Biochemical and Biophysical Research Communications 486 (2017) 1110e1115
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Defect in the GTPase activating protein (GAP) function of eIF5 causes repression of GCN4 translation Charles Antony A, Pankaj V. Alone* School of Biological Sciences, National Institute of Science Education and Research Bhubaneswar, Constituent Institutes of Homi Bhabha National Institute (HBNI), P.O Jatni, Khurda 752050 India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 21 March 2017 Accepted 1 April 2017 Available online 4 April 2017
In eukaryotes, the eIF5 protein plays an important role in translation start site selection by providing the GAP (GTPase activating protein) function. However, in yeast translation initiation fidelity defective eIF5G31R mutant causes preferential utilization of UUG as initiation codon and is termed as Suppressor of initiation codon (Suie) phenotype due to its hyper GTPase activity. The eIF5G31R mutant dominantly represses GCN4 expression and confers sensitivity to 3-Amino-1,2,4-Trizole (3AT) induced starvation. The down-regulation of the GCN4 expression (Gcne phenotype) in the eIF5G31R mutant was not because of leaky scanning defects; rather was due to the utilization of upUUG initiation codons at the 50 regulatory region present between uORF1 and the main GCN4 ORF. © 2017 Elsevier Inc. All rights reserved.
Keywords: Translation initiation GCN4 expression eIF5 Gcne phenotype Suie phenotype
1. Introduction Selection of AUG start codon in the translation initiation process involves initiation factors including heterotrimeric GTPase$eIF2$GTP$Met-tRNAMet [Ternary Complex (TC)], eIF1, eIF1A, eIF5 i and eIF3 that are assembled on the 40S ribosomal subunit [1,2]. The cooperative interaction of these factors along with mRNA and eIF4F complex result in the formation of 48S complex [3e7]. Proper assembly of 48S complex leads to GTP hydrolysis by the TC with the help of the GTPase activating protein (GAP) eIF5 leading to GDP þ Pi formation; however, the Pi remains bound to the complex [4,8e10]. The 48S complex is proposed to be in a scanning competent “open conformation” and the Met-tRNAMet is considered to be in the POUT i state as it is yet to engage with the mRNA in the P-site [4,11,12]. Base-pairing between the anticodon and an AUG codon causes a conformational change in the Met-tRNAMet resulting in the PIN state i and converts the scanning competent 48S complex from an “open” state to a “closed” non-scanning state with the selection and delivery of Met-tRNAMet to the AUG codon [4,8,13]. i General amino acid control (GAAC) is related to GCN4 protein (bZip family of transcription factors) expression in response to amino acid starvation [14]. The GCN4 protein expression is regulated at translational initiation level by trans-acting factors (products of
* Corresponding author. E-mail address:
[email protected] (P.V. Alone). http://dx.doi.org/10.1016/j.bbrc.2017.04.002 0006-291X/© 2017 Elsevier Inc. All rights reserved.
Gcd and Gcn genes) as well as cis-acting elements, consist of four upstream short open reading frames (uORFs) present at the 50 regulatory region of GCN4 mRNA [14,15]. The GCN4 expression level represents an in-vivo barometer of initiation factor activity and integrity [16]. Any defect in the translation initiation pathways that down-regulates the de-repression of GCN4 protein expression under the starvation condition is termed as the Gcne (general control non de-repressed) phenotype [14]. On the other hand, mutations that constitutively de-repressed GCN4 expression in the absence of the GCN2 kinase are termed the Gcde (general control derepressed) phenotype [17e20]. The Suppressor of initiation codon (Suie) phenotype, first identified in Saccharomyces cerevisiae by Donahue et al., where certain mutants were able to utilize in-frame third UUG codon of the HIS4 gene (HIS4-303 allele) as a translation initiation codon when AUG was mutated to AUU codon, resulting in cell growth on medium lacking histidine [18]. The eIF5G31R mutant was originally isolated as a dominant Suie mutant (SUI5) and observed to be recessive lethal [21,22]. It has been proposed that the Suie phenotype is the result of premature GTPase activity conferred by eIF5G31R mutant that causes premature release of Pi from the 48S complex, leaving Met-tRNAMet at the ribosomal P-site with a mismatch at the i UUG codon [22,23]. The N-terminal and C-terminal domain (NTD and CTD) of eIF5 have been shown to have a distinct function in the translation initiation process. The eIF5-CTD is reported to take part in 48S assembly/post-assembly process and mutations in this region confer both Gcne and Gcde phenotype in a temperature
