BIOLOGY OF REPRODUCTION 60, 1378–1383 (1999)
D1 and D2 Dopamine Receptor Messenger Ribonucleic Acid in Brain and Pituitary during the Reproductive Cycle of the Turkey Hen 1 Stephen A. Schnell,2 Seungkwon You, and Mohamed E. El Halawani Department of Animal Science, University of Minnesota, St. Paul, Minnesota 55109 ABSTRACT The regulation of prolactin secretion during the reproductive cycle of seasonal breeding birds appears to be largely under the stimulatory influence of hypothalamic vasoactive intestinal peptide (VIP). However, the factors influencing VIP secretion, and hence prolactin release, in birds remain largely unexplored. Recent evidence has demonstrated that dopamine and dopamine receptors may affect VIP and prolactin release in birds. The differential expression of dopamine receptors on hypothalamic VIP-releasing neurons may affect the degree of prolactinemia observed during the reproductive cycle of birds. In order to examine this hypothesis, we used reverse transcription-polymerase chain reaction to quantitate the levels of D1 and D2 dopamine receptor subtype mRNAs in the brain of the domestic turkey hen during the reproductive cycle. No significant difference in hypothalamic expression of D1 or D2 dopamine receptor subtypes during the reproductive cycle was observed. However, pronounced differences in D1D and D2 mRNAs were detected in cortex and cerebellum. Interestingly, there was a dramatic increase in pituitary D1D receptor mRNA during the reproductive stages of laying and incubation of eggs, which paralleled the hyperprolactinemic state of the turkey reproductive cycle. In addition, pituitary D2 receptor mRNA steadily increased throughout the reproductive cycle. In light of these observations, a modified hypothesis regarding the effects of dopamine on prolactin secretion is discussed.
INTRODUCTION
Prolactin secretion from the pituitary is closely correlated with the reproductive cycle in birds. During the reproductively quiescent stages of the cycle, plasma prolactin levels are very low (;5–10 ng/ml); however, during the laying and incubation stages, circulating prolactin levels increase dramatically (;500–1500 ng/ml) [1]. In mammals, the regulation of prolactin secretion is under the inhibitory control of tuberoinfundibular dopaminergic (TIDA) neurons in the hypothalamus, which release dopamine that acts directly upon pituitary lactotrophs [2]. In contrast, the regulation of prolactin in birds appears to be largely under major stimulatory control of vasoactive intestinal peptide (VIP), most likely released from neurons in the hypothalamus into the hypophysial portal blood [3–8]. The involvement of VIP on the major stimulatory phase of prolactin release (e.g., the initiation and maintenance of incubation behavior) is thus fairly well understood. However, the mechanism by which prolactin is inhibited during the phases of low prolactin secretion (e.g., nonphotostimulated and photorefractory birds) remains to be determined. Accepted January 26, 1999. Received July 24, 1998. 1 These studies were supported by grant number 97-35203-4960 from the United States Department of Agriculture. 2 Correspondence: Steve Schnell, 4-144 Jackson Hall, Dept. Cell Biology and Neuroanatomy, 321 Church Street S.E., University of Minnesota, Minneapolis, MN 55455. FAX: 612 624 8118; e-mail:
[email protected]
