Aug 15, 1996 - Complement C7 deficiency (C7D) is associated frequently with recurrent bacterial infections, especially meningitis caused by. Neisseria ...
Genetic Bases of Human Complement C7 Deficiency’ Hiroaki Nishizaka,* Takahiko Horiuchi,’* Zeng-Bian Zhu,t John E. Volanakist
Yasuo Fukumori,* and
Complement C7 deficiency (C7D) is associated frequently with recurrent bacterial infections, especially meningitis caused by Neisseria meningitidis. W e report in this work the molecular bases of C7D in two unrelated Japanese males. We used exonspecific PCR/single-strandconformation polymorphism analysis as a screening step for mutations. Subsequent direct sequencing of the target exons identified homozygous mutations in exon 16 of case 1 and in exon 15 of case 2. The mutation of case 1 was a homozygous T to A transversion at nucleotide 2250, the third nucleotide of the codon TGT for C Y S ’ ~leading ~, to a stop codon TGA (C728X). In case 2, a homozygous 2-bp deletion (2137delTG/2138delGT/2139delTG) caused a frameshift, generating a premature termination codon 4 to 6 nucleotides downstream. Family study in case 1 confirmed the genetic nature of the defect. Moreover, we detected a novel polymorphism in intron 11 that presumably is linked to the mutation responsible for C7D in case 1. Our results indicate that the pathogenesis of C7D is heterogeneous like mostof the other deficiencies of complement components. The JournalofImmunology, 1996, 157: 4239-4243.
C
7 is one of five complement proteins that upon activation of either the classical or the alternative pathway interact sequentially to form a large protein-protein complex, called membrane attack complex (MAC).’ Assembly of the MAC on target cells results in the formation of transmembrane pores that can lead to killing of the cells. The single polypeptide chain of C7 is composed of 821 amino acid residue^,^ and during the process of MAC formation binds to the C5b6 complex (1,2). The resulting CSb-7 complex is transiently endowed with the ability to bind to membrane surfaces (1). C7 is structurally similar to the other terminal complement proteins, C6, CSa, CSP, and C9. The genes for C7 as well as those for C6 and C9 are located on chromosome Sp13 (3, 4), while the genes for C8a and C8P are located on the short arm of chromosome 1 ( 5 ) . The genes for C7 and C6 are 160 kb apart and are oriented in a tail-to-tail configuration relative to transcription (4, 6). The C7 gene has been shown to span about 80 kb of DNA, is encoded by 18 exons (0-17), and has an organization very similar to that of the C6 gene (7, 8). Individuals with inherited deficiencies of the terminal components of the complement system frequently suffer from recurrent systemic infections caused by Neisseria meningitidis or Neisseria
‘First Department of Internal Medlcine, Faculty of Medicine,Kyushu University, Fukuoka, Japan; ‘Divcsion of Clinlcal Immunology and Rheumatology, DepartAL ment of Medicine,Universlty of Alabama a t Birmingham,Birmingham, 35294; and *Department of Research, Osaka RedCross Blood Center, Osaka, lapan Received forpublicationMay 15, 1996.
21, 1996.Acceptedforpublication
August
The costs of publicatlon of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement In accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
’
This study was supported in part by grants-in-ald from The Tokyo Biochemical Research Foundation, Kaibara Morlkaru Medical Science PromotionFoundatlon, and U.S. Public Health Service Grants A121067 and AR03555.
’ Address correspondence and reprint DepartmentofInternalMedlclne,Faculty Fukuoka 81 2-82, Japan.
requests to Dr. Takahiko Horiuchi, First of Medicine, Kyushu University,
’
Abbreviations used in this paper: MAC, membrane attack complex; C7D, C7 deficiency; SSCP, single-strand conformation polymorphism; RID, radial Immunodiffusion assay. Throughout this paper, nucleotide and amino acid residues numbering for C7 is according to DiScipio et al. (1). Copyright 0 1996 by The American Association of Immunologists
gonorrhoeae, including meningococcal meningitis, meningococcemia, and disseminated gonococcal infection (9-1 1). Molecular defects leading to inherited deficiencies of CS, C6, and CSP in humans have been described recently (12-16). However, to our knowledge, defects causing C7 deficiency (C7D) have not been reported as yet. In the present study, we investigated the molecular bases of two cases of C7D in unrelated Japanese subjects. We used exon-specific PCWsingle-strand conformation polymorphism (SSCP) (17, 18), followed by sequencing anomalously migrating exons to identify mutations. A homozygous T to A transversion in exon 16at the third nucleotide of the TGT codon for C Y S ’ ~ ~ (C728X) was detected in the first case, and a homozygous 2-bp deletion in exon 15 (2137delTG/2138delGT/2139delTG) generating a stop codon 4 to 6 nucleotides downstream in the second case. Thus, similarly to other inherited complement protein deficiencies, C7D appears to be heterogeneous.
