transfection of the Single-Chain Class I Molecule Gene Construct. A single-chain class I gene construct was obtained by splicing overlap extension PCR (Fig. 1). The gene fragment ,32m15-A2, encoding the human 132m leader sequence, the human g2m coding region, a 15-aa peptide spacer sequence (GGGGS)3, and the complete HLA-A2 coding region, was confirmed by DNA sequencing and was cloned into the mammalian expression vector pcDNAI-neo, under control of the promoter from the immediate early gene of the human cytomegalovirus. The P2m-deficient colorectal cell line DLD-1 was transfected with the single-chain construct (DLD-A2c),
238
Immunology: Toshitani et al.
Proc. Natl. Acad. Sci. USA 93
Table 1. Oligonucleotide primer sequences Primer Sequence (5' -> 3') P1 CGGGTCGACATGTCTCGCTCCGTGGCCTTA P2 GCCGCCACCCGAGCCACCTCCGCCGGATCCGCCACCTCCCATGTCTCGATCCCACTTAAC P3 GGTGGCTCGGGTGGCGGCGGATCCGGATCTCACTCCATGAGGTATTTCTTCACATCC P4 GCCCAAGCTTTCTCAGTCCCTCACAAGGCAGCTGTC P5 GTCCCTCACAAGGCAGCTGTCTCACACTTTACAAGCTGTGAG P6 P7 P8 P9
PIO P1l P12 P13 P14 P15 P16 P17 P18 P19
Portion Sal I, j2m 5' end /2m 3' end, peptide spacer Peptide spacer, HLA-A2 exon 2 HLA-A2 3'-untranslated region, HindlIl 3' end of P4, HLA-A2 3'-coding region 12m 3' end, Sal I 32m, peptide spacer 12m exon 2 f2m exon 2 32m exon 2 HLA-A2 exon 2 HLA-A2 exon 2 HLA-A2 exon 4 HLA-A2 exon 4 HLA-A2 exon 5 HLA-A2 exon 4 HLA-A2 exon 3 HLA-A2 exon 3 HLA-A2 exon 2
TGAGTCGACTTACATGTCTCGATCCC GATCGAGACATGGGAGGTGGCGGATCCGGCGGAGGTGGCTCGGGTGGCGGCGGATCC GTACTCCAAAGATTCAGGTTTACTCACG TACCCCACTTAACTATCTTGGGCTGTGA TGCCTGCCGTGTGAACCA
TGGATAGAGCAGGAGGG CGACGGCAAGGATTACATCGC GACCATGAAGCCACCCTGAGG AAGCCCCTCACCCTGAGA AATGATGCCCACGATGGGGA TGGTCCTCGCCATCCCGCTG CGGAGCCACTCCACGCAC TCCGACCCCACGTCGCAGCC CGCGGCGTCGCTGTCGAA
with the f32m gene (DLD-,B2m), and with the plasmid alone (DLD-Mock). Expression of the Single-Chain Class I Molecule Gene Construct and I32m. After detection of the integrated gene construct by PCR, FACScan analyses were performed using the mAb W6/32 (anti-HLA class I complex), BB7.2 (antiHLA-A2, -A69), and BBM.1 (anti-f32m). As W6/32 and BBM.l gave the same pattern, only W6/32 stainings are presented. As shown in Fig. 2A, expression of the HLA class I molecules was detected on the DLD-A2c transfectant but not on the mock transfectant DLD-Mock, which lacks f32m (9). Thus, the recombinant molecule seemed to be correctly folded as it was recognized by conformationally dependent mAbs. f32m-transfected cells (DLD-32m) were also positive with these three mAbs (Fig. 2A). As shown in Fig. 2B, DLD-,B2m was positive for BB7.2 and also for NSF TM901 (specific for HLA-A9 and -Al), showing the expected reexpression of A2 and A9 based on the HLA-A genotype of DLD-1 (9). The fluorescence intensity of both BB7.2 and NSF TM901 for DLD-j32m increased after treatment with IFN--y, whereas the fluorescence intensity of BB7.2 did not increase and remained negative for NSF TM901, with or without IFN-,y in DLD-A2c. This shows that transfection of DLD-1 with f32m was associated with expression of the endogenous HLA-A genes under IFN-,y induction, whereas transfection with the single-chain construct in DLD-A2c under control