In birds, the involvement of dopamine in prolactin release is unclear at present. In vitro studies on the effect of dopamine on chicken and turkey pituitary cells demonstrated inhibition of prolactin release [8–12] similar to that seen in mammals. However, in vivo experiments have produced contradictory results. Intracerebroventricular (ICV) infusion of dopamine can either have no effect or inhibit electrically stimulated prolactin secretion, depending upon the concentrations used [13]. Subsequent ICV infusion experiments then suggested that different dopamine receptor subtypes with different affinities for dopamine may mediate the observed effects on prolactin secretion [14]. It has been suggested that dopamine is inhibitory to the VIPergic system, which stimulates prolactin secretion in laying hens [15]. Indeed, in vitro perfusion of hypothalamic explants suggested that activation of D1 receptors stimulated VIP secretion, although activation of D2 receptors had no effect on VIP release [16]. Thus, it appears that a central dopaminergic system can indirectly affect prolactin secretion in birds, perhaps by an opposing action of stimulatory D1 and inhibitory D2 dopamine receptors on hypothalamic VIPergic neurons. To further understand the interplay between dopamine receptors and their role for modulation of VIP and prolactin secretion in birds, the gross tissue distribution of D1 and D2 dopamine receptor subtypes in the turkey brain and pituitary was determined. Furthermore, we determined whether differential expression of these receptors might be correlated with respect to prolactin release during the different stages of the turkey reproductive cycle. Differential regulation of stimulatory D1 and inhibitory D2 dopamine receptors may determine the degree of hyper- and hypoprolactinemia observed during the reproductive cycle of birds by regulating VIP and/or prolactin secretion. A predominance of one receptor subtype over another during the reproductive cycle could explain this phenomenon. The recent cloning of three chicken D1 receptor subtypes (D1A, D1B, and D1D) [17] and turkey D2L and D2S receptor subtypes (unpublished observation; GenBank accession number AF056201) of dopamine receptor cDNAs provides the molecular probes necessary to investigate this hypothesis. The highly sensitive and specific technique of reverse transcription (RT) polymerase chain reaction (PCR) was used to quantify the relative levels of D1 and D2 dopamine receptor mRNAs in turkey brain and pituitary during the hen reproductive cycle. MATERIALS AND METHODS
Animals
Nicholas Large White female turkeys were used throughout these experiments. Birds were divided into four reproductive groups: nonphotostimulated (NPS), laying (LAY), incubating (INC), and photorefractory (REF) hens [18]. Six birds from each group were used. Before injection of anesthetic, blood samples were withdrawn from the bra-
1378
1379
D1 AND D2 DOPAMINE RECEPTOR mRNA TABLE 1. Primers and PCR products used for RT-PCR analysis. PCR product
Primers 59 → 39
No. of cycles
Product size (bp)
D1A
TTTCCGCAAGGCATTTTCCAC GGTTTTATGCTGCCCATTTTG
26
334
D1B
CTTCTCCAACCTCCTGGGATG ATGTAAACCATTTGGAGTGAA
26
298
D1D
CACCAGGACACCACCTGCCAGAAGGA TGCCTGCTAAACCCTGTAAAGGCATT
30
272
D2
ATCCACTGTGACATCTTTGTCAC ACACCCAGGACAATAGCTAACAT
32
240 (D2L) 151 (D2S)
b-Actin
ACCAGTAATTGGTACCGGCTCCTC TCTGGTGGTACCACAATGTACCCT
26
603
chial vein for plasma prolactin determination. Animals were killed with pentobarbitol (Anpro Pharmaceutical, Arcadia, CA) at the same time of day to avoid any diurnal variations in plasma prolactin concentration. Tissue was collected and quickly frozen in liquid nitrogen. These studies were conducted in accordance with the Guiding Principles for the Care and Use of Research Animals promulgated by the Society for the Study of Reproduction. The hypothalamic tissue was dissected away from the brain, from the optic chiasm caudally to the interpeduncular nucleus. The incision was approximately 2–3 mm deep and bounded by approximately 2 mm on either side of the midline. The hypothalamus included the caudal preoptic area and rostral including the infundibulum [16]. The cortical tissue used was from a region that physically corresponds to the motor area and somatosensory cortex in primates. The cerebellar tissue used was from a region that physically corresponds to the spinocerebellum in primates. The entire pituitary and pineal gland were used in these studies. Prolactin Assay