C. Antony A, P.V. Alone / Biochemical and Biophysical Research Communications 486 (2017) 1110e1115
sensitive manner [24]. However, eIF5-NTD is only implicated in GAP function and none of the mutations in this region are known to be associated with Gcne and Gcde phenotype, suggesting a predominantly regulatory function to this region. Here, we report that the dominant negative hyper GTPase eIF5G31R mutant shows Gcne phenotype due to a novel mechanism that is linked to UUG initiation codon recognition from the 50 regulatory region of the GCN4 transcript. 2. Materials and methods 2.1. Strains The yeast strain used in this study YP823; Mat a, Ura3-52, Leu23, 112, trpD63, GCN2þ, Gal2þ. 2.2. Plasmids and oligonucleotides Plasmids and oligonucleotides used in this study are listed in Table 1 and Table 2 respectively. 2.3. Cloning of eIF5 variants in yeast shuttle vector The eIF5G31R cassette (2.2 kb) was derived from the plasmid pRS313-eIF5G31R (C3097) [provided by Thomas E. Dever] by EcoRSalI digestion and subcloned into pYCplac22 vector at EcoRI-SalI site to generate pYCplac22-eIF5G31R (pA860). Another eIF5 variant (eIF5G31S) was created by fusion PCR using oligonucleotide oPA854, oPA985, oPA986, and oPA855 and plasmid pA860 as a template, and cloned into pYCplac22 vector at EcoRI-SalI site. Recombinant positive clones were identified by using appropriate restriction digestion and further confirmed by DNA sequencing. 2.4. Construction of uORF-less and UUG-less 50 UTR in GCN4-lacZ All the 10 UUG codons of 50 UTR of GCN4 were removed by fusion PCR using oligonucleotide oPA848, oPA871, oPA852, oPA869, oPA868, oPA849, oPA866, oPA892, oPA891, and oPA851 and plasmid p227 as a template. The resultant fusion PCR product (958 bp) is cloned at SalI-BamHI site in p227 by replacing the corresponding 50 UTR region to generate pYCP50-GCN4 lacZ uORF-less and upUUG-less (pA901). 3. Results 3.1. The eIF5G31R mutant shows both Suie and Gcne phenotype The eIF5G31R mutation in the GAP region of eIF5-NTD is by far one of the strongest dominant Suie mutant known, which also shows a strong penchant to initiation at the UUG codon as
1111
compared to alternative initiation codons such as CUG, GUG or UUA, being utilized by other Suie mutants [21]. However, the eIF5G31S mutation was earlier reported to be recessive Suie and Gcnþ [24]. It is possible that G31S substitution may have a weak effect on eIF5 function that could not have affected GCN4 expression. We hypothesize that the strong Suie phenotype of eIF5G31R mutant might affect GCN4 expression. In order to test this hypothesis, we first compared the Suie phenotype of eIF5G31R and eIF5G31S mutant by transforming HIS4AUG-LacZ (p3989) or HIS4UUGLacZ (p3990) reporter constructs along with either empty vector (pA823), eIF5G31R mutant (pA860) or eIF5G31S mutant (pA1034) constructs to yeast strain YP823. The resultant b-galactosidase activity was plotted as UUG/AUG ratio to evaluate the Suie phenotype (Fig. 1A). The eIF5G31R mutant has significantly high UUG/AUG ratio in comparison to vector control. However, no significant difference was observed with eIF5G31S mutant suggesting that G31S substitution has a weak effect on eIF5 function and probably is weak Suie in dominant condition. To test whether G31R substitution causes Gcne phenotype, we used GCN2þ yeast strain (YP823) and transformed with single copy empty vector (pA823) or single copy vector carrying derivatives of TIF5 gene; eIF5WT (pA870), eIF5G31S (pA1034) and eIF5G31R (pA860) and spotted on SCD or SCD þ3AT media. The 3AT is a competitive inhibitor of the HIS3 enzyme and induces histidine starvation [30]. While the wild type (WT) cells can overcome histidine starvation