Materials and Methods C7D subjects Two unrelated Japanese individuals were included in this study. Case I was a 33-yr-old male admitted to Kyushu University Hospital (Fukuoka, Japan) for somnolence and a skin rush (19). Physical and laboratory examination established the diagnoses of meningitis, septic shock, disseminated intravascular coagulation, adrenocortical insufficiency, and cardiac failure with evidence of myocardial infarction. N . meningiridis, serogroup B, was isolated from the blood on the second hospital day. The patient was treated with ampicillin (6-8 g/day) and intensive care measures for cardiac-septic shock and recovered fully. The patient’s younger sister is suffering from systemic lupus erythematosus. Case 2 was a 33-yr-old male who was found to be C7 deficient during a large-scale screening of healthy blood donors in Osaka, Japan for inherited deficiencies of late-acting complement proteins (20). He had no history of neisserial infections.
Hemolytic assays and single radial immunodiffusion assay (RID) for C7 Total serum hemolytic activity was measured as described previously (21). To reconstitute total hemolytic activity of C7-deficient serum, purified C7 (Advanced Research Technologies, San Diego, CA) was added to a final concentration of 70 pg/ml. C7 hemolytic activity was measured by using C7-depleted serum (Advanced Research Technologies). Briefly, 100 p1 Ab-coated sheep erythrocyte (1.5 X 108/ml), 100 pl C7-depleted serum diluted 1/20, and 100 p1 test serum diluted serially were incubated in halfstrength Veronal-buffered saline, containing 2.5% dextrose, 0. I % gelatin, 0.15 mM CaCl,, and 0.5 mM MgCl, at 37°C for 30 min. The reaction was 0022-1 767/96/$02.00
GENETIC BASES OF HUMAN COMPLEMENT C7 DEFICIENCY
4240
Table I. Primer sequences for the analysis of human complement component C7
Exons
1 2 3 4 5 6 7 8
9 10 11 12 13 14 15 16 17
5’ Oligonucleotide Sequence ( 5 ’ to 3’1
3’ Oligonucleotide Sequence (5’to 3 ’ )
Fragment Slze
ATA.4CATCACTTTGTACCCCAT CTTTCCACCTGCTTTATGATG CAAACAAACCACTGCCTGCTT TTTGGTCCTGGGTAGTGTTCT TTTCCCCACCAAGTGCTATTT GCAATGATAAAGGATCCAGCA CTTCCACCTAAAACTCCTTGT CTGAAGATCTTCAAGGAATGC CCAGGATGTCATACAATTTGAT CTTGCCTAAACCCTGATTACT AGTTCCCAAGCCCTCTTTAAG AGGAGAAATCCAACGTAATGC CAAACTCTTTCCTTTTCCATC GATGGTTTAGGAGAGCAACGA TTCTCCTAACGACCACATCTC CCTTCTCAGCTTTTACGAACA CTCCACAATGTACCATTAAGC
TTGGAGGGATACACAGATTCA CATGCCAAAGTATTTCTGCAA GAGCAAGTTCACCAAATAACG CAATTCACTGATGTACTCAGG AATGCTCTCTGACAATTCCAG GCATTGACTCTTAAAGGAAGTA CAGAAAGCCTTTAGACAACGA GTTAAGGCTTGCAATGCAAAC AACATGACTGCTTCCTATTGC TCAATGTGTACAGGTGGCTAG TGTGTTCTATGCAACTGCCAG ATAGGTTATGGGCTCAGCAGA TTGATTCATTCTCTTCCACGT ATGAAGGTCGCCACAAGGACT AAGCTACACCTTCCATCCAAC TCCTCAGTACTGTGACTTTAG TGTGCAGATGTTTTCACTCAG
270 174 237 253 262 372 322 209 287 316 266 239 232 314 223 300 293
stopped by adding 1.2 ml ice-cold Veronal-buffered saline containing 0.01 units from the A,,, of the supernatants. Serum C7concentration was measured by using the C7 NL RID kit (The Binding Site, Birmingham, U.K.), according to the supplier’s instructions. Reported normal serum C7 range by this method is 55 to 85 pg/ml (mean -+ 2 SD).