All plasma samples were analyzed simultaneously using the homologous RIA for turkey prolactin as described previously [19]. The intra- and interassay coefficients of variation were 9% and 12%, respectively. RT-PCR
Total RNA was extracted from ;100 mg tissue using TRI Reagent (Molecular Research Center, Cincinnati, OH)) according to the manufacturer’s instructions. RT-PCR was performed using the GeneAmp RNA kit (Perkin-Elmer, Norwalk, CT) as described by the manufacturer with a few modifications. Briefly, 2 mg total RNA was pretreated with DNase I before first-strand cDNA synthesis to remove any contaminating chromosomal DNA. The 11-ml reaction volume contained 1 U ribonuclease (RNase)-free deoxyribonuclease (DNase) I (Boehringer Mannheim, Indianapolis, IN), 1 U RNase inhibitor, 5 mM MgCl2, and single-strength PCR buffer II (50 mM KCl, 10 mM Tris-HCL; pH 8.3). Two micrograms total RNA was treated with DNase I at 378C for 10 min, denatured at 658C for 5 min, and snapcooled on ice for 2 min. Fourteen microliters of a mixture containing 2.5 U murine leukemia virus (MuLV) reverse transcriptase, 2.5 mM oligo(dT), and 1.5 mM of each dNTP was added; and one round of RT (258C for 5 min, 428C for 1 h, 958C for 5 min, and 48C soak) was performed in a thermal cycler. Four microliters of each RT product was added to 16 ml of PCR mixture (final concentrations: 2.5 U AmpliTaq
DNA polymerase, 2 mM MgCl2, single-strength PCR buffer II, and 40 pmol of each upstream and downstream primer). Preliminary experiments were designed to determine the optimal conditions for PCR amplification. First, the optimal amplification temperatures were determined. Second, we determined the linear range of amplification for the primer pairs using the optimal thermal temperatures with 15–40 cycles of PCR, done in triplicate. The actual conditions used and the sequence of primers are described in Table 1. Each PCR reaction product was fractionated on 1% or 3% agarose gels and Southern-blotted onto a nylon membrane. The membranes were then probed with nicktranslated dopamine receptor and b-actin cDNA fragments, and autoradiography was quantified by computer-assisted densitometry (Ambis Inc., San Diego, CA). Densitometry and Statistics
The band intensities of amplified dopamine receptors were normalized to the band intensities of b-actin and are expressed as arbitrary densitometric units (ADU). Statistical analysis of differences in the levels of dopamine receptors in turkey brain during the reproductive cycle were determined using the SAS General Linear Model procedure for one-way ANOVA (SAS Inc., Cary, NC). Significant differences between reproductive stages were detected using Duncan’s multiple-range test for multiple comparisons at a significance level of a 5 0.05. RESULTS
Plasma Prolactin Determination
Plasma prolactin was determined to demonstrate four readily identifiable stages during the reproductive cycle of the turkey hen (Fig. 1). NPS (4 6 1.8 ng/ml) and REF (7.5 6 3.8 ng/ml) birds had very low levels of plasma prolactin, whereas LAY and INC birds demonstrated, respectively, intermediate (495 6 285 ng/ml) and very high (;1146 6 512 ng/ml) plasma prolactin levels. RT-PCR Analysis
No significant differences in steady-state D1A, D1B, D1D, D2L, or D2S receptor mRNA levels were detected in turkey hypothalamus during the reproductive cycle (Figs. 2 and 3). In the pituitary (Figs. 2 and 3), D1A and D1B receptor steady-state mRNA levels were unchanged throughout the reproductive cycle although a slight decrease, which was statistically significant for D1B mRNA, was detected during the transition from LAY to INC stages. Steady-state D1D receptor mRNA levels dramatically increased from
1380
SCHNELL ET AL.
FIG. 1. Serum prolactin levels during the reproductive cycle of the turkey hen. Prolactin was measured during the reproductive cycle in NPS, LAY, INC, and REF hens. Values are expressed as the mean 6 SEM.