by de-repressing GCN4 expression and grow on 3AT media, the Gcne mutants cannot grow on 3AT media and show 3AT sensitivity. Consistently, the eIF5G31R mutant could not grow on 3AT media in comparison to eIF5G31S mutant and vector control (Fig. 1B), suggesting that eIF5G31R mutant confers Gcne phenotype while eIF5G31S mutant remains Gcnþ possibly due to the weak effect of G31S substitution. Next, we tested the levels of GCN4 expression of these mutants by using (p180) GCN4-LacZ reporter construct as the Gcne mutants down-regulate the GCN4 expression. Consistent with its 3AT sensitivity, the eIF5G31R mutant causes significant down regulation of GCN4 expression, while the eIF5G31S mutant showed no significant difference in GCN4 level in comparison to the vector control (Fig. 1C). The data indeed confirmed that eIF5G31R mutant shows Gcne phenotype. The lower level of GCN4 expression in Gcne phenotype can be attributed to various defects such as slow scanning of uORFs, premature release of the 40S subunit post uORF1 translation, or leaky scanning of uORF1 by the 48S complex. These defects lie downstream of TC formation and they are independent of TC levels regulated by eIF2a phosphorylation by GCN2 kinase [14,31,32]. In order to decipher the molecular mechanism behind Gcne phenotype shown by the eIF5G31R mutant we used the following modified derivatives of GCN4-LacZ (p180) reporter constructs (Fig. 1D). The construct pM226 has point and frameshift mutations that elongate uORF1 and overlapped 130 nucleotides out of frame with GCN4 main ORF [28]. Ribosomes that initiate translation at elongated
Table 1 Plasmids. S.No.
Plasmid number
Plasmid name
Type
1 2 3 4 5 6 7 8 9 10 11
pA823 pA860 pA1034 pA870 p180 p3989 p3990 pM226 pM199 p227 pA901
pYcplac22 pYcplac22-eIF5G31R pYcplac22-eIF5G31S pYcplac22-eIF5WT pYcP50-WT GCN4 lacZ HIS4-lacZAUG HIS4-lacZUUG pYcP50-GCN4 lacZ [uORF1 extended] pYcP50-GCN4 lacZ [uORF1 only with 350 nt 50 UTR] pYcP50-GCN4 lacZ [uORFless] pYcP50-GCN4 lacZ [uORFless and upUUG less (UUG 1 to 10)]
Single Single Single Single Single Single Single Single Single Single Single
Source or reference copy copy copy copy copy copy copy copy copy copy copy
[25] This This This [26] [27] [27] [28] [28] [29] This
study study study
study
1112
C. Antony A, P.V. Alone / Biochemical and Biophysical Research Communications 486 (2017) 1110e1115 Table 2 Oligonucleotides. S.No
Oligo name
Sequence (50 e30 )
1 2 3 4 5 6 7 8 9 10 11 12 13 14
oPA985 oPA986 oPA854 oPA855 oPA848 oPA871 oPA852 oPA869 oPA868 oPA849 oPA866 oPA892 oPA891 oPA851
GAAGGTAGAGGTAACAGTATCAAGACTGCCGTTTTG GTCTTGATACTGTTACCTCTACCTTC CACAGAATTCGAAAACGTAGTGATCAGAGAATCC CATAGTCGACAGGTCATACGGATATTAGC TAACGTCGACCCCGTCCTGTGGATCTTCG GAAATATAATCGGTTTAGCGAGCTTTTTTCAATGATC CTTGCTAAACCGATTATATTTCGTTTTTAAAGTAGATTATTATTAG AATTTTCTCTTTCGATAAATTTAACA TTTATCGAAAGAGAAAATTTATTTTCCCTTATTA GGTAACGAAACGAATAACTCTTCGAAAAACTGACAGTTTTCGAAAAAAGTAAAGGAC CCAATCGCTATCAGGTACCCGTAGAATTTTATTC CTTGAGCAGACGAATTGGTAAACGAAACTTTAGTAATAATAATG CATTATTATTACTAAAGTTTCGTTTACCAATTCGTCTGCTCAAGAAAATAAATTAAATAC CACCGGATCCTCTTCAGTCTTGATG
uORF1 were unable to translate GCN4 main ORF. The increased expression of GCN4 ORF under these conditions could be due to leaky scanning of the elongated uORF1. The construct, pM199 has point mutations that remove uORF2-4 while keeping uORF1 intact and is used to measure re-initiation defects post uORF1 translation. Yeast strain (YP823) was transformed with either single copy empty vector (pA823) or eIF5G31R mutant (pA860) along with pM199 or pM226 constructs and the resultant b-galactosidase activity is summarized in a tabular form (Fig. 1D). In the case of eIF5G31R mutant, the GCN4 expression was not significantly altered for pM226 construct suggesting that the Gcne phenotype was not caused due to leaky scanning of elongated uORF1. However, the GCN4 expression was significantly reduced in pM199 construct, suggesting that the eIF5G31R mutant has translation re-initiation defects, possibly due to the premature release of 40S ribosome before translating GCN4 main ORF. This result also rules out the slow scanning defect as the slow scanning mutant should have a high GCN4 expression similar to the WT [1].