M EDTA, and the C7 activity was calculated in CH,,
PCWSSCP analysis Primers for exon-specific PCR for exons 1 to 17 of the C7 gene were prepared on the basis of the flanking intronic sequences (8) and are listed in Table I. As the nucleotide sequences flanking exon 0, which encodes two codons at 5’ end of the C7 gene transcript, are still undetermined, exon 0 could not be analyzed. Genomic DNA was prepared from peripheral blood, as described previously (22). PCR was performed by using SO ng genomic DNA as template, 0.2 pM of each primer, 25 p M dNTP,2pCi [u-”P]dCTP (Amersham International, Buckinghamshire, U.K.), 0.125 U Taq polymerase, and the standard buffer provided by the supplier (PerkinElmer, Norwalk, CT) in a total reaction mixture of 5 pl. Reactions were conducted for 30 cycles consisting of 1 minat 95°C and 2 min at 60°C, using a thermal cycler PJ2000 (Perkin-Elmer). The PCR products were diluted with formamide dyes (95% formamide, 20 mM Na,EDTA, 0.05% bromophenol blue, and 0.05% xylene cyanol) and heat denatured at 80°C for 5 min. Electrophoresis was conducted at 25°C in 5% nondenaturing acrylamide gels containing 5% glycerol or at 4°C in gels without glycerol at 13 Vkm, using 45 mM Tris-borate and 1 mM EDTA buffer, pH 8.3. DNA fragments were visualized by exposing the gels to Fuji RX film (Fuji Photo Film Co., Kanagawa, Japan).
Nucleotide sequencing Exons of interest were amplified directly from genomic DNA using the PCR reagent kit (Perkin-Elmer). according to the manufacturer’s instructions. The PCR products were electrophoresed in 1 S % agarose gels, excised from the gels, and purified on SUPREC-OI columns (Takara Shuzo Co.. Otsu, Japan). They were then reamplified for 20 cycles consisting of 1 min at 95°C and 2 min at 65°C. The products were purified on Microcon100 (Amicon, Beverly, MA), and directly sequenced by using the Amplicycle sequencing kit (Perkin-Elmer), according to the manufacturer’s instructions. The cycling sequencing reaction included 25 cycles consisting of I min at 9 5 T , 1 rnin at 6 8 T , and 1 rnin at 72°C. Primers were labeled by using T4 polynucleotide kinase (New England Biolabs, Beverly, MA) and [y-”PIATP (ICN Radiochemicals, Irvine, CA) at 37°C for 20 min.
(bp)
within normal range. C7 concentration in the serum of the father, mother, and sister was 42, 36, and 33 pg/ml, respectively. All three values were more than 2 SD below the normal mean value. Results of complement determinations of case 2 have been reported previously (20). Briefly, this individual had undetectable serum C 7 protein by RID and also undetectable total and C 7 hemolytic activities in serum. Hemolytic activities of all of the other complement components were within normal limits. Total hemolytic activity could be restored to within normal range by addition of purified C7. Detection o f C7 gene mutations by PCRLSSCP analysis
PCRISSCP analysis of exons I to 17 revealed aberrant bands in exon 16 of case 1 and in exon 15of case 2. In case I , the exon 16-specific PCR product of the proband (Fig. la, lane 5 ) displayed two bands migrating slower than those of normocomplementemic controls (Fig. la, lanes I, 4 , and 7). This was evident under both conditions of electrophoresis, i.e., at 25°C in gels containing 5% glycerol or at 4°C without glycerol. The PCR products derived from genomic DNA of the parents and the sister of case 1 displayed four bands each (Fig. la, lanes 2, 3, and 6). Two of the bands migrated with the same mobility as those of the proband, and the other two as those of the normocomplementemic controls. These results suggested that the proband was homozygous for an abnormality in exon 16, while his parents and sister were heterozygous for the same abnormality. In case 2, two aberrant bands with slightly faster mobility than those of controls were observed in the analysis of the exon 15-specific PCR product at 4°C in gels not containing glycerol (Fig. Ih, lune 3 ) . This result suggested a homozygous mutation in exon 15 in case 2. No family members were available to establish the inheritance pattern of the defect in case 2. No other aberrant bands were detected in any other exons in either C 7 D case, except for the one caused by a novel rare polymorphism in intron 11of case 1. Determination of the mutation in case 7
Results Definition o f C7D
C7 protein was undetectable in the serum of case 1 by RID. Total and C7 hemolytic activities were also undetectable. Total hemolytic activity could be restored to within normal range ( I 25 CHsd ml) by adding 70 pg/ml of purified C7. The patient’s father, mother, and sister had total and C7 serum hemolytic activities
The amplified PCR product of exon 16 from case 1 was directly sequenced in its entirety. The nucleotide sequence was identical with that reported previously ( I ) , except that nucleotide 2250 was an A instead of T (Fig. 20). Nucleotide 2250 is the third nucleotide of the codon TGT for CYS’~’of normal C7. The T to A transversion generates a termination codon, TGA, which would cause the truncation of the encoded C 7 protein (Fig. 2h). Sequencing of the
The Journal of Immunology
a.
