De novo tetrahydrobiopterin biosynthesis is impaired ...

Cell Biology International ISSN 1065-6995 doi: 10.1002/cbin.10969

SHORT COMMUNICATION

De novo tetrahydrobiopterin biosynthesis is impaired in the inflammed striatum of parkin(/) mice Roberta de Paula Martins1, Viviane Glaser1, Aderbal S. Aguiar Jr1, bora da Luz Scheffer1, Priscila Maximiliano de Paula Ferreira1, Karina Ghisoni1, De 2 3 3 Laurence Lanfumey , Rita Raisman-Vozari , Olga Corti , Ana Lucia De Paul4, Rodrigo Augusto da Silva1,5 and Alexandra Latini 1* rio de Bioenerg gicas, Universidade Federal de 1 Laborato etica e Estresse Oxidativo—LABOX, Departamento de Bioquımica, Centro de Ci^ encias Biolo polis, Brazil Santa Catarina, Floriano 2 INSERM UMR 894, Centre de Psychiatrie et Neurosciences, Paris, France ^pital de la Piti 3 Institut de Cerveau et de la Moelle Epini ere, Ho e Salp^ etri ere, Paris, France nica, Instituto de Investigaciones en Ciencias de la Salud (INICSA-CONICET), Facultad de Ciencias M 4 Centro de Microscopia Electro edicas, Universidad rdoba, Co rdoba, Argentina Nacional de Co 5 Faculdade de Odontologia, Area de Pesquisa em Epigen etica, Universidade Paulista, S~ ao Paulo, Brazil

Abstract Parkinson’s disease (PD), the second-most prevalent neurodegenerative disease, is primarily characterized by neurodegeneration in the substantia nigra pars compacta, resulting in motor impairment. Loss-of-function mutations in parkin are the major cause of the early onset familial form of the disease. Although rodents deficient in parkin (parkin(/)) have some dopaminergic system dysfunction associated with central oxidative stress and energy metabolism deficiencies, these animals only display nigrostriatal pathway degeneration under inflammatory conditions. This study investigated the impact of the inflammatory stimulus induced by lypopolisaccharide (LPS) on tetrahydrobiopterin (BH4) synthesizing enzymes (de novo and salvage pathways), since this cofactor is essential for dopamine synthesis. The mitochondrial content and architecture was investigated in the striatum of LPS-exposed parkin(/) mice. As expected, the LPS (0.33 mg/kg; i.p.) challenge compromised spontaneous locomotion and social interaction with juvenile parkin(/) and WT mice. Moreover, the genotype impacted the kinetics of the investigation of the juvenile. The inflammatory scenario did not induce apparent changes in mitochondrial ultrastructure; however, it increased the quantity of mitochondria, which were of smaller size, and provoked the perinuclear distribution of the organelle. Furthermore, the BH4 de novo biosynthetic pathway failed to be upregulated in the LPS challenge, a well-known stimulus for its activation. The LPS treatment increased sepiapterin reductase (SPR) expression, suggesting compensation by the salvage pathway. This might indicate that dopamine synthesis is compromised in parkin(/) mice under inflammatory conditions. Finally, this scenario impaired the striatal expression of the transcription factor BDNF, possibly favoring cell death. Keywords: GTP cyclohydrolase; inflammation; mitochondria; neurodegeneration; parkin; tetrahydrobiopterin

Introduction Parkinson’s disease (PD) is the second most common neurodegenerative disease after Alzheimer’s disease (AD)

and the incidence rate is around 1–2% of the population over 60 and 3–4% over 80 years (Nussbaum and Ellis, 2003; Gray et al., 2006). Most PD cases are sporadic; however, approximately 5–10% arise from inherited mutations with

Corresponding author: e-mail: [email protected]/[email protected] Abbreviations: AD, Alzheimer’s disease; BDNF, brain-derived neurotrophic factor; BH4, tetrahydrobiopterin; GTPCH, triphosphate cyclohydrolase I; HSD17B10, hydroxysteroid dehydrogenase; i.p., intraperitoneal; LPS, lypopolisaccharide; MPTP, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine; PCG1a, proliferator-activated receptor g coactivator 1 a; PD, Parkinson’s disease; PINK, PTEN-induced putative kinase protein 1; PTPS, 6-pyruvoyl tetrahydropterin synthase; SDS, Sequence Detection Systems; SEM, standard error of the mean; SNpc, substantia nigra pars compacta; SPR, sepiapterin reductase; SPSS, Statistical Package for the Social Sciences; TFAM, mitochondrial transcription factor A; TH, tyrosine hydroxylase