3.2. GCN4 expression is influenced by the upstream UUG codons present between uORFs and the main GCN4 ORF in the eIF5G31R mutant It is evident from our data that the eIF5G31R mutation results in the repression of GCN4 expression possibly by the release of 40S ribosome post translating uORF1. As the eIF5G31R mutant initiates translation at the UUG codon, it is possible that the utilization of UUG codon in the 50 regulatory region of the GCN4 transcript may interfere with normal GCN4 expression. We observed that there are ten UUG codons in the 50 UTR region of the GCN4 transcript between uORF1 and the main GCN4 ORF, which we call upUUG-ORFs. In order to test the role of these upUUG-ORFs in the disruption of GCN4 expression, we used the following modified derivatives of GCN4-LacZ (p180) reporter constructs. The construct p227 have point mutations in the AUG codon which removes short uORF1-4 (uORF-less) and is used to test Cap-dependent GCN4 expression devoid of any translation regulations contributed by the uORF1-4. The construct pA901 is modified by point mutations that removes uORF1-4 and upUUG-ORF1-10 (uORF-less & upUUG-less) and used to measure the contributions of UUG codons in GCN4 expression. Yeast strain (YP823) was transformed with either single copy empty vector (pA823) or eIF5G31R (pA860) mutant along with either p180, pM227 or pA901 GCN4-LacZ constructs and the b-galactosidase activities were normalized to 100% for WT and compared with the eIF5G31R mutant and represented in the table below each Fig. 2AeC. Under repressed (-3AT) condition, the removal of uORF14 did not significantly improve the GCN4 expression in comparison
to the vector control (68%; compare Fig. 2A and B) indicating premature dissociation of 40S ribosome before reaching GCN4 main ORF. However, after additional elimination of upUUG-ORF1-10 along with uORF1-4 as in the case of pA901 construct, the GCN4 expression for eIF5G31R mutant was significantly increase as compared to vector control (94%; compare Fig. 2B and C). The data suggests that eIF5G31R mutant causes premature dissociation of 40S ribosome possibly due to the utilization of upUUG-ORF from the 50 UTR region of the GCN4 transcript leading to the repression of GCN4 expression.
4. Discussion Isolation of Gcne or Gcde mutations at the eIF5-CTD end predominantly implicated its role in the integrity and scanning function of the 48S complex. The Suie mutants at the eIF5-NTD did not show any of these defects, possibly due to the weak effect of these mutations on eIF5 function [24]. It is also likely that the eIF5-NTD does not directly participate in maintaining the integrity and scanning function of 48S complex and the G31R substitution may have only exacerbated the regulatory function of GAP region in comparison to the weaker G31S substitution. Thus, the G31R mutation shows strong dominant Suie phenotype as compared with the G31S mutation. It is likely that the Gcne phenotype observed for the eIF5G31R mutant in this study is not due to the leaky scanning defects of uORF1 rather premature release of 40S ribosome post uORF1 translation. It has been reported earlier that non-AUG codons upstream of uORF1 were translated but played a very minor role in the regulation of GCN4 expression [33]. However, the ten UUG codons in the 50 UTR region of the GCN4 transcript between uORF1 and the main GCN4 ORF constituting upUUG-ORFs might have an influence on GCN4 regulation in the eIF5G31R mutant. Consistently, the removal of uORF1-4 and upUUG-ORFs 1e10 improved the GCN4 expression level significantly (Fig. 2AeC), suggesting the use of upUUG-ORFs by the eIF5G31R mutant could possibly cause 40S ribosome dissociation upon their translation (Fig. 3). This would represent a novel mechanism of the Gcne phenotype caused by the utilization of UUG codons from the 50 UTR region of GCN4 transcript in comparison to the other reported mechanisms of Gcne phenotype that involves leaky scanning, slow scanning and premature dissociation of the 40S ribosome [34]. It is very intriguing to compare the Gcne phenotypes of prt1-1 mutant, which has a hyper-accurate AUG codon recognition ability in contrast to the poor AUG codon recognition and better UUG codon recognition ability of the eIF5G31R mutant [22,35,36]. Our data thus suggests a strong Suie phenotype of the eIF5G31R mutation is responsible for the Gcne phenotype.