4241
a
Case 1 / Exon 16
Control
Case2
1 2 3 4 5 6 7 1 : Control 2 : Father 3 :Mother 4 :Control 5 :C7D, Case 1 6 : Sister 7 : Control
G A T CG A T C
b
b.
Case 2 / Exon 15
213'1-2140 Nomulatiole CAQ
Q
M T TCA Mu k N
S
R
AM
T GTT
C
V
C
R
1 2 3 4 1 , 2 , 4 :Control
Mutantalkk CAQ M T TCA Mu W TM T M M T Q lU S R C L S t a p 6b2
3 :C7D, C a s e 2 FIGURE 1. PCWSSCP analysis of C7D individuals. a, Exon-specific PCWSSCP for exon 16 using genomic DNA from case 1 (lane 5),his father (lane 2 ) ,his mother (lane 3), his sister (lane 6 ) ,and C7-sufficient controls (lanes 7, 4, and 7). Electrophoresis was performed in 5% polyacrylamide gel containing 5% glycerol at 25°C. Electrophoresis in 5% polyacrylamidegel without glycerol at 4°C gave similar results(not shown). b, Exon-specific PCWSSCP for exon 15 using genomic DNA from case 2 (lane 3 ) and C7-sufficient controls (lanes I , 2, and 4). Electrophoresis was performed in 5% polyacrylamide in the absence of glycerol at 4°C.
FIGURE 3. Definition of exon 15 mutation in case 2. a, PartialDNA sequence of exon 15 amplified from genomic DNAof case 2 and a C7-sufficient control. The position of a 2-bp deletion (2137delTW 21 38delGT/2139delTG) is shown on the right. b, The nucleotide sequence and deduced amino acid sequence (one-letter code) around the mutation. The translated C7protein is truncated at amino acid residue 692, with an amino acid residue (in italic) that is different from that of the native protein.
2 138, or 2 139 (21 37delTG/2 138deIGT/2139delTG) (Fig. 3a). The dinucleotide deletion resulted in frameshift generating one amino acid different from native C7 (V692L). followed by a premature termination codon (Fig. 3b).
a
Father Mother Case 1
Sister Control
-
-.
d.
e
c
-
G AG TC AG TC AG TC AG TC ATC
Nonnalsllde: CAT GTT CTC CM: TGT CAG GGT H V L H C Q G
uiso
Mubntalbk: CAT GTT CTC CAC Tt3A CAG GGT R V L Stop
7
727
FIGURE 2. Definition of exon 16 mutation in case 1. a, Pedigree of the family of case 1 and partial DNA sequence of exon 16 amplified from genomic DNAof case 1, his father, his mother, his sister, and a C7-sufficient control. The arrow indicates the position of the substitution (2250T-A). b, The nucleotide sequence and deduced amino acid sequence (one-letter code) around the mutation. ThetranslatedC7 protein is truncated at amino acid residue 727.
genomic DNA of the parents and sister ofcase 1 showed that in all three cases both the native nucleotide T and the mutated A were present at position 2250 (Fig. 2a).