Cell Biol Int 9999 (2018) 1–9 © 2018 International Federation for Cell Biology

1

R. de Paula Martins et al.

Striatum tetrahydrobiopterin in parkin mice

early onset of the clinical symptoms (L€ ucking et al., 2000). The main PD hallmark is the degeneration of dopaminergic neurons of the substantia nigra pars compacta (SNpc), the associated loss of dopaminergic inputs to the striatum, which leads to perturbation of basal ganglia circuits, and the presence of Lewy bodies (for revision see Hornykiewicz, 2008). Almost 40% of PD cases beginning before age 45 are caused by loss-of-function mutations in the parkin/PARK2 gene, which encodes the cytosolic E3 ubiquitin protein ligase parkin. This protein mediates the covalent transfer of ubiquitin to protein substrates subjected to degradation by the proteasome (L€ ucking et al., 2000; Dawson and Dawson, 2003). Although parkin has been involved in several processes due to its ability to be recruited to dysfunctional mitochondria displaying low membrane potential and promoting their ubiquitination and mitophagy, it has been suggested that parkin might have a conserved role in maintaining mitochondrial health (Narendra et al., 2008). PD individuals carrying parkin mutations are clinically characterized by mild dystonia, symptomatic improvement following sleep, good response to L-DOPA, and mitochondrial dysfunctions in peripheral leukocytes (M€ uft€ uoglu et al., 2004). Postmortem tissues have shown dopaminergic loss, gliosis, and frequent absence of Lewy bodies in the SNpc (Klein and Westenberger, 2012). On the other hand, parkin deficient mice present variable pathological characteristics, with the absence of a robust parkinsonian phenotype. The parkin knockout mice (parkin(/)), by deletion of exon 3, for example, display normal morphology, a normal number of dopaminergic neurons (Goldberg et al., 2003; FrankCannon et al., 2008), mild mitochondrial alterations or oxidative damage (Palacino et al., 2004; Frank-Cannon et al., 2008; Damiano et al., 2014), and do not show increased vulnerability to the neurotoxin MPTP (1-methyl-4-phenyl1,2,3,6-tetrahydropyridine), which is used to induce experimental PD (Aguiar et al., 2013). However, it has been shown that nigrostriatal degeneration can be induced by inflammation, a mechanism most likely to contribute to the degenerative processes observed in PD patients. In this scenario, several clinical and pre-clinical studies have shown increased pro-inflammatory cytokines and other inflammatory mediators in the brain and cerebrospinal fluid of PD patients and animal experimental models (Cicchetti et al., 2002; Frank-Cannon et al., 2008; McCabe et al., 2017; Rydbirk et al., 2017). In line with this, Frank-Cannon et al. (2008) have demonstrated that low-dose repeated injections of lipopolyssacaride (LPS) impairs fine-motor performance and reduces the number of tyrosine hydroxylase (TH) positive cells—dopamine producing cells—in the SNpc in parkin(/) mice. The synthesis of dopamine is mediated by the ratelimiting enzyme TH, which requires as essential cofactor 2

tetrahydrobiopterin (BH4), a natural occurring pteridine that is produced endogenously (Thony et al., 2000). BH4 intracellular concentrations are maintained by multiple metabolic routes; the de novo, the recycling and the salvage pathways (for a review see Ghisoni et al., 2015). The de novo synthesis of BH4 is composed by the enzymes guanosine triphosphate cyclohydrolase I (GTPCH), 6-pyruvoyl tetrahydropterin synthase (PTPS) and sepiapterin reductase (SPR). GTPCH is the rate-limiting enzyme of the de novo pathway, and it is transcriptionally regulated by inflammatory stimuli, including IFN-g, LPS, IL-1b, and hydrogen peroxide (Werner et al., 2011). Thus, during inflammatory conditions the de novo pathway is stimulated and large quantities of BH4 and neopterin, which is the byproduct and biomarker of inflammation, are formed (Thony et al., 2000). It is generally accepted that in basal conditions the de novo pathway is mainly active in the brain to assure the synthesis of neurotransmitters, while the recycling and salvage pathways are believed to occur mainly in the liver (Thony et al., 2000). BH4 defective metabolism has also been proposed to be linked to the pathophysiology of PD; however, the metabolism in experimental models of PD and particularly in parkin(/) mice is virtually unknown. Thus, the main objective of this study was to investigate the impact of inflammation on the BH4 pathway and mitochondrial content in the striatum of parkin(/) mice. Results and discussion Parkin/PARK2 gene mutations are the causative factor for nearly half of early onset PD cases (L€ ucking et al., 2000; Dawson and Dawson, 2003). Although mitochondrial dysfunction has been extensively involved in PD pathogenesis—mitochondrial impairments have been described in the brain and peripheral tissues of patients affected by idiopathic PD and also by parkin mutations (M€ uft€ uoglu et al., 2004; Bender et al., 2006)—only slight alterations have been described in the brain of these animals (Palacino et al., 2004; Frank-Cannon et al., 2008; Damiano et al., 2014). Furthermore, parkin(/) mice by deletion of exon 3 only present substantial loss of dopaminergic neurons when challenged with inflammatory stimuli (Frank-Cannon et al., 2008). Therefore, we first investigated the effect of LPS (0.33 mg/kg; single injection) on behavior, and the striatal mitochondrial architecture, content, size, cellular distribution and mitochondrial transcription factor A (TFAM) gene expression in parkin(/) mice (Figure 1A). Figures 1B–E shows that spontaneous locomotion and social interaction (number of investigations and cumulative time of investigations) with a juvenile animal is not altered in 10-month-old parkin(/) mice. As expected, LPS challenge exposure compromised these parameters, with an effect that is dependent on the parkin(/) genotype only when observing the min. Cell Biol Int 9999 (2018) 1–9 © 2018 International Federation for Cell Biology