C. Antony A, P.V. Alone / Biochemical and Biophysical Research Communications 486 (2017) 1110e1115
1113
1114
C. Antony A, P.V. Alone / Biochemical and Biophysical Research Communications 486 (2017) 1110e1115
Fig. 2. Upstream UUG codons repress the GCN4 expression in eIF5G31R mutant. (A)(B)(C) Analysis of GCN4-LacZ expression. The yeast cells YP823 transformed with GCN4-LacZ (p180), uORF-less GCN4-LacZ (p227) or uORF-less & upUUG-less GCN4-LacZ (pA901) reporter constructs and subjected to the GCN4-LacZ expression analysis as per Fig. 1C. The bgalactosidase activity values were from three independent experiments using three individual colonies and represented in the tabular form along with the average deviations. Percentage changes with respected to the WT (100%) were shown in the parenthesis. The open square boxes (1e4), represented in the schematic shows upstream open reading frames (uORF), horizontal pentagon boxes with line (UUG 1e10) show upstream UUG codons containing reading frames terminating at various length. The black cross represents the mutations in either AUG codons to form ORF-less constructs or mutations in UUG codons to form ORF-less & upUUG-less construct.
Fig. 3. Model depicting the mechanism of Gcne phenotype exhibited by eIF5G31R mutant. Schematic representation of GCN4 construct. The open square boxes (1e4) shows upstream open reading frames (uORF), horizontal pentagon boxes with line (UUG 1e10) show upstream UUG codons based reading frames terminating at various length. The eIF5G31R mutant utilizes upUUG codons and terminates translation before reaching GCN4 main ORF.
It is equally important to contemplate about the varying degrees of Suie phenotype shown by different mutants. Most of the Gcde mutants such as eIF2gN135D or eIFbS264Y that also shows Suie phenotype are naturally supported by the de-repression of GCN4 expression, as it increases the HIS4-303 transcript level several-fold
thus synthesizing HIS4p and helps to stimulate histidine biosynthesis [17,18]. However, the Gcne mutants that also shows Suie phenotype, need to have an extraordinarily strong ability to recognize the UUG initiation codon from the basal level HIS4-303 transcript under repressed GCN4 expression; this might be the
Fig. 1. eIF5G31R mutant shows Suie and Gcne phenotype. (A) Analysis of Suie phenotype. Yeast cells carrying single copy empty vector (pA823), eIF5G31R (pA860) or eIF5G31S (pA1034) plasmids were transformed with either HIS4AUG-LacZ (pB3989) or HIS4UUG-LacZ (pB3990) constructs. The whole-cell extracts were prepared, and b-galactosidase activity (nmol of O-nitrophenyl-b-D-galactopyranoside cleaved per min per mg) was measured. The UUG/AUG ratio of the HIS4-LacZ expression is plotted. (B) Growth rate analysis of yeast expressing eIF5G31R or eIF5G31S mutant under dominant condition. Yeast strain carrying empty vector (pA823), eIF5WT (pA870), eIF5G31R (pA860) or eIF5G31S (pA1034) plasmids were grown overnight. Cells were serially diluted (with O.D.600 of 0.5, 0.05, 0.005, 0.0005, and 0.00005) and spotted on SCD, and SCD minus histidine plus 50 mM 3-Amino-1,2,4-triazole (þ3AT) and incubated at 30 C for 2 days or 3 days. (C and D) Analysis of GCN4-LacZ expression. In (C), Yeast strain carrying empty vector (pA823), eIF5G31R (pA860) or eIF5G31S (pA1034) plasmids were transformed with GCN4-lacZ reporter (p180). Cells were grown up to an A600 of 0.9 in SCD plus histidine minus 3AT medium (white bars; un-induced) or in SCD minus histidine plus 3AT medium (white shaded bars; induced). The whole-cell extracts were prepared, and b-galactosidase activity (nmol of O-nitrophenyl-b-D-galactopyranoside cleaved per min per mg) was measured and plotted. In (D) a derivative of GCN4-lacZ reporter (p180) having uORF1 elongated and overlapped 130 nucleotides out of frame with GCN4 main ORF (pM226), or consist of only uORF1 (pM199) was co-transformed with either empty vector (pA823) or eIF5G31R (pA860) plasmid. b-galactosidase activity was measured as per (C) and represented in tabular form. In all the assays, yeast strain YP823 was used and the b-galactosidase activity measurement is from three independent experiments using three individual colonies as describe previously [17] while the error represents an average deviation.