Detection of a novel polymorphism in intron 1 1 and typing for M/N and T367.5 polymorphisms
PCR/SSCP analysisofexon I 1 of case 1 disclosed bands with altered mobility. Sequencing of the PCR product revealed a homozygous C to A transition within intron 1 1 at nucleotide 1661 + 18 of the propositus, while his parents and sister were heterozygous (data not shown). This nucleotide change at 1661 + 18 could not be expected to affect splicing, because it is located far downstream from the consensus sequence at the exon-intron junction (23). PCR/SSCP analysis of genomic DNA from 50 healthy individuals and from case 2 failed to detect any additional C7 alleles carrying A at nucleotide position 1661 + 18. It thus appears that this is a rare polymorphism that is probably linked to the exon 16 mutation C728X. The molecular bases of the C7 M/N and T367S polymorphism have been described (24, 25). M/N polymorphism was defined originally by reactivity to the allospecific mAb, WU 4-15 (26). The difference in reactivity was shown to reside in the first nucleotide of the codonfor amino acid residue 565 in exon 13. A C to A transition results in amino acid changefrom Pros6' in C7 N to Th?"' in C7 M. Direct sequencing of exon 13-specific PCR products revealed that both case 1 and case 2 were homozygous for Thr (C7M) (data not shown). The T367Spolymorphism is caused by a change in the second nucleotide of codon367 in exon 9 from AGT (encoding Ser) to ACT(encoding Thr). Direct sequencing of exon 9-specific PCR products revealed that case 1 was homozygous forThr and case 2 was homozygous for Ser(data not shown).
Determination of the mutation in case 2
Discussion
Direct sequencinganalysis of exon 15 amplified fromgenomic DNA of case 2 revealed a 2-bp deletion starting at nucleotide2137,
This is the first description of molecular defects leading to C7D. Homozygous small mutations, a nonsense mutation in the first case
4242 and a 2-bp deletion in the second case, were shown to be the apparent causes of deficiency. In contrast to some complement deficiencies such as C9 deficiency (IO, 27,281 and C2 deficiency (29), which are preferentially expressed in some ethnic groups, C7D does not appear to have an ethnic predominance. The incidence of the homozygous C7D is estimated to be approximately 4 per 100,000, based on a single large population study that included 145,640 healthy blood donors in Osaka, Japan (20). In the present study, we utilized exon-specific PCWSSCP analysis as a screening step for mutations, followed by direct sequencing of the target exons. The approach enabled us to avoid sequencing the entirecoding region of the C7 gene of the deficient individuals. The strategy provides a rapid, sensitive, and simple method to investigate the whole coding region of genes, and has been successfully used by our group for the molecular analysis of C6-deficient individuals as well (14). By using this methodology, the only molecular defect identified in case 1 was a T to A transversion of the third nucleotide of the codon for C ~ S ’ ~in* exon 16. The mutation resulted in the generation of a termination codon. The mutant C7 gene encodes a polypeptide lacking the carboxylterminal 94 amino acids of normal C7, which represent approximately 11.4% of the molecular size. Family study demonstrated that both parents as well as a sister carry one C7 allele with the identical mutation. The single molecular defect detected in the C7 gene of case 2 occurred slightly upstream from that of case 1 . Two nucleotides, TG or GT, were deleted beginning at nucleotide 2137, 2138, or 2139 (2137delTG/2138delGT/2139delTG). The deletion resulted in frameshift and the generation of a premature termination codon immediately after the mutated amino acid 692. If translated, the mutant C7 would lack the carboxyl-terminal 129 amino acid residues or approximately 15.7% of the molecular size of the polypeptide. Direct repeats of nucleotides between 2- and 8-bp long have been shown to be located in the immediate vicinity of short gene deletions (30). It has been suggested that tandem repeats cause misalignment during gene replication, resulting in deletions of less than 20 bp (31). In case 2, two nucleotides of two tandem repeats of TG or GT were deleted. Nonsense and frameshift mutations in human disease genes frequently cause severe reduction in mRNA levels, leading to absence of protein production. Occasionally, nonsense mutations are associated with normal mRNA levels, but truncated proteins. The mechanisms for the reduced expression of nonsense mutated mRNA are incompletely understood, but they seem to be diverse and to involve cytoplasmic and nuclear elements. In a number of cases, nonsense mutations lead to increased rates of decay of cytoplasmic mRNA (32, 33). In yeast cells, the trans-acting factor UPFl has been shown to be necessary for the specific degradation of mRNAs that contain premature stop codons (34). In other instances, nonsense codons and frameshifts reduce mRNA abundance without affecting either the rateof transcription or the rate of cytoplasmic decay. At least two distinct mechanisms appear to be responsible. In one mechanism, recognition of nonsense codons in frame with the translation initiation codon triggers the decay of nuclear RNA. Evidence for such a nuclear scanning mechanism has been presented for nonsense mutations of the genes encoding dihydrofolate reductase (3.9, triosephosphate isomerase (36), and human P-globin (37). In another mechanism, nonsense mutations affect nuclear RNA processing and translocation into the cytoplasm by inhibiting the removal of introns that are located downstream of the stop codon. This results in an abnormally low abundance of cytoplasmic mRNA that, however, has a normal f,,,. Examples of this mechanism are provided by mutations of the minute virus of mice (38) and the Ig K light chain genes (39). An
GENETIC BASES OF H U M A NC7 COMPLEMENT Exons
0 1 2 3
4
5
6
7
8 9 10 111213 14
DEFICIENCY 15 16
17
Structural Motifs
T1 LA
Perforln
EGT1 CP CP
FM
FM
Normal C7
Mutant C7 (Case 1 Mutant C7 (Case 2
Acid Number
0
I
100
200
300
400
500
600
700
I
BOO
900
I
FIGURE 4. Schematic diagram of the molecular structure of normal C7 (adapted from Ref. 8) and truncated C7 of cases 1 and 2. Modules are designated, according to the recommendations of a recent workshop (41), as follows: T1, thrombospondin, type 1; LA, LDL receptor, type A; EG, epidermal growth factor-like;CP, complement control protein; and FM, complement factor I, MAC proteins.