Figure 1 Effect of lipopolysaccharide (LPS) administration on behavior and mitochondrial morphology in the striatum of parkin(/) mice. The locomotor activity of ten-month-old knockout (deletion of exon 3) parkin mice (/) and wild type mice (þ/þ) was evaluated. Animals received a single LPS (0.33 mg/kg) or vehicle (saline) intraperitoneal injection (n ¼ 8 animals per group). Behavior (4 h after LPS administration) and striatal mitochondrial content, morphology and localization and TFAM gene expression (4.5 h after LPS) were assessed (A). Spontaneous locomotion in the open field arena was assessed before (B) and after (C) LPS administration. Social interaction with a juvenile animal was assessed by measuring the number (D), accumulated time of investigations (E) and investigation min. by min (8 min recording is shown; F). Ultrastructural analyses of striatal samples were performed by transmission electron microscopy, with magnification of 20,000 (G–J). The content (K), area (L), and distance (M) from the nuclear membrane were assessed by using the ImageJ1 software (n ¼ 3 animals per group). The gene expression of TFAM (N) was analyzed by RT-PCR shown as the ratio of the studied transcripts relative to b-actin (n ¼ 4–5 animals per group). Values are presented as mean SEM. P < 0.05; P < 0.001, vehicle versus LPS; #P < 0.05, (þ/þ) versus (/) (Two-way ANOVA followed by the post hoc of Tukey). Bars, 1 mm; m, mitochondria; n, nuclear membrane; a, mitochondrial area; d, distance between mitochondria and nuclear membrane.

by min. kinetics of investigation of the juvenile (1–8 min; Figure F) (spontaneous locomotion: [F(1,27) ¼ 40.24; P < 0.001]; number of investigations: [F(1,22) ¼ 13.70; P < 0.01 and t(9) ¼ 13.12; P < 0.001; parkin (/) Veh vs. LPS]; time of investigations: [F(1,27) ¼ 21.87; P < 0.001]). These results are in agreement with previous studies showing that adult parkin(/) mice (6–18-month-old) do not present noticeable motor performance impairment measured through the open field test (Goldberg et al., 2003; Aguiar et al., 2013), which can be worsened after chronic low-dose intraperitoneal injections of LPS (Frank-Cannon et al., 2008).


As shown in Figures 1G–J, no apparent changes were observed in mitochondrial ultrastructure in the striatum of parkin(/) mice, where mitochondria showed wellformed and defined cristae, without swelling or separation of the mitochondrial membranes. However, the mitochondrial number was increased in the striatum of parkin(/) mice compared to WT controls (Figure 1K). This effect was significantly potentiated by the LPS exposure, which also resulted in mitochondria with smaller area (Figures 1K and 1L) in the striatum of both parkin(/) and WT mice (number of mitochondria: effect of LPS [F(1,82) ¼ 28.78; P < 0.001], effect of genotype [F(1,82) ¼ 4.97; P < 0.05],

3


interaction [F(1,82) ¼ 4.63; P < 0.05]; size of mitochondria: [F(1,82) ¼ 26.95; P < 0.001], no interaction with genotype). Furthermore, parkin(/) mice exposed to LPS also showed a particular perinuclear redistribution of mitochondria (effect of LPS [F(1,73) ¼ 9.55; P < 0.01], effect of genotype [F(1,73) ¼ 23.11; P < 0.001], interaction [F(1,73) ¼ 11.40; P < 0.01]; Figure 1G). Finally, the increased mitochondrial number appears not to be linked to mitochondrial biogenesis, since the expression of TFAM was reduced in parkin(/) mice, and severely compromised in LPSreceiving mice parkin(/) and WT mice (effect of LPS [F(1,13) ¼ 32.71; P < 0.001], effect of genotype [F(1,13) ¼ 5.13; P < 0.05], interaction [F(1,73) ¼ 5.57; P < 0.05]; Figure 1K). Normal gross morphology of mitochondria in the striatum of parkin(/) mice has previously been reported by Palacino et al. (2004), despite deficiencies of many respiratory complex chain proteins (content and activity), impaired oxygen consumption and marked oxidative stress. Similar impairments were also described by Damiano et al. (2014), specifically in the striatum, without changes in citrate synthase activity, which suggests the mitochondrial mass was not altered in parkin(/) mice. The impaired TFAM expression in the striatum of parkin(/) mice is a novelty of this study; however, it did not have an impact on mitochondrial morphology, and the number of organelles were not reduced (Figures 1K–N). It would be expected that the marked reduction of TFAM expression would correlate with the reduced mitochondrial number. However, this phenomenon might have been counterbalanced and therefore masked by impaired mitophagy or mitochondrial dynamics. Additional evidence of reduced mitochondrial biogenesis has also been suggested by Shin et al. (2011), showing the involvement of parkin in the activation of the peroxisome proliferator-activated receptor g coactivator 1 a (PCG-1a)-dependent transcription—PCG-1a, a master transcriptional regulator that favors mitochondrial biogenesis. In addition, Bertolin et al. (2015) also demonstrated that parkin is required for the biogenesis of a specific mitochondrial protein, hydroxysteroid dehydrogenase (HSD17B10), and the levels of this protein have been found to be reduced in parkin(/) mice and in the ventral midbrain of PD patients (Bertolin et al., 2015). On the other hand, since parkin is involved in the removal of dysfunctional mitochondria by autophagy (Yang and Yang, 2013), this could contribute to the increase in the number of the organelle and the perinuclear clustering in parkin(/) mice. In this context, it is known that mitochondria are mainly produced in neuronal cell bodies and then delivered to sites with high metabolic demand, such as the synapses or nodes of Ranvier, and that dysfunctional mitochondria return to the soma for degradation by the autophagy– lysosomal system (Saxton and Hollenbeck, 2012). Therefore, it is possible that the increased perinuclear number of 4