NPS through INC stages, demonstrating an increase of approximately five times the NPS level, and then decreased to NPS levels during the REF stage. Steady-state D2L and D2S mRNA levels increased steadily throughout the reproductive cycle, achieving maximum levels during the REF stage. In the pineal gland (Figs. 2 and 3), D1A receptor steadystate mRNA levels were high during the NPS stage, demonstrated significant decreases during the reproductive stages of LAY and INC, and then increased during REF stages to NPS levels. D1B receptor steady-state mRNA levels did not change significantly throughout the reproductive cycle. D1D receptor mRNA increased steadily from NPS through INC and then decreased at the REF stage. D2L and D2S mRNA increased significantly during the INC and REF stages over that of NPS birds. In the cortex (Figs. 2 and 3), D1A mRNA increased significantly from the NPS to the INC stage and then decreased during the REF stage. A significant decrease in cortical D1B mRNA occurred from the NPS to the LAY stage. Mean cortical D1D steady-state mRNA levels increased from the NPS to the INC stage and then decreased during REF stage; however, statistical analysis demonstrated no significant differences among stages. D2L and D2S steady-state mRNA levels increased throughout the reproductive cycle, becoming significantly different during the INC and REF stages from those of NPS birds. In the cerebellum (Figs. 2 and 3), D1A and D1B receptor steady-state mRNA levels demonstrated no statistical difference in expression during the reproductive cycle of the turkey hen. However, cerebellar D1D receptor steady-state mRNA levels increased significantly during the LAY stage and then returned to NPS levels at the REF stage. In addition, D2L and D2S steady-state mRNA levels increased throughout the reproductive cycle, becoming significantly different at the INC and REF stages from those of NPS birds. DISCUSSION
The results of this study showed a widespread distribution of D1 and D2 dopamine receptor mRNA throughout the turkey brain by the technique of RT-PCR. All five of the dopamine receptor subtypes studied (D1A, D1B, D1D, D2L, and D2S) were detected in turkey pituitary, hypothal-
FIG. 2. RT-PCR tissue expression of D1 and D2 dopamine receptor subtype mRNAs. Southern blot of RT-PCR products from selected brain tissues, from one turkey, of steady-state levels of D1A, D1B, D1D, D2L, D2S, and b-actin. These blots were exposed to clearly illustrate the presence of dopamine receptor or b-actin mRNAs. However, this results in overexposure of D1A, D1D, D2L, and b-actin bands. Properly exposed autoradiograms were used for semi-quantitative densitometry.
amus, pineal gland, cortex, and cerebellum. In addition, quantitative RT-PCR showed that steady-state D1 and D2 receptor mRNAs in some, but not all, turkey brain regions are differentially expressed during the reproductive cycle of the turkey hen. Most notably, mRNAs for the D1D, D2L, and D2S dopamine receptors in pituitary, pineal, cortex, and cerebellum were differentially expressed during the reproductive cycle. An interesting result obtained from these experiments was the demonstration of differential mRNA expression of both D1D and D2 dopamine receptors in the pituitary over the course of the turkey hen reproductive cycle. The recent discovery of a new D1 subtype (D1D), with its interesting pharmacological profile [17], and the data presented in this paper of its mRNA expression suggests an important role for this receptor on pituitary function. In addition, D1D receptor mRNA expression increased in parallel with that of serum prolactin concentration. D1 receptors have been classically described as being stimulatory [20–25]; thus it seems possible that activation of D1 receptors on pituitary lactotrophs could also stimulate prolactin secretion. Indeed, it has been reported that D1-like and/or D5-like dopamine receptors may actually stimulate prolactin release from rat pituitary [26]. In the turkey pituitary, VIP-stimulated prolactin release is inhibited by the application of a D2 agonist, although the effects using a D1 agonist were unclear [8]. It is widely accepted that dopamine acting upon inhibitory D2 receptors on pituitary lactotrophs tonically inhibits prolactin secretion in mammals [2]. Since D2 dopamine receptors have been localized to the pituitary, the presence of a non-D2 subtype is plausible. This possibility is further supported by the mRNA expression of three D1-like receptors in the pituitary. It would be of interest to determine what effects the D1D receptor has on pituitary function. It
D1 AND D2 DOPAMINE RECEPTOR mRNA
1381 FIG. 3. Summary of RT-PCR data for D1 and D2 dopamine receptor subtype mRNAs in turkey hypothalamus, pituitary, pineal gland, cortex, and cerebellum. The band intensities of amplified turkey D1 and D2 fragments were quantified and normalized. Values are expressed as the mean 6 SEM; statistical significance from those of NPS hens is indicated by an asterisk ( p # 0.05).