C. Antony A, P.V. Alone / Biochemical and Biophysical Research Communications 486 (2017) 1110e1115
reason for Gcne mutant eIF1A98101 not being able to suppress the Hise phenotype and thus believed to be a weak Suie [37]. In this regard, the eIF5G31R mutation represents a special category of a Suie mutant that has an extraordinarily strong ability to recognize the UUG initiation codon that downregulate GCN4 expression, which could be a possible molecular mechanism underpinning the Gcne phenotype. Acknowledgments We thank Thomas E. Dever, John Hershey and Madhusudan Dey for comments on the manuscript and helpful discussion. Alan Hinnebusch and Thomas E. Dever for providing plasmids and yeast strains. This work was supported by the grant (No.BT/PR14107/BRB/ 10/810/2010) from Department of Biotechnology, Government of India to P.V.A and intramural support from Department of Atomic Energy, Government of India to P.V.A. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2017.04.002. References [1] A.G. Hinnebusch, Molecular mechanism of scanning and start codon selection in eukaryotes, Microbiol. Mol. Biol. Rev. 75 (2011) 434e467. [2] A.G. Hinnebusch, The scanning mechanism of eukaryotic translation initiation, Annu. Rev. Biochem. 83 (2014) 779e812. sek, A.A. Mathew, B.S. Shin, K.H. Nielsen, B. Szamecz, A.G. Hinnebusch, [3] L. Vala The yeast eIF3 subunits TIF32/a, NIP1/c, and eIF5 make critical connections with the 40S ribosome in vivo, Genes Dev. 17 (2003) 786e799. [4] L.A. Passmore, T.M. Schmeing, D. Maag, D.J. Applefield, M.G. Acker, M.A. Algire, J.R. Lorsch, V. Ramakrishnan, The eukaryotic translation initiation factors eIF1 and eIF1A induce an open conformation of the 40S ribosome, Mol. Cell. 26 (2007) 41e50. [5] K. Asano, L. Phan, L. Valasek, L.W. Schoenfeld, A. Shalev, J. Clayton, K. Nielsen, T.F. Donahue, A.G. Hinnebusch, A multifactor complex of eIF1, eIF2, eIF3, eIF5, and tRNA(i)Met promotes initiation complex assembly and couples GTP hydrolysis to AUG recognition, Cold Spring Harb. Symp. Quant. Biol. 66 (2001) 403e415. [6] A.V. Jivotovskaya, L. Valasek, A.G. Hinnebusch, K.H. Nielsen, Eukaryotic translation initiation factor 3 (eIF3) and eIF2 can promote mRNA binding to 40S subunits independently of eIF4G in yeast, Mol. Cell Biol. 26 (2006) 1355e1372. [7] A.G. Hinnebusch, J.R. Lorsch, The mechanism of eukaryotic translation initiation: new insights and challenges, Cold Spring Harb. Perspect. Biol. 4 (2012) 1e25. [8] D. Maag, C.A. Fekete, Z. Gryczynski, J.R. Lorsch, A conformational change in the eukaryotic translation preinitiation complex and release of eIF1 signal recognition of the start codon, Mol. Cell. 17 (2005) 265e275. [9] P.V. Alone, T.E. Dever, Direct binding of translation initiation factor eIF2gamma-G domain to its GTPase-activating and GDP-GTP exchange factors eIF5 and eIF2B epsilon, J. Biol. Chem. 281 (2006) 12636e12644. [10] I.B. Lomakin, V.G. Kolupaeva, A. Marintchev, G. Wagner, T.V. Pestova, Position of eukaryotic initiation factor eIF1 on the 40S ribosomal subunit determined by directed hydroxyl radical probing, Genes Dev. 17 (2003) 