mitochondria observed in the striatum of parkin(/) mice (vehicle-treated) could result from organelles transported to the soma for repair and/or degradation. However, it cannot be ruled out that deficient mitochondrial trafficking in parkin(/) striatal cells segregated the organelles in the periphery of the nucleus. In this context, it has been reported that Miro and Milton participate in the transport of the organelles by interacting with microtubules as well as parkin and PINK1 (PTEN-induced putative kinase protein 1), another protein related to familial forms of PD, known to coregulate mitochondrial quality-control together with parkin (Wang et al., 2011). This suggests that the loss-of-function of parkin might have provoked the mitochondrial segregation. Finally, it has been reported that parkin also modulates microtubule stability, which could also have an indirect role in mitochondrial transport and the resultant perinuclear distribution of the organelles (Yang et al., 2005). Since dopamine levels rely on the activity of the BH4 de novo pathway, the expression of the biosynthetic enzymes GTPCH, PTPS, and SPR were measured in the striatum of parkin(/) mice exposed to LPS. Figures 2A–C show that parkin(/) genotype per se did not change the expression of BH4-related enzymes, while LPS administration failed to upregulate GTPCH in parkin(/) mice (effect of LPS on GTPCH in parkin(þ/þ) [t(5) ¼ 2.61; P < 0.05]). It is known that GTPCH is transcriptionally controlled by IFN-g, IL-1b, TNF-a, and hydrogen peroxide, among others (for a review see Ghisoni et al., 2015), and that the expression and content of GTPCH and the levels of the biomarker neopterin increased in wild type rodents receiving similar LPS doses after 4–6 h (Kaneko et al., 2001; Ota et al., 2007; de Paula Martins et al., 2018). The lack of GTPCH upregulation suggests a possible interaction with or dependence on mitochondrial homeostasis. Foxton et al. (2007) has previously proposed BH4 to be essential for mitochondrial activity because of the antioxidant capacity (Foxton et al., 2007). However, the inverse relationship is virtually unknown, and parkin might be the connection. The physiopathology of the two most common neurodegenerative diseases, AD and PD, has been extensively linked to mitochondrial dysfunction, and patients affected by these disorders also present low levels of BH4 in cerebrospinal fluid (Lovenberg et al., 1979; Williams et al., 1980), and in the putamen and SNpc of postmortem samples from AD individuals (Sawada et al., 1987). In addition, autosomal dominant mutations in the GCH1 gene (GTP cyclohydrolase1) and more rarely autosomal recessive mutations in the TH or SPR genes cause a disease called doparesponsive dystonia (DRD), considered a major clinical sign of juvenile parkinsonism caused by mutations in the PARK2/parkin gene (Clot et al., 2009; Tassin et al., 2000). However, patients with parkin gene mutations usually present precocious and severe levodopa induced dyskinesias, Cell Biol Int 9999 (2018) 1–9 © 2018 International Federation for Cell Biology



Figure 2 Effect of LPS administration on the gene expression of the tetrahydrobiopterin de novo biosynthetic enzymes in the striatum of parkin(/) mice. Ten-month-old parkin mice received a single LPS intraperitoneal injection (0.33 mg/kg). After 4.5 h, the striatum was dissected and prepared for RT-PCR. The gene expression of GTPCH (A), PTPS (B), and SPR (C) are shown as the ratio of the studied transcripts relative to b-actin measured in triplicate. Values are presented as mean SEM (n ¼ 3–4 animals per group). P < 0.001 vehicle versus LPS; #P ¼ 0.055 (þ/þ) versus (/) (Two-way ANOVA followed by the post hoc of Tukey); &P < 0.05 vehicle versus LPS (Student t-test).

as opposed to those with DRD, probably due to dopaminergic cell loss in substantia nigra (Mori et al., 1998). In this context, it is reasonable to propose that impaired BH4 upregulation, associated with reduced mitochondrial quality-control and enhanced inflammation will reduce dopamine synthesis, promoting cell death. Figures 2B and 2C also show that PTPS, as a constitutive enzyme, did not change its expression under the inflammatory stimulus; however, SPR was significantly upregulated in the striatum of LPS-receiving mice (effect of LPS [F(1,7) ¼ 29.14; P < 0.001], effect of genotype [F(1,7) ¼ 5.13; P ¼ 0.055], with no interaction; Figure 2C), probably in an attempt to control BH4 intracellular levels. This also suggests that the salvage pathway (SPR participates in the de novo and salvage pathways) might be also triggered under inflammation, and that the parkin mice would upregulate this enzyme in order to counterbalance the impaired de novo pathway. This is further supported by studies showing that sepiapterin treatment (substrate of SPR in the salvage pathway) attenuated the dopamine depletion and the decrease in TH-positive cells induced by MPPþ in organotypic rat ventral mesencephalic slice cultures (Madsen et al., 2003). Finally, as shown in Figure 3, LPS failed to stimulate the expression of BDNF (brain-derived neurotrophic factor)—a neurotrophic factor involved in neuroplasticity—in parkin (/) mice (effect of LPS [F(1,8) ¼ 7.42; P < 0.05], effect of genotype [F(1,13) ¼ 36.09; P < 0.001], interaction [F(1,8) ¼ 20.59; P < 0.001]). BDNF induces the translation of mRNAs encoding critical proteins for synaptic plasticity, learning and memory, including Arc (Yin et al., 2002), N-methyl-Daspartate receptor subunits, the postsynaptic density scaffolding Cell Biol Int 9999 (2018) 1–9 © 2018 International Federation for Cell Biology