1382
SCHNELL ET AL.
is tempting to speculate that a coincident increase in D1D receptor numbers and prolactin secretion is directly correlated. The development of D1D-specific ligands could provide important data for understanding any stimulatory effect dopamine may have on avian prolactin secretion. It is interesting to note the pattern of D1D and D2 receptor mRNA expression in the pituitary. D1D receptor steady-state mRNA levels increase as birds shift from a reproductively quiescent state to laying, and further increase during egg incubation; this is followed by a decline during the photorefractory state. In contrast, steady-state D2 receptor mRNA levels increase throughout the reproductive cycle. If D1D receptor activation does indeed have prolactin-releasing capabilities, then its activity may also be regulated by increasing D2 receptor numbers. If, on the other hand, D1D receptors are not involved in prolactin secretion, they may influence other aspects of pituitary function. Hypothalamic D1 and D2 receptor subtype mRNAs were not differentially expressed during the reproductive cycle of the turkey hen. It is important to note that our failure to detect differences in dopamine receptor mRNA expression may be due to our use of whole hypothalami. It is possible that changes in receptor mRNA levels may be localized to discrete hypothalamic nuclei. Nevertheless, our results contradict a portion of the stated hypothesis (i.e., differential expression of hypothalamic D1 and D2 receptors affect VIP release, and hence, prolactin secretion). The basis of the hypothesis consisted of several lines of evidence that suggested that modulation of the hypothalamic VIPergic system by dopamine might provide the mechanism by which prolactin secretion is regulated. Electrical stimulation of the medial basal hypothalamus was shown to induce prolactin release from laying turkey hens [27]. In a subsequent experiment [15], infusion of apomorphine completely abolished electrically stimulated prolactin release in laying turkeys. In addition, systemic infusion of pimozide, a nonspecific dopamine receptor antagonist, enhanced electrically stimulated prolactin secretion. It was also discovered that intracerebroventricular infusion of low (1–10 nM) and high (100–500 nM) concentrations of dopamine had different effects on prolactin secretion [13]. Low concentrations had no effect on electrically stimulated prolactin release while high concentrations inhibited it. Other experiments have been conducted to determine which dopamine receptor subtypes might mediate these effects. ICV infusions of dopamine and selective D1 or D2 dopamine receptor antagonists were performed in laying turkeys [14]. In those experiments, electrically stimulated prolactin secretion was greatly diminished in the presence of the D1 receptor blocker SCH-23390. Furthermore, this effect required an intact VIPergic system. However, prolactin secretion was unaffected by the infusion of low concentrations (1–10 nM) of the D2 receptor blocker eticlopride HCl. High concentrations (100 nM) of eticlopride stimulated prolactin release, but this observation was interpreted as having a nonspecific component. Earlier experiments [6, 7, 28–30] strongly suggest that VIP is the major physiological factor responsible for stimulation of prolactin secretion in birds. The physiological initiator of VIP release remains to be determined; however, dopamine has recently been demonstrated to have biphasic effects on the release of VIP from turkey hypothalamic explants [16]. In those experiments, selective activation of D1 dopamine receptors stimulated the release of VIP, whereas activation of D2 receptors had no effect on VIP secretion.