2786e2797. [11] A.K. Saini, J.S. Nanda, J.R. Lorsch, A.G. Hinnebusch, Regulatory elements in eIF1A control the fidelity of start codon selection by modulating tRNA(i)(Met) binding to the ribosome, Genes Dev. 24 (2010) 97e110. [12] Y. Yu, A. Marintchev, V.G. Kolupaeva, A. Unbehaun, T. Veryasova, S.C. Lai, P. Hong, G. Wagner, C.U.T. Hellen, T.V. Pestova, Position of eukaryotic translation initiation factor eIF1A on the 40S ribosomal subunit mapped by directed hydroxyl radical probing, Nucleic Acids Res. 37 (2009) 5167e5182. [13] T.V. Pestova, S.I. Borukhov, C.U. Hellen, Eukaryotic ribosomes require initiation factors 1 and 1A to locate initiation codons, Nature 394 (1998) 854e859. [14] A.G. Hinnebusch, Translational regulation of GCN4 and the general amino acid control of yeast, Annu. Rev. Microbiol. 59 (2005) 407e450. [15] A.G. Hinnebusch, Mechanisms of gene regulation in the general control of amino acid biosynthesis in Saccharomyces cerevisiae, Microbiol. Rev. 52 (1988) 248e273.
1115
[16] A.G. Hinnebusch, Translational control of GCN4: an in vivo barometer of initiation-factor activity, Trends Biochem. Sci. 19 (1994) 409e414. [17] P.V. Alone, C. Cao, T.E. Dever, Translation initiation factor 2gamma mutant alters start codon selection independent of Met-tRNA binding, Mol. Cell Biol. 28 (2008) 6877e6888. [18] B. Castilho-Valavicius, H. Yoon, T.F. Donahue, Genetic characterization of the Saccharomyces cerevisiae translational initiation suppressors sui1, sui2 and SUI3 and their effects on HIS4 expression, Genetics 124 (1990) 483e495. €m, A.S. Bystro € m, A.G. Hinnebusch, Modulation of [19] T.E. Dever, W. Yang, S. Astro tRNA(i)(Met), eIF-2, and eIF-2B expression shows that GCN4 translation is inversely coupled to the level of eIF-2.GTP.Met-tRNA(i)(Met) ternary complexes, Mol. Cell Biol. 15 (1995) 6351e6363. [20] G.D. Pavitt, W. Yang, A.G. Hinnebusch, Homologous segments in three subunits of the guanine nucleotide exchange factor eIF2B mediate translational regulation by phosphorylation of eIF2, Mol. Cell Biol. 17 (1997) 1298e1313. [21] H.K. Huang, H. Yoon, E.M. Hannig, T.F. Donahue, GTP hydrolysis controls stringent selection of the AUG start codon during translation initiation in Saccharomyces cerevisiae, Genes Dev. 11 (1997) 2396e2413. [22] A.K. Saini, J.S. Nanda, P. Martin-Marcos, J. Dong, F. Zhang, M. Bhardwaj, J.R. Lorsch, A.G. Hinnebusch, Eukaryotic translation initiation factor eIF5 promotes the accuracy of start codon recognition by regulating Pi release and conformational transitions of the preinitiation complex, Nucleic Acids Res. 43 (2014) 1e18. [23] J.S. Nanda, A.K. Saini, A.M. Munoz, A.G. Hinnebusch, J.R. Lorsch, Coordinated movements of eukaryotic translation initiation Factors eIF1, eIF1A, and eIF5 trigger phosphate release from eIF2 in response to start codon recognition by the ribosomal preinitiation complex, J. Biol. Chem. 288 (2013) 5316e5329. [24] C.R. Singh, C. Curtis, Y. Yamamoto, N.S. Hall, D.S. Kruse, H. He, E.M. Hannig, K. Asano, Eukaryotic translation initiation factor 5 is critical for integrity of the scanning preinitiation complex and accurate