protein Homer2 (Schratt, 2004), and CamKII (Aakalu et al., 2001). In addition, dopaminergic neurons express BDNF mRNA in the rat ventral midbrain (Seroogy et al., 1994), and loss-offunction mutations or low levels of this neurotrophic factor have been associated with cognitive impairment in PD patients (Altmann et al., 2016; Wang et al., 2016). The compromised BDNF expression in LPS-exposed parkin(/) mice, might further contribute to cell death and behavioral impairment. Conclusion Here we report that parkin(/) mice carrying a deletion in exon 3 display impairments in the main pathway responsible for maintaining BH4 levels in the CNS, an essential cofactor for dopamine synthesis, under inflammatory conditions. Concomitant to this alteration, striatum cells do not upregulate BDNF to confer neuroprotection in LPS-exposed mice, displaying an increased number of mitochondria of smaller size with perinuclear clustering. These findings suggest that besides its role in mitochondrial quality-control and trafficking, parkin might be a key molecule in signaling BH4 synthesis. Materials and methods

Animals and treatment Parkin(/) mice were generated and brought into the C57BL/6J genetic background as previously described (Fournier et al., 2009) (PMID: 24192137). Experimental groups of age-matched littermate parkin(/) and wild 5



LPS-induced neuroinflammation Inflammation was induced by the administration of a single intraperitoneal (i.p.) injection of Escherichia coli lipopolysaccharide (LPS; E. coli LPS, 0.33 mg/kg, serotype 0127:B8). Control animals received vehicle injections (saline; i.p.). The LPS dosage was selected due to the already known proinflammatory cytokine response in the adult mice brains (Henry et al., 2009; Ghisoni et al., 2015; de Paula Martins et al., 2018). Behavioral tests were performed 4 h after LPS administration. Then, the animals were euthanized, the brain dissected and the striatum collected for subsequent analysis. Some animals were perfused with 0.9% saline solution in order to perform transmission electron microscopy. After perfusion, the striatum was dissected and stored for 48 h in fixative solution containing 4% paraformaldehyde and 2% glutaraldehyde.

Behavioral tests Open field test The open field test was used to evaluate spontaneous locomotor activity. The animals were placed in the center of the open field arena (40 40 cm) and recorded for 10 min in order to evaluate the total distance traveled. The tests were videorecorded and analyzed by ANY-maze PlatformTM as we previously described (Aguiar et al., 2013).

Figure 3 Effect of LPS administration on BDNF gene expression in the striatum of parkin(/) mice. Ten-month-old parkin and wild type mice received a single LPS intraperitoneal injection (0.33 mg/kg). After 4.5 h, the striatum was dissected and prepared for RT-PCR. The BDNF expression is shown as the ratio of the studied transcripts relative to b-actin measured in triplicate. Values are presented as mean SEM (n ¼ 3–4 animals per group). P < 0.01 vehicle versus LPS; #P < 0.05 (þ/þ) versus (/) (Two-way ANOVA followed by the post hoc of Tukey).

type mice were generated by intercross of heterozygous parkin(/þ) mice. Genotypes were determined as described in Fournier et al. (2009). To investigate the role of parkin in the LPS-induced neuroinflammation model, we used 10month-old homozygous C57BL/6 mice with parkin gene deletion on exon 3 (parkin(/)) and strain-matched controls (þ/þ or WT). For the social interaction test, 3-week-old C57BL/6 mice were also used. The animals were maintained on a 12-h light/dark cycle in controlled temperature 23 1 C, with free access to water and protein commercial chow. All procedures were performed in accordance with the Committee on Care and Use of Laboratory Animals of the Institute of Laboratory Animal Resources (NIH publication, Bethesda, U.S.).

6

Social interaction test Social interactions are a fundamental and adaptive component of the biology of numerous species, including mice. Social recognition is critical for the structure and stability of the networks and relationships, which may be important for maintaining social hierarchy and for mate choice. This rodent familiar behavior was assessed by the interaction of ten-month-old parkin mice with a juvenile (3week-old) C57/BL6 mouse. First, the animals were habituated to the test environment for two consecutive days. On the third day, mice were exposed to LPS (0.33 mg/kg) and kept in separate cages. Four hours later, an unfamiliar juvenile C57BL/6J male (3-week-old), without previous contact with the parkin mice, was placed in the center of the arena, restricted to a small wire cage (Stoelting Co). Social interaction was evaluated by the number and the time the adult animal interacted with the juvenile C57BL/6J for 10 min. The experiment was recorded on video and subsequently analyzed in ANY-maze TM platform (Martin et al., 2013).

Gene expression analysis by quantitative real-time PCR Total RNA was isolated from striatum samples by using the TRIzol1/chloroform/isopropanol method. The quantity




Table 1 Primers used to assess the gene expression. Protein b-actin TFAM GTPCH PTPS SPR BDNF