It was suggested that hypothalamic VIP secretion was, at least partially, regulated by the opposing action of two different dopamine receptors. The present study has shown that all five dopamine receptor subtypes studied are localized to the hypothalamus. This region is known to be rich in VIP mRNA [4], and VIP immunoreactivity in turkey infundibulum and median eminence increases coincident with plasma prolactin concentration [6, 7]. It seems likely that at least some VIPergic neurons also express one or more of these receptors. We were unable to detect any differential expression of dopamine receptors in whole hypothalamus, and the possibility remains that changes are restricted to certain nuclei. Hence, any modulation of VIPstimulated secretion of prolactin by differential expression of hypothalamic dopamine receptor numbers remains to be determined. It is suggested that the use of in situ hybridization histochemistry may provide the answer to this question. In the pineal gland, a significant increase in D1D mRNA expression during the turkey hen reproductive cycle was shown. In mammals, the pineal is the primary organ for synthesis and secretion of melatonin, a substance implicated in the maintenance of circadian rhythms [31, 32]. It is possible that activation of pinealocyte D1D receptors may stimulate the release of melatonin in turkeys. In rats, however, it has been shown that pineal dopamine concentrations follow a circadian rhythm and are lowest when the animal is in darkness [33]. Therefore, it also is possible that an increase in turkey pineal dopamine receptor number could be a compensatory mechanism in response to increasing dopamine release. The measurement of pineal dopamine concentrations during the turkey reproductive cycle would be important for answering these questions. The presence of D1 and D2 mRNA subtypes throughout the turkey cortex is in agreement with observations in rats [34, 35] and primates [36]. It has been hypothesized that cortical dopamine receptors may affect dopaminergic regulation in the mammalian striatum [36]. The present study suggests that a similar mechanism modulating dopaminergic neurotransmission may exist in birds, possibly by regulating cortical D1 and D2 receptor subtypes throughout the reproductive cycle. Both D1 and D2 receptor mRNA subtypes were also found in turkey cerebellum. Evidence on the existence of D1 or D2 dopamine receptors in the mammalian cerebellum is currently contradictory. D1 and D2 receptor mRNAs have been found by some investigators [37–40], whereas others have not found D1 or D2 receptor mRNA [37, 41, 42] in the cerebellum. At present, no consensus exists for any functional role that cerebellar dopamine receptors might play; however, the RT-PCR data indicate that changes in D1 and D2 steady-state mRNA levels may be associated with reproductive status. In summary, the present data establish that hypothalamic D1 and D2 receptor mRNAs are not differentially expressed during the turkey reproductive cycle. Interestingly, pituitary D1D and D2 dopamine receptors were differentially expressed during the turkey hen reproductive cycle. It is hypothesized that pituitary dopamine receptors are directly involved in modulating prolactin secretion. Taken together, these results suggest that dopamine may affect hypothalamic VIP release as well as pituitary prolactin secretion. REFERENCES 1. El Halawani ME, Burke WH, Millam JR, Fehrer SC, Hargis BM. Regulation of prolactin and its role in gallinaceous bird reproduction. J Exp Zool 1984; 232:521–529.