of a cytomegalovirus promoter was not associated with the endogenous A2 gene. We confirmed that the translated recombinant molecule was a single-chain product by labeling DLD-A2c and analyzing by immunoprecipitation and SDS/PAGE. As shown in Fig. 3, precipitation of metabolically labeled product with the antif32m mAb, as well as precipitation of surface-labeled extracts with the anti-class I complex mAb, showed a band of a relative molecular mass at -57 kDa, which corresponds to the expected size of product expressed from the ,B2ml5-A2 fusion construct. This band was not seen in DLD-f32m, DLD-Mock, or BCl PG. The absence of any other molecular mass product in DLD-A2c precipitates indicates that the only f32massociated HLA class I product made in DLD-A2c was that encoded by the fusion construct. In contrast, bands at -45 kDa (for the HLA heavy chain) and 12 kDa (f32m) were observed in both the normal BCl PG and DLD-f32m, as expected from the normal association of HLA class I heavy chains with f32m. These results show that BBM.l can recognize its f32m determinant in the fusion product and that the fusion product does not give rise to any free f32m, which is consistent with the lack
(1996)
of reactivity of the A9 mAb (NSF TM901) on DLD-A2c (Fig.
2B). HLA-A2-Restricted CTLs Recognize a Specific Antigen Presented by the Single-Chain Class I Molecule. CTLs from a
A 0 rz
B no Ab ; z
BB7.2
F-i
F-i
0) U
NSF TM901
0)
10
1 63 lbU
101
10
Fluorescence Intensity
FIG. 2. The single-chain HLA class I molecule is expressed at the cell surface of DLD-A2c transfectants. Cells were analyzed by flow cytometry on a FACScan. (A) Expression of the single-chain HLA class I molecule. Cells were stained with the following mAbs: an anti-132massociated HLA class I (W6/32; labeled W) and an anti-HLA-A2, -A69 (BB7.2; labeled 7.2). The Bcl PG (HLA-A2, -A3) was analyzed as a positive control. The negative control is indicated as a dotted line. (B) Expression of class I molecules in the DLD-A2c and the DLD-/32m after treatment with IFN-,y. Cells were stained with anti-HLA-A2, -A69 (BB7.2) and anti-HLA-A1, -A9 (NSF TM901) after treatment with (shaded area) or without (open area) IFN-,y (500 units/ml) for 3 days.
Immunology: Toshitani et al. A
B
Proc. Natl. Acad. Sci. USA 93 (1996)
239
A 0 40
-
0
U
20 Mo
57kD_57kD 45kD o45kD 4 _
0
DLD-A2c
DLD-A2c+IFN PG
0
M58-66 (pM)
B
DLD-A2c
DLD-A2c + IFN
60
60
40
40'
20
20
1 2kD 0-
12kD_-
FIG. 3. The single-chain HLA class I molecule is immunoprecipitated from DLD-A2c transfectant. (A) Metabolic labeling with [35S]methionine and immunoprecipitation with mAb BBM.1. (B) Cell surface labeling with 125I and immunoprecipitation with mAb W6/32.
donor (PG) whose lymphocytes gave an influenza A matrix 1-specific, HLA-A2-restricted response after stimulation in vitro were tested for recognition of the single-chain class I gene-transfected target cells (DLD-A2c) using a 51Cr-release assay. We first tested the recognition of exogenous antigenic peptides (M58-66) presented by the single-chain class I molecule. The specific lysis of DLD-A2c with added peptide M58-66 was much higher (around 40% at E:T = 10:1) than the DLD-Mock transfectant (