additional level of regulation is exercised at the post-translational level. Misfolded or incompletely folded truncated polypeptides are retained in the endoplasmic reticulum by chaperone proteins and are quickly degraded (40). The mechanisms leading to the apparent absence of C7 from the blood of the two individuals reported in this work are under investigation. However, given the low frequency of C7D, it seems reasonable to assume that the identified gene defects are causally related to the observed C7D phenotypes. As shown in Figure 4, the putative mutant C7 polypeptide in case 1 would be missing the entire second and the carboxyl-terminal one-fourth of the first factor I module. In case 2, the putative C7 polypeptide would be missing the second and about three-quarters of the first factor I module (1). A molecular defect of the C6 gene, probably leading to truncation of the encoded protein at a position analogous to that observed for C7 in our case 2, causes not complete, but subtotal, C6 deficiency (13). Individuals with that defect have in their blood low concentrations of a C6 polypeptide that is about 14% shorter than the normal protein. Surprisingly, the truncated C6 was shown to be functional (13,42,43), despite data suggesting that the factor I modules of both C6 and C7 contain C5b binding sites (44, 45). It has been proposed (42) that the low levels of functional C6 present in individuals with subtotal C6 deficiency account for the absence of increased susceptibility to neisserial infections among them. It is of further relevance that, by using a sensitive ELISA, Wiirzner et al. (43) found that all nine tested sera fromC7D individuals contained measurable amounts of C7. Concentrations of C7 ranged from 20 to 360 ng/ml, hut only in one of the nine cases was C7 functional. The sensitivity of the RID method used in the present study to measure serum C7 is well above the highest C7 concentration measured by ELISA in C7D. Therefore, we cannot exclude the possibility that low levels of truncated C7 were present in the serum of one or both of our cases. However, no hemolytically active C7 was detected in either case, and in case 1 the patient presented with life-threatening rneningococcal disease. It thus appears unlikely that either individual had subtotal C7D.
References I . DiScipio, R. G., D. N. Chakravarti, H. J. Muller-Eberhard. and G . H. Fey. 1988. Thestructure of humancomplementcomponentC7andtheC5b-7 complex. J. Biol. Chem. 263:549. 2. Muller-Eberhard, H. J. 1986. Themembraneattack complex of complement. Annu. Rev. Immunol. 4:503.