D1 AND D2 DOPAMINE RECEPTOR mRNA 2. Ben-Jonathan N. Dopamine: a prolactin-inhibiting hormone. Endocr Rev 1985; 6:564–589. 3. El Halawani ME, Silsby JL, Mauro LJ. Vasoactive intestinal peptide is a hypothalamic prolactin-releasing neuropeptide in the turkey (Meleagris gallopavo). Gen Comp Endocrinol 1990; 78:66–73. 4. Kuenzel WJ, McCune SK, Talbot RT, Sharp PJ, Hill JM. Sites of gene expression for vasoactive intestinal polypeptide throughout the brain of the chick (Gallus domesticus). J Comp Neurol 1997; 381:101–118. 5. Hof PR, Dietl MM, Charnay Y, Martin JL, Bouras C, Palacios JM, Magistretti PJ. Vasoactive intestinal peptide binding sites and fibers in the brain of the pigeon Columba livia: an autoradiographic and immunohistochemical study. J Comp Neurol 1991; 305:393–411. 6. Mauro LJ, Elde RP, Youngren OM, Phillips RE, El Halawani ME. Alterations in hypothalamic vasoactive intestinal peptide-like immunoreactivity are associated with reproduction and prolactin release in the female turkey. Endocrinology 1989; 125:1795–804. 7. Mauro LJ, Youngren OM, Proudman JA, Phillips RE, El Halawani ME. Effects of reproductive status, ovariectomy, and photoperiod on vasoactive intestinal peptide in the female turkey hypothalamus. Gen Comp Endocrinol 1992; 87:481–493. 8. Xu M, Proudman JA, Pitts GR, Wong EA, Foster DN, El Halawani ME. Vasoactive intestinal peptide stimulates prolactin mRNA expression in turkey pituitary cells: effects of dopaminergic drugs. Proc Soc Exp Biol Med 1996; 212:52–62. 9. Hall TR, Harvey S, Chadwick A. Control of prolactin secretion in birds: a review. Gen Comp Endocrinol 1986; 62:171–184. 10. Hall TR, Chadwick A. Dopaminergic inhibition of prolactin release from pituitary glands of the domestic fowl incubated in vitro. J Endocrinol 1984; 103:63–69. 11. Harvey S, Chadwick A, Border G, Scanes CG, Philips TG. Neuroendocrine control of prolactin secretion. In: Scanes CG, Ottinger MA, Kenny AD, Balthazart J, Cronshaw J, Jones IC (eds.), Aspects of Avian Endocrinology: Practical and Theoretical Implications. Lubbock, TX: Texas Tech. Press; 1982: 41–64. 12. Fehrer SC. The role of monoamines and thyrotropin releasing hormone in prolactin and luteinizing hormone release by the pituitary gland of the young domestic turkey. In: Animal Physiology. Minneapolis: University of Minnesota; 1984. 13. Youngren OM, Pitts GR, Phillips RE, El Halawani ME. The stimulatory and inhibitory effects of dopamine on prolactin secretion in the turkey. Gen Comp Endocrinol 1995; 98:111–117. 14. Youngren OM, Pitts GR, Phillips RE, El Halawani ME. Dopaminergic control of prolactin secretion in the turkey. Gen Comp Endocrinol 1996; 104:225–230. 15. El Halawani ME, Youngren OM, Silsby JL, Phillips RE. Involvement of dopamine in prolactin release induced by electrical stimulation of the hypothalamus of the female turkey (Meleagris gallopavo). Gen Comp Endocrinol 1991; 84:360–364. 16. Chaiseha Y, Youngren OM, El Halawani ME. Dopamine receptors influence vasoactive intestinal peptide release from turkey hypothalamic explants. Neuroendocrinology 1997; 65:423–429. 17. Demchyshyn LL, Sugamori KS, Lee FJ, Hamadanizadeh SA, Niznik HB. The dopamine D1D receptor. Cloning and characterization of three pharmacologically distinct D1-like receptors from Gallus domesticus. J Biol Chem 1995; 270:4005–4012. 18. You S, Silsby JL, Farris J, Foster DN, El Halawani ME. Tissue-specific alternative splicing of turkey preprovasoactive intestinal peptide messenger ribonucleic acid, its regulation, and correlation with prolactin secretion. Endocrinology 1995; 136:2602–2610. 19. Proudman JA, Opel H. Turkey prolactin: validation of a radioimmunoassay and measurement of changes associated with broodiness. Biol Reprod 1981; 25:573–580. 20. Sibley DR, Monsma FJ. Molecular biology of dopamine receptors. TIPS 1992; 13:61–69. 21. Strange PG. The binding of agonists and antagonists to dopamine receptors. Biochem Soc Trans 1996; 24:188–192.