control of GCN4 translation, Mol. Cell. Biol. 25 (2005) 5480e5491. [25] R.D. Gietz, S. Akio, New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites, Gene 74 (1988) 527e534. [26] A.G. Hinnebusch, A hierarchy of trans-acting factors modulates translation of an activator of amino acid biosynthetic genes in Saccharomyces cerevisiae, Mol. Cell Biol. 5 (1985) 2349e2360. [27] T.F. Donahue, A.M. Cigan, Genetic selection for mutations that reduce or abolish ribosomal recognition of the HIS4 translational initiator region, Mol. Cell Biol. 8 (1988) 2955e2963. [28] C.M. Grant, P.F. Miller, A.G. Hinnebusch, Requirements for intercistronic distance and level of eukaryotic initiation factor 2 activity in reinitiation on GCN4 mRNA vary with the downstream cistron, Mol. Cell Biol. 14 (1994) 2616e2628. [29] P.F. Miller, A.G. Hinnebusch, Sequences that surround the stop codons of upstream open reading frames in GCN4 mRNA determine their distinct functions in translational control, Genes Dev. 3 (1989) 1217e1225. [30] J.L. Hilton, P.C. Kearney, Mode of action of the herbicide, 3-amino-1,2,4-triazole (amitrole): inhibition of an enzyme of histidine biosynthesis, Arch. Biochem. Biophys. 112 (1965) 544e547. , V. Munzarova , A. Herrmannov [31] B. Szamecz, E. Rutkai, L. Cuchalova a, K.H. Nielsen, L. Burela, A.G. Hinnebusch, L. Val asek, eIF3a cooperates with 0 sequences 5 of uORF1 to promote resumption of scanning by posttermination ribosomes for reinitiation on GCN4 mRNA, Genes Dev. 22 (2008) 2414e2425. [32] T. Krishnamoorthy, G.D. Pavitt, F. Zhang, T.E. Dever, A.G. Hinnebusch, Tight binding of the phosphorylated alpha subunit of initiation factor 2 (eIF2alpha) to the regulatory subunits of guanine nucleotide exchange factor eIF2B is required for inhibition of translation initiation, Mol. Cell Biol. 21 (2001) 5018e5030. [33] F. Zhang, A.G. Hinnebusch, An upstream ORF with non-AUG start codon is translated in vivo but dispensable for translational control of GCN4 mRNA, Nucleic Acids Res. 39 (2011) 3128e3140. , T. Kouba, A. Herrmannova , I. Da nyi, W.-L. Chiu, L. Val [34] L. Cuchalova asek, The RNA recognition motif of eukaryotic translation initiation factor 3g (eIF3g) is required for resumption of scanning of posttermination ribosomes for reinitiation on GCN4 and together with eIF3i stimulates linear scanning, Mol. Cell. Biol. 30 (2010) 4671e4686. [35] P. Martin-Marcos, J.S. Nanda, R.E. Luna, F. Zhang, A.K. Saini, V.A. Cherkasova, G. Wagner, J.R. Lorsch, A.G. Hinnebusch, Enhanced eIF1 binding to the 40S ribosome impedes conformational rearrangements of the preinitiation complex and elevates initiation accuracy, RNA 20 (2014) 150e167. [36] K.H. Nielsen, B. Szamecz, L. Val asek, A. Jivotovskaya, B.S. Shin, A.G. Hinnebusch, Functions of eIF3 downstream of 48S assembly impact AUG recognition and GCN4 translational control, EMBO J. 23 (2004) 1166e1177. [37] C.A. Fekete, D.J. Applefield, S.A. Blakely, N. Shirokikh, T. Pestova, J.R. Lorsch, A.G. Hinnebusch, The eIF1A C-terminal domain promotes initiation complex assembly, scanning and AUG selection in vivo, EMBO J. 24 (2005) 3588e3601.