Forward sequence 0

Reverse sequence 0

5 GCGTCCACCCGCGAGTACAAC 3 50 GTGAGACGAACCGGACGGCG 30 50 TGAGCCCCAGTCCGGGTGAC 30 50 GTCCTTCAGCGCGAGCCACC 30 50 CCGAGTGTGCGGGTGCTGAG 30 50 TGCAGGGGCATAGACAAAAG 30

and purity of extracted RNA was estimated by using the spectrophotometer apparatus NanoDrop, at 260 and 280 nm. The cDNA was synthesized by reverse transcription kit “M-MLV Reverse Transcriptase” (Sigma), according to the instructions recommended by the manufacturer. qPCR was performed using SYBR Green Master Mix (Applied Science) and specific primers (Table 1) for each gene. The primers were designed using the “BLAST” available at: http://blast.ncbi.nlm.nih.gov/Blast.cgi according exons specific for each protein. Reactions were performed in the ABI PRISM 7900HT equipment (Applied Biosystems, Foster City, USA) in the Multiuser Laboratory for Biological Studies (LAMEB, CCB, UFSC, Brazil). The results were analyzed using Sequence Detection Systems software (SDS) version 2.4. The critical comparative threshold method 2DCt was used to calculate the relative number of transcripts in the samples. In this method, the average Ct gene of interest is subtracted from the average Ct internal control (b-actin), resulting in a DCt. To calculate gene expression, the DCt value obtained is replaced in 2DCt formula. The obtained final numbers are presented as the ratio between the expressions of the gene of interest relative to the internal control gene. The results were expressed as mean SEM of three independent animals performed in triplicate.

Transmission electron microscopy After the behavior testing, the mice were anesthetized with chloral hydrate (400 mg/kg, i.p.) and immediately perfused with heparin in physiological saline (0.9% NaCl), followed by perfusion with 4% paraformaldehyde. Then, the striatum was removed and post-fixed in a solution composed by 4% paraformaldehyde and 2% glutaraldehyde in 0.1 M cacodylate buffer for 2 h and then treated with 1% OsO4 before being stained with 1% v/v uranyl acetate. After dehydration with a series of graded cold acetones, glands were embedded in Araldite. For ultrastructural studies, thin sections (70– 90 nm) were cut with a diamond knife on JEOL JUM-7 ultramicrotome, stained with uranyl acetate/lead citrate and examined using the JEM-101 electron microscope. The micrographs were taken using the capture system from


0

5 CGACGACGAGCGCAGCGATA 30 50 AGACGAGGGGATGCGACCCC 30 50 GTGCTAACAAGCGCTGCGGC 30 50 CCCGTGTGAGGCCCTGGTGT 30 50 CCAGCGCCCCATCCGACTTC 30 50 TGAATCGCCAGCCAATTCTC 30

Gatan Digital Micrograph images (Electron Microscopy Laboratory—LCME, UFSC, Brazil). Sixty micrographs were taken of each sample at a magnification of 20,000 X. The ImageJ1 software was used to measure the mitochondrial content, area and distance from the nuclear membrane. The content of mitochondria in the striatum of parkin(/) mice was determined by analyzing twenty different fields from the striatum of each animal. Each experimental condition was formed by three mice (60 micrographs per experimental condition). The average number of mitochondria per experimental group was calculated and used to depict the results in the graphs.

Statistical analysis Results are expressed as mean standard error of the mean (SEM). Data were analyzed using two-way ANOVA followed by the post hoc of Tukey test, when F was significant. When comparing two independent groups, Student t test for independent samples was used. Only significant values are given in the text. Differences between the groups were rated significant at P < 0.05. Statistics were performed using SPSS (Statistical Package for the Social Sciences software; version 16.0 for Windows). All graphs were performed using GraphPad Prism 51. Acknowledgments and funding This manuscript is part of the series Mitochondria and energy metabolism, which refers to the proceedings of the X MitoMeeting, organized by Anibal E Vercesi, Helena Oliveira and Leonardo R Silveira, held in Guape, MG, Brazil, April 27– 30th 2017. The authors are grateful to Theodore Griswold for language editing. This work was supported by grants from CNPq (Conselho Nacional de Desenvolvimento Cientıfico e Tecnol ogico, Brazil), CAPES (CoordenaSc ~ao de AperfeiSc oamento de Pessoal de Nıvel Superior, Brazil), FAPESC/CNPq (Programa de Apoio a N ucleos de Excelência PRONEX; NENASC Project) and Fondation ICM, “Investissements d’avenir” ANR-10-IAIHU-06. Aguiar Jr, AS and Latini, A are CNPq fellows.