1383
22. Jarvie KR, Caron MG. Heterogeneity of dopamine receptors. Adv Neurol 1993; 60:325–333. 23. Jaber M, Robinson SW, Missale C, Caron MG. Dopamine receptors and brain function. Neuropharmacology 1996; 35:1503–1519. 24. Civelli O, Bunzow JR, Grandy DK, Zhou QY, Van Tol HH. Molecular biology of the dopamine receptors. Eur J Pharmacol 1991; 207:277– 286. 25. Bates MD, Gingrich JA, Bunzow JR, Falardeau P, Dearry A, Senogles SE, Civelli O, Caron MG. Molecular characterization of dopamine receptors. Am J Hypertens 1990; 3:29S–33S. 26. Porter TE, Grandy D, Bunzow J, Wiles CD, Civelli O, Frawley LS. Evidence that stimulatory dopamine receptors may be involved in the regulation of prolactin secretion. Endocrinology 1994; 134:1263– 1268. 27. El Halawani ME, Youngren OM, Silsby JL, Phillips RE. Prolactin release following electrical stimulation of the brain in female turkeys (Meleagris gallopavo). Gen Comp Endocrinol 1987; 65:1–8. 28. Pitts GR, Youngren OM, Silsby JL, Foster LK, Foster DN, Rozenboim I, Phillips RE, El Halawani ME. Role of vasoactive intestinal peptide in the control of prolactin-induced turkey incubation behavior. I. Acute infusion of vasoactive intestinal peptide. Biol Reprod 1994; 50:1344– 1349. 29. Opel H, Proudman JA. Stimulation of prolactin release in turkeys by vasoactive intestinal peptide. Proc Soc Exp Biol Med 1988; 187:455– 460. 30. Youngren OM, Silsby JL, Rozenboim I, Phillips RE, El Halawani ME. Active immunization with vasoactive intestinal peptide prevents the secretion of prolactin induced by electrical stimulation of the turkey hypothalamus. Gen Comp Endocrinol 1994; 95:330–336. 31. Reiter RJ. Reproductive effects of the pineal gland and pineal indoles in the syrian hamster and the albino rat. In: Reiter RJ (ed.), The Pineal Gland, vol. 2. Boca Raton, FL: CRC; 1981: 45–81. 32. Reiter RJ. The role of light and age in determining melatonin production in the pineal gland. In: Axelrod J, Fraschini F, Velo GP (eds.), The Pineal Gland and Its Endocrine Role. New York: Plenum; 1983: 227–241. 33. Saavedra JM, Barden N, Chevillard C, Fernandez-Pardal J. Twentyfour-hour rhythm and effects of stress and adrenomedullectomy on rat pineal dopamine, noradrenaline and adrenaline concentrations. Cell Mol Neurobiol 1982; 2:1–10. 34. Gaspar P, Bloch B, Le Moine C. D1 and D2 receptor gene expression in the rat frontal cortex: cellular localization in different classes of efferent neurons. Eur J Neurosci 1995; 7:1050–1063. 35. Weiner DM, Levey AI, Sunahara RK, Niznik HB, O’Dowd BF, Seeman P, Brann MR. D1 and D2 dopamine receptor mRNA in rat brain. PNAS 1991; 88:1859–1863. 36. Goldman-Rakic PS, Lidow MS, Gallager DW. Overlap of dopaminergic, adrenergic, and serotoninergic receptors and complementarity of their subtypes in primate prefrontal cortex. J Neurosci 1990; 10: 2125–2138. 37. Dietl MM, Palacios JM. Neurotransmitter receptors in the avian brain. I. Dopamine receptors. Brain Res 1988; 439:354–359. 38. Levey AI, Hersch SM, Rye DB, Sunahara RK, Niznik HB, Kitt CA, Price DL, Maggio R, Brann MR, Ciliax BJ. Localization of D1 and D2 dopamine receptors in brain with subtype-specific antibodies. PNAS 1993; 90:8861–8865. 39. Neve KA, Neve RL, Fidel S, Janowsky A, Higgins GA. Increased abundance of alternatively spliced forms of D2 dopamine receptor mRNA after denervation. PNAS 1991; 88:2802–2806. 40. Ricci A, Mammola CL, Vega JA, Zaccheo D, Amenta F. Density and pattern of dopamine D2-like receptors in the cerebellar cortex of aged rats. Neurobiol Aging 1996; 17:45–52. 41. Ariano MA, Sibley DR. Dopamine receptor distribution in the rat CNS: elucidation using anti-peptide antisera directed against D1A and D3 subtypes. Brain Res 1994; 649:95–110. 42. De Keyser J, Claeys A, De Backer JP, Ebinger G, Roels F, Vauquelin G. Autoradiographic localization of D1 and D2 dopamine receptors in the human brain. Neurosci Lett 1988; 91:142–147.