4243
The Journal of Immunology 3. Abhott, C.. L. West, S. Povey, S. Jeremiah, Z. Murad, R. G. DiScipio, and G. Fey. 1989. The gene for the human complement component C9 mapped to chromosome 5 by polymerase chain reaction. Genomics 4:606. 4. Hobart, M. J., B. A. Fernie, R. G. DiScipio, and P. J. Lachmann. 1993. A physical map of the C6and C7 complement component gene region on chromosome 5 ~ 1 3 . Hum. Mol. Genet. 2:1035. 5. Rogde, S., B. Olaisen, T. Gedde-Dahl, Jr., and P. Teisherg. 1986. The C8A and C8B loci are closely linked on chromosome 1. Ann. Hum. Genet. 50:139. 6. SetiCn, F.. V. Alvarez, E. Coto, R. G. DiScipio, and C. L6pez-Lmea. 1993. A physical map of the human complement component C6, C7, and C9 genes. Immunogenetics 38.341. 7 Hobart, M. J., B. Fernie, and R. G. DiScipio. 1993. Structure of the human C6 gene. Biochemist0 32.6198. 8 Hobart, M. I.. B. A. Fernie, and R. G. DiScipio. 1995. Structure of the human C7 gene and comparison with the C6, C8A. CSB, and C9 genes. J. Immunol. 1S4: 5188. 9 Ross, S. C., and P. Densen. 1984. Complement deficiency states and infection: epidemiology, pathogenesis, and consequences of neisserial and other infections in an immune deficiency. Medicine 63:243. 10 Wiirzner, R., A. Orren, and P. J. Lacbmann. 1992. Inherited deficiencies of the terminal components of human complement. Immunodejic. Rev. 3.123, I I Tedesco. F., W. Niimberger, and S. Perissutti. 1993. Inherited deficiencies of the terminal complement components. Int. Rev. lmmunol. lOt51. 12 Wang, X., D. T. Fleischer, W. T. Whitehead, D. L. Haviland, S. I. Rosenfeld, J. P. Leddy. R. Snyderman, and R. A. Wetsel. 1995. Inherited human complement C5 deficiency: nonsense mutations in exons 1 (Glnl to Stop) and 36 (Arg1458 to Stop) and compound heterozygosity in three African-American families. J. Immunol. 154r5464. 13 Wiirzner, R., M. J. Hohan, B. A. Fernie, D. Mewar, P. C. Potter, A. Orren, and P. J. Lacbmann. 1995. Molecular basis of subtotal complement C6 deficiency: a carhoxy-terminally truncated but functionally active C6. J. Clin. Invest. 95.1877. 14 Nishizaka, H., T. Horiuchi, Z.-B. Zhu, Y. Fukumori, K. Nagasawa, K. Hayashi, R. Krumdieck, C. G. Cobhs, M. Higuchi. S. Yasunaga, Y. Niho, and J. E. Volanakis. 1996. Molecular bases for inherited human complement component C6 deficiency in two unrelated individuals. J. Immunol. 156.2309. 15. Kaufmann. T., G. Hansch, C. Rittner, P. Spath, F. Tedesco. and P. M. Schneider. 1993. Genetic basis of human complement CSP deficiency. J. Immunol. 150: 4943. 16 Saucedo. L., L. Ackermann, A. E. Platonov, A.Gewurz,R. M. Rakita, and P. Densen. 1995. Delineation of additional genetic bases for CSp deficiency: prevalence of null alleles and predominance of C-T transition in their genesis. J. Immunol. 155:5022. 17. Orita, M., Y. Suzuki,T. Sekiya, and K. Hayashi. 1989. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5:874. 18. Hayashi. K. 1991. PCR-SSCP: a simple and sensitive method for detection of mutations in the genomic DNA. PCR Merhods Appl. 1:34. 19. Moriyama, K., K. Okada, Y. Sawae, R. Kaji, J. Kudo, K. Fujimoto, T. Okamura, Y. Niho, I. Ohmura. S. Kawamura. T. Kusaba, and S. Inaba. 1988. A successfully treated case of meningococcal meningitis in an adult with complement seven deficiency. Kunsenshogaku Zusshi 62:1026. 20. Inai, S., Y. Akagaki, T. Moriyama, Y. Fukumori, K. Yoshimura, S. Ohnoki, and H. Yamaguchi. 1989. Inherited deficiencies of the late-acting complement components other than C9 found among healthy blood donors. Int. Arch.Allergy Appl. Immunol. 90:274. 21. Oglesby, T. J., A. Ueda, and J. E. Volanakis. 1988. Radioassays for quantitation of intact complement proteins C2 and B in human serum, J. lmmunol. Methods
I1O:SS. 22. Horiuchi, T., K. J . Macon, V. J. Kidd. and J. E. Volanakis. 1989. cDNA cloning and expression of human complement component C2. J . Immunol. 142:2105. 23. Green, M. R. 1991. Biochemical mechanisms of constitutive and regulated premRNA splicing. Annu. Rev. Cell Biol. 7359. 24. Wiirzner, R., B. A. Fernie, A. M. Jones, P. J. Lachmann, and M. J. Hobart. 1995. Molecular hasis of the complement C7 M/N polymorphism: a neutral amino acid
substitution outside the epitope of the allospecific monoclonal antibody WU 4-15,
J. Immunol. 154:4813. 25. Dewald, G., M. M. Nothen, and K. Riither. 1994. A common SerlThr polymorphism in the perforin-homologous region of human complement component C7. Hum. Hered. 44.301. 26. Wiirzner, R., M. J. Hohan, A. Orren, K. Tokunaga. R. Nitze, 0. Gotze, and P. J. Lachmann. 1992. A novel protein polymorphism of human complement C7 detected by a monoclonal antibody. Immunogenetics 35398. 27. h i , S., H. Kitamura, S. Hiramatsu. and K. Nagaki. 1979. Deficiency of the ninth component of complement in man. J. Clin. Lab. Immunol. 2.85. 28. Fukumori, Y., K. Yoshimura, S . Ohnoki, H. Yamaguchi, Y. Akagaki, and S. h i . 1989. A high incidence of C9 deficiency among healthy blood donors in Osaka, Japan. h t . Immunol. 1:85. 29. Kolhle, K., and K. B.M. Reid. 1993. Genetic deficiencies of the complement system and association with disease: early components. Int. Rev. Immunol. 10:17. 30. Krawczak, M., and D. N. Cooper. 1991. Gene deletions causing human genetic disease: mechanisms of mutagenesis and the role of the local DNA sequence environment. Hum. Genet. 86:425. 31. Streisinger, G., Y. Okada, J. Emricb, J. Newton, A. Tsugita, E. Terzaghi, and M. Inouye.1966. Frameshift mutations and the genetlc code. Cold Spring Harbor Symp. Quant. Biol. 31.77. 32. Losson, R., and F. Lacroute. 1979. Interference of nonsense mutations with eukaryotic messenger RNA stability. Proc. Natl. Acod. Sci. USA 76:5134. 33. Barker, G. F., and K. Beemon. 1991. Nonsense codons within the Rous sarcoma virus gag gene decrease the stability of unspliced viral RNA. Mol. Cell. Biol. 11:2760. 34. Leeds, P., S. W. Peltz, A. Jacobson, and M. R. Culbertson. 1991. The product of the yeast UPFI geneis required for rapid turnover of mRNAs containing a premature translational termination codon. Genes Dev. 5:2303. 35. Urlaub, G., P. J. Mitchell, C. J. Ciudad, and L. A. Chasin. 1989. Nonsense mutations in the dihydrofolate reductase gene affect RNA processing. Mol.Cell. Biol. 9.2868. 36. Cheng, J., and L. E. Maquat. 1993. Nonsense codons can reduce the abundance of nuclear mRNA without affecting the abundance of pre-mRNA or the half-life of cytoplasmic mRNA. Mol. Cell. Biol. 13:1892. 37. Kugler, W., J. Enssle, M. W. Hentze, and A. E. Kulozik. 1995. Nuclear degradation of nonsense mutated 6-globin mRNA: a post-transcriptional mechanism to protect heterozygotes from severe clinical manifestations of P-thalassemia? Nucleic Acids Res. 23.413. 38. Naeger, L. K., R.V. Schoborg, Q. Zhao, G. E. Tullis, and D. I. Pintel. 1992. Nonsense mutations inhibit splicing of MVM RNA in cis when they interrupt the reading frame of either exon of the final spliced product. Genes Dev. 6:1107. 39. Lozano, F., B. Maertzdorf, R. Pannell, and C. Milstein. 1994. Low cytoplasmic mRNA levels of immunoglobulin K light chain genes containing nonsense codons correlate with inefficient splicing. EMBO J. 13:4617. 40. Helenius, A,, T. Marquardt, and I. Braakman. 1992. The endoplasmic reticulum as a protein-folding compartment. Trends Cell Biol. 2.227. 41. Doolittle, R. F. 1995. The multiplicity of domains in proteins. Annu. Rev. Biochem. 64:287. 42. k e n , A., R. Wiirzner, P. C. Potter, B. A. Fernie, S. Coetzee, B. P. Morgan, and P. J. Lachmann. 1992. Properties of a low molecular weight complement cornponent C6 found in human subjects with subtotal C6 deficiency. Immunology 75:IO. 43. Wiirzner, R., A. Orren, P. Potter, B. P. Morgan, D. Ponard, P. Spath, M. Brai, M. Schulze, L. Happe, and 0. Gotze. 1991. Functionally active complement proteins C6 and C7 detected in C6- and C7-deficient individuals. Clin. Exp. Immunol. 83:430. 44. Haefliger, J. A., J. Tschopp, N. Vial, and D. E. Jenne. 1989. Complete primary structure and functional characterization of the sixth comvonent of the human complement system:identification of the C5b-binding domain in component C6. J. Biol. Chem. 264:1804/. 45. DiScipio, R. G. 1992. Formation and structure of the C5b-7 complex of the lytic pathway of complement. J. Biol. Chem. 267:17087.