7


References Aakalu G, Smith WB, Nguyen N, Jiang C, Schuman EM (2001) Dynamic visualization of local protein synthesis in hippocampal neurons. Neuron 30: 489–502. Aguiar AS, Trist~ao FSM, Amar M, Chevarin C, Lanfumey L, Mongeau R, Corti O, Prediger RD, Raisman-Vozari R (2013) Parkin-knockout mice did not display increased vulnerability to intranasal administration of 1-methyl-4-phenyl-1,2,3,6tetrahydropyridine (MPTP). Neurotox Res 24: 280–7. Altmann V, Schumacher-Schuh AF, Rieck M, Callegari-Jacques SM, Rieder CRM, Hutz MH (2016) Val66Met BDNF polymorphism is associated with Parkinson’s disease cognitive impairment. Neurosci Lett 615: 88–91. Bender A, Krishnan KJ, Morris CM, Taylor GA, Reeve AK, Perry RH, Jaros E, Hersheson JS, Betts J, Klopstock T, Taylor RW, Turnbull DM (2006) High levels of mitochondrial DNA deletions in substantia nigra neurons in aging and Parkinson disease. Nat Genet 38: 515–7. Bertolin G, Jacoupy M, Traver S, Ferrando-Miguel R, Saint Georges T, Grenier K, Ardila-Osorio H, Muriel M-P, Takahashi H, Lees AJ, Gautier C, Guedin D, Coge F, Fon EA, Brice A, Corti O (2015) Parkin maintains mitochondrial levels of the protective Parkinson’s disease-related enzyme 17-b hydroxysteroid dehydrogenase type 10. Cell Death Differ 22: 1–4. Cicchetti F, Brownell AL, Williams K, Chen YI, Livni E, Isacson O (2002) Neuroinflammation of the nigrostriatal pathway during progressive 6-OHDA dopamine degeneration in rats monitored by immunohistochemistry and PET imaging. Eur J Neurosci 15(6): 991–8. Clot F, Grabli D, Cazeneuve C, Roze E, Castelnau P, Chabrol B, Landrieu P, Nguyen K, Ponsot G, Abada M, Doummar D, Damier P, Gil R, Thobois S, Ward AJ, Hutchinson M, Toutain A, Picard F, Camuzat A, Fedirko E, Sân C, Bouteiller D, LeGuern E, Durr A, Vidailhet M, Brice A (2009) Exhaustive analysis of BH4 and dopamine biosynthesis genes in patients with Dopa-responsive dystonia. Brain 132: 1753–63. Damiano M, Gautier CA, Bulteau AL, Ferrando-Miguel R, Gouarne C, Paoli MG, Pruss R, Auchere F, L’Hermitte-Stead C, Bouillaud F, Brice A, Corti O, Lombes A (2014) Tissue- and cell-specific mitochondrial defect in Parkin-deficient mice. PLoS ONE 9(6): e99898. Dawson TM, Dawson VL (2003) Rare genetic mutations shed light on the pathogenesis of Parkinson disease. J Clin Invest 111: 145–51. de Paula Martins R, Ghisoni K, Lim CK, Aguiar AS, Guillemin GJ, Latini A (2018) Neopterin preconditioning prevents inflammasome activation in mammalian astrocytes. Free Radic Biol Med 115: 371–82. Fournier M, Vitte J, Garrigue J, Langui D, Dullin JP, Saurini F, Hanoun N, Perez-Diaz F, Cornilleau F, Joubert C, ArdilaOsorio H, Traver S, Duchateau R, Goujet-Zalc C, Paleologou K, Lashuel HA, Haass C, Duyckaerts C, Cohen-Salmon C, Kahle PJ, Hamon M, Brice A, Corti O (2009) Parkin deficiency delays motor decline and disease manifestation in a mouse model of synucleinopathy. PLoS ONE 4(8): e6629.

8


Foxton RH, Land JM, Heales SJR (2007) Tetrahydrobiopterin availability in Parkinson’s and Alzheimer’s disease; potential pathogenic mechanisms. Neurochem Res 32: 751–6. Frank-Cannon TC, Tran T, Ruhn KA, Martinez TN, Hong J, Marvin M, Hartley M, Trevino I, O’Brien DE, Casey B, Goldberg MS, Tansey MG (2008) Parkin Deficiency Increases Vulnerability to Inflammation-Related Nigral Degeneration. J Neurosci 28: 10825–34. Ghisoni K, Martins R, Barbeito L, Latini A (2015) Neopterin as a potential cytoprotective brain molecule. J Psychiatr Res 71: 134–9. Goldberg MS, Fleming SM, Palacino JJ, Cepeda C, Lam HA, Bhatnagar A, Meloni EG, Wu N, Ackerson LC, Klapstein GJ, Gajendiran M, Roth BL, Chesselet MF, Maidment NT, Levine MS, Shen J (2003) Parkin-deficient Mice Exhibit Nigrostriatal Deficits but not Loss of Dopaminergic Neurons. J Biol Chem 278: 43628–35. Gray J, Yeo GSH, Cox JJ, Morton J, Adlam ALR, Keogh JM, Yanovski JA, El Gharbawy A, Han JC, Tung YCL, Hodges JR, Raymond FL, O’rahilly S, Farooqi IS (2006) Hyperphagia, severe obesity, impaired cognitive function, and hyperactivity associated with functional loss of one copy of the brain-derived neurotrophic factor (BDNF) gene. Diabetes 55: 3366–71. Henry CJ, Huang Y, Wynne AM, Godbout JP (2009) Peripheral lipopolysaccharide (LPS) challenge promotes microglial hyperactivity in aged mice that is associated with exaggerated induction of both pro-inflammatory IL-1beta and antiinflammatory IL-10 cytokines. Brain Behave Immun 23: 309–17. Hornykiewicz O (2008) Basic research on dopamine in Parkinson’s disease and the discovery of the nigrostriatal dopamine pathway: the view of an eyewitness. Neurodegener Dis 5(3–4): 114–7. Kaneko YS, Ikemoto K, Mori K, Nakashima A, Nagatsu I, Ota A (2001) Expression of GTP cyclohydrolase I in murine locus ceruleus is enhanced by peripheral administration of lipopolysaccharide. Brain Res 890: 203–10. Klein C, Westenberger A (2012) Genetics of Parkinson ’ s Disease. Cold Spring Harb Perspect Med 2: 1–5. Lovenberg W, Levine RA, Robinson DS, Ebert M, Williams AC, Calne DB (1979) Hydroxylase cofactor activity in cerebrospinal fluid of normal subjects and patients with Parkinson’s disease. Science 204: 624–6. L€ ucking CB, D€ urr A, Bonifati V, Vaughan J, De Michele G, Gasser T, Harhangi BS, Meco G, Denefle P, Wood NW, Agid Y, Brice A (2000) Association between early-onset Parkinson’s disease and mutations in the parkin gene. N Engl J Med 342: 1560–7. Madsen JT, Jansen P, Hesslinger C, Meyer M, Zimmer J, Gramsbergen JB (2003) Tetrahydrobiopterin precursor sepiapterin provides protection against neurotoxicity of 1methyl-4-phenylpyridinium in nigral slice cultures. J Neurochem 85: 214–23. McCabe K, Concannon RM, McKernan DP, Dowd E (2017) Time-course of striatal Toll-like receptor expression in neurotoxic, environmental and inflammatory rat models of Parkinson’s disease. J Neuroimmunol 310: 103–6.



Mori H, Kondo T, Yokochi M, Matsumine H, Nakagawa-Hattori Y, Miyake T, Suda K, Mizuno Y (1998) Pathologic and biochemical studies of juvenile parkinsonism linked to chromosome 6q. Neurology 51: 890–2. € Ercan A, Kulaksiz G, Og€ € us M€ uft€ uoglu M, Elibol B, Dalmizrak O, € H, Dalkara T, Ozer N (2004) Mitochondrial complex I and IV activities in leukocytes from patients with parkin mutations. Mov Disord 19: 544–8. Narendra D, Tanaka A, Suen DF, Youle RJ (2008) Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. J Cell Biol 183(5): 795–803. Nussbaum RL, Ellis CE (2003) Alzheimer’s Disease and Parkinson’s Disease. N Engl J Med 1356–64. Ota A, Kaneko YS, Mori K, Nakashima A, Nagatsu I, Nagatsu T (2007) Effect of peripherally administered lipopolysaccharide (LPS) on GTP cyclohydrolase I, tetrahydrobiopterin and norepinephrine in the locus coeruleus in mice. Stress 10: 131–6. Palacino JJ, Sagi D, Goldberg MS, Krauss S, Motz C, Wacker M, Klose J, Shen J (2004) Mitochondrial Dysfunction and Oxidative Damage in parkin-deficient Mice. J Biol Chem 279: 18614–22. Rydbirk R, Elfving B, Andersen MD, Langbøl MA, Folke J, Winge K, Pakkenberg B, Brudek T, Aznar S (2017) Cytokine profiling in the prefrontal cortex of Parkinson’s Disease and Multiple System Atrophy patients. Neurobiol Dis 106: 269–78. Sawada M, Hirata Y, Arai H, Iizuka R, Nagatsu T (1987) Tyrosine Hydroxylase, Tryptophan Hydroxylase, Biopterin, and Neopterin in the Brains of Normal Controls and Patients with Senile Dementia of Alzheimer Type. J Neurochem 48: 760–4. Saxton WM, Hollenbeck PJ (2012) The axonal transport of mitochondria. J Cell Sci 125: 2095–104. Schratt GM (2004) BDNF Regulates the Translation of a Select Group of mRNAs by a Mammalian Target of RapamycinPhosphatidylinositol 3-Kinase-Dependent Pathway during Neuronal Development. J Neurosci 24: 7366–77. Seroogy KB, Lundgren KH, Tran TMD, Guthrie KM, Isackson PJ, Gall CM (1994) Dopaminergic neurons in rat ventral midbrain



express brain-derived neurotrophic factor and neurotrophin-3 mRNAs. J Comp Neurol 342: 321–34. Shin J, Ko HS, Kang H, Lee Y, Lee Y-II, Pletinkova O, Troconso JC, Dawson VL, Dawson TM (2011) PARIS (ZNF746) repression of PGC-1a contributes to neurodegeneration in Parkinson’s disease. Cell 144(5): 689–702. Tassin J, D€ urr A, Bonnet AM, Gil R, Vidailhet M, L€ ucking CB, Goas JY, Durif F, Abada M, Echenne B, Motte J, Lagueny A, Lacomblez L, Jedynak P, Bartholome B, Agid Y, Brice A (2000) Levodopa-responsive dystonia. GTP cyclohydrolase I or parkin mutations? Brain 123(Pt 6): 1112–21. Thony B, Auerbach G, Blau N (2000) Tetrahydrobiopterin biosynthesis, regeneration and functions. Biochem J 347 (Pt 1): 1e16. Wang X, Winter D, Ashrafi G, Schlehe J, Wong YL, Selkoe D, Rice S, Steen J, Lavoie MJ, Schwarz TL (2011) PINK1 and Parkin target miro for phosphorylation and degradation to arrest mitochondrial motility. Cell 147: 893–906. Wang Y, Liu H, Zhang B-S, Soares JC, Zhang XY (2016) Low BDNF is associated with cognitive impairments in patients with Parkinson’s disease. Park Relat Disord 29: 66–71. Werner ER, Blau N, Th€ ony B (2011) Tetrahydrobiopterin: biochemistry and pathophysiology. Biochem J 438: 397–414. Williams AC, Levine RA, Chase TN, Lovenberg W, Calne DB (1980) CFS hydroxylase cofactor levels in some neurological diseases. J Neurol Neurosurg Psychiatry 43: 735–8. Yang J-Y, Yang WY (2013) Bit-by-bit autophagic removal of parkin-labelled mitochondria. Nat Commun 4. Yang F, Jiang Q, Zhao J, Ren Y, Sutton MD, Feng J (2005) Parkin stabilizes microtubules through strong binding mediated by three independent domains. J Biol Chem 280: 17154–62. Yin Y, Edelman GM, Vanderklish PW (2002) The brain-derived neurotrophic factor enhances synthesis of Arc in synaptoneurosomes. Proc Natl Acad Sci U S A 99: 2368–73. Received 23 October 2017; accepted 31 March 2